ID: 1117618067

View in Genome Browser
Species Human (GRCh38)
Location 14:57554473-57554495
Sequence GTTCAGCAGCTCCAAGCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117618067_1117618071 30 Left 1117618067 14:57554473-57554495 CCTATAGCTTGGAGCTGCTGAAC No data
Right 1117618071 14:57554526-57554548 GATTACAGAGCAAAGTTTCCAGG No data
1117618067_1117618069 5 Left 1117618067 14:57554473-57554495 CCTATAGCTTGGAGCTGCTGAAC No data
Right 1117618069 14:57554501-57554523 CTCTGATTTCGTATATCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117618067 Original CRISPR GTTCAGCAGCTCCAAGCTAT AGG (reversed) Intergenic
No off target data available for this crispr