ID: 1117616422

View in Genome Browser
Species Human (GRCh38)
Location 14:57538223-57538245
Sequence TGGTTCGTAAGAGACATCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117616418_1117616422 7 Left 1117616418 14:57538193-57538215 CCCTCCTACTTAAAGAAGAAGAT No data
Right 1117616422 14:57538223-57538245 TGGTTCGTAAGAGACATCCTTGG No data
1117616419_1117616422 6 Left 1117616419 14:57538194-57538216 CCTCCTACTTAAAGAAGAAGATG No data
Right 1117616422 14:57538223-57538245 TGGTTCGTAAGAGACATCCTTGG No data
1117616420_1117616422 3 Left 1117616420 14:57538197-57538219 CCTACTTAAAGAAGAAGATGAAG No data
Right 1117616422 14:57538223-57538245 TGGTTCGTAAGAGACATCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117616422 Original CRISPR TGGTTCGTAAGAGACATCCT TGG Intergenic
No off target data available for this crispr