ID: 1117619677

View in Genome Browser
Species Human (GRCh38)
Location 14:57572056-57572078
Sequence ATCCCTCTGTATCCTAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117619677 Original CRISPR ATCCCTCTGTATCCTAGAGC AGG Intronic
901630722 1:10646956-10646978 ACCCCTCTGCATCCTGGAGGCGG - Intronic
901859430 1:12064509-12064531 TTCCCTCTGTATCATTCAGCAGG - Intronic
903937917 1:26909566-26909588 ATCTCTCTGAATCCTCAAGCTGG - Intronic
904546605 1:31278995-31279017 ATCGCTCTGTACCATAGACCTGG - Intronic
906933383 1:50190758-50190780 TTCCCTCTGTACCCTAGCTCTGG + Intronic
915536300 1:156537925-156537947 CTCACTCTGTTGCCTAGAGCTGG + Intronic
1063146760 10:3302023-3302045 CTCCCTCTGTGTGCTTGAGCTGG + Intergenic
1063185508 10:3647094-3647116 CTCCCTCTATATCTCAGAGCAGG - Intergenic
1065974335 10:30829283-30829305 ATCCCTCAGTATCCAAGGCCAGG - Intronic
1067976803 10:51035562-51035584 AGCGCTCTGTGTCCTTGAGCAGG - Intronic
1069058239 10:63866830-63866852 ATTTCTCAGTATCCTGGAGCTGG + Intergenic
1069841004 10:71339447-71339469 ATCCCTCTGTTCCTCAGAGCTGG + Intronic
1073440106 10:103547511-103547533 ATCCCTCTGTAAGCTGGACCTGG + Intronic
1074115679 10:110456186-110456208 TTCCCTTTGTATCCAAGAGCTGG + Intergenic
1080278081 11:30525317-30525339 AGCCCCCTAAATCCTAGAGCAGG - Intronic
1081716755 11:45255976-45255998 CTCCCTCTGCATCCTACAACAGG - Intronic
1082026625 11:47577453-47577475 ATTCCTCTGTATTCTGCAGCTGG + Exonic
1092636357 12:10454834-10454856 CTCCCTCTGTATCCCTGAGCTGG - Intergenic
1094088412 12:26620077-26620099 GTCCCTCTGTATCACAGAGCTGG + Intronic
1094585368 12:31772783-31772805 ATCTCTCTGTCTCCTATAGCAGG + Intergenic
1100108381 12:91206519-91206541 CTCCCTCTTTATCTCAGAGCTGG + Intergenic
1101011601 12:100456634-100456656 ATCCCTCTGATTCTTAGAGAAGG + Intergenic
1101237074 12:102800513-102800535 ATGCCTGTGCTTCCTAGAGCAGG + Intergenic
1101397205 12:104358866-104358888 ATACCTCTGTGACCTAGAGGTGG + Intergenic
1102201272 12:111059579-111059601 AGCTTTCTGTATCCTAGAGGTGG + Intronic
1103349509 12:120274074-120274096 CTCCCTCTGTCACCCAGAGCTGG + Intergenic
1103992210 12:124806870-124806892 ATCACTCTGTAGCCTGGAGCTGG - Intronic
1105752719 13:23436333-23436355 CTCCCTCTCTCTCCTTGAGCTGG + Intergenic
1108372402 13:49783428-49783450 CTCCCTCTGTATCCTCGGGGGGG + Intronic
1112959499 13:105106174-105106196 ATCCATCATTATTCTAGAGCTGG - Intergenic
1117619677 14:57572056-57572078 ATCCCTCTGTATCCTAGAGCAGG + Intronic
1119126349 14:72130778-72130800 ATCCCACTTTCCCCTAGAGCAGG + Intronic
1124458911 15:29870972-29870994 AGCCCTCTGTGTCCTGGGGCTGG - Intronic
1126537017 15:49777559-49777581 TTCCTTCTGTATCCTTGACCTGG + Intergenic
1130688316 15:86058547-86058569 CTACCTGTGTATCCTTGAGCAGG - Intergenic
1130973838 15:88757542-88757564 AAGCATCCGTATCCTAGAGCTGG - Intergenic
1133768596 16:8854786-8854808 ATCCCTCTTCCTCCTGGAGCTGG - Exonic
1137764254 16:50965635-50965657 ATCCCTCTGTGAGGTAGAGCAGG - Intergenic
1138983871 16:62303293-62303315 ATCCCTCTGAATTCTAGTTCAGG - Intergenic
1140885407 16:79238359-79238381 TTCCCTTTGTATCTAAGAGCGGG + Intergenic
1141201901 16:81904616-81904638 TTCCCTCTGTGTGCTAGAGAAGG + Intronic
1142325372 16:89411441-89411463 ATCCTTCTGTCACCTAGAGCTGG + Intronic
1143862906 17:9904209-9904231 CTCACTCTGTAGCCCAGAGCTGG - Intronic
1146600354 17:34209255-34209277 GTCCATCTATATGCTAGAGCTGG - Intergenic
1146831063 17:36070001-36070023 CTCCCTCTGTCTCCCAGAGGTGG - Intronic
1148957220 17:51363835-51363857 CTCCCTCTGAAACCTGGAGCAGG + Intergenic
1152312663 17:79560289-79560311 ATCCCTGTGTATGTGAGAGCTGG - Intergenic
1160946007 19:1644404-1644426 ACCCCTCTGTGTCCAGGAGCTGG + Intronic
1164719464 19:30421812-30421834 CTCCCTCTGTACACGAGAGCAGG + Intronic
1164737827 19:30554808-30554830 ATCCCTCTTTACACCAGAGCAGG - Intronic
928796811 2:35033257-35033279 TTCACTCTGTATTCTAGAGCTGG - Intergenic
929619583 2:43341302-43341324 ATTCCTTTGTCTTCTAGAGCTGG + Intronic
929666680 2:43838960-43838982 TTCACTCTGTTTCCTGGAGCAGG - Exonic
929934753 2:46286497-46286519 ATCCCTCTGGATCCTAGGAGAGG + Intergenic
930073479 2:47388188-47388210 TTCCCCCAGCATCCTAGAGCAGG - Intergenic
933849240 2:86352430-86352452 CTCCCTCTGTCTCCTGGAGCTGG + Intergenic
934847346 2:97670593-97670615 CTCCCTCTGTCACCCAGAGCTGG + Intergenic
937311067 2:120903840-120903862 ATCCCTCTGGATCCTTGGGGAGG - Intronic
939992754 2:148890676-148890698 ATTCCACTCTATCCTATAGCTGG + Intronic
945898139 2:215507943-215507965 CACCCTCTTTATCCTAGAGCTGG - Intergenic
947110809 2:226717479-226717501 ATACCTTTGTTACCTAGAGCAGG - Intergenic
947179393 2:227398847-227398869 ATTTCTCTGTATTCTAAAGCAGG + Intergenic
948703111 2:239773071-239773093 ATCCCACTGTCTGGTAGAGCAGG + Intronic
1169129819 20:3160336-3160358 CTCGCTCTGTGTCCCAGAGCTGG - Intergenic
1169787142 20:9371022-9371044 GTCCCTCTGGTTCCCAGAGCTGG - Intronic
1170842980 20:19939071-19939093 CTCGCTCTGTTGCCTAGAGCTGG + Intronic
1172481502 20:35274504-35274526 GTCCCTCTGCATCCTGGTGCTGG + Exonic
1172512167 20:35508342-35508364 CTTGCTCTGTCTCCTAGAGCTGG + Intronic
1172647775 20:36482118-36482140 ATCCCTCGGCAGCCTAGAGTTGG - Intronic
1174373776 20:50112364-50112386 ATCCATCTGTATCCTCGAACAGG + Intronic
1175286680 20:57841304-57841326 ATCCGTTTGTCTCCTAGAGCTGG + Intergenic
1177695878 21:24569588-24569610 ATCTCTCTGTCTCCTTGAGCTGG - Intergenic
1178527412 21:33342943-33342965 ATCCCTCTGTAGCATAGATGTGG + Intronic
1178538654 21:33431046-33431068 ATCCCTCTGCTGCCTTGAGCAGG - Intronic
1179673195 21:42964165-42964187 ATTCCTCTGTAGCCTGGAGAGGG + Intergenic
1181527112 22:23496269-23496291 ATCCATCTGCCTCCCAGAGCAGG - Intergenic
1182511720 22:30824796-30824818 ATCCCTCGGCATCCCGGAGCAGG - Intronic
949928669 3:9061200-9061222 CTCCCTCTGTCACCTAGACCTGG - Intronic
958518148 3:95148191-95148213 GTCTCTCTCTATCCTGGAGCTGG - Intergenic
958689198 3:97440083-97440105 ATCCGTATGTATCCTAAAGTGGG - Intronic
961500503 3:127329707-127329729 CTCCCTCTGGATCCTTGGGCTGG - Intergenic
962842023 3:139242435-139242457 AAATCTCTGTATCCTAGAGATGG - Intronic
962940752 3:140122725-140122747 TTCCCTTGGTTTCCTAGAGCAGG + Intronic
964521381 3:157572810-157572832 ATCCCACTGGATACTAGAGTGGG + Intronic
965783622 3:172314054-172314076 ATCCCTCTGAATCCTTCTGCTGG + Intronic
966821832 3:183930899-183930921 ATGCCTCTGGATCAAAGAGCAGG + Intronic
978911062 4:114064586-114064608 CTCCCTCAGTATCAAAGAGCAGG + Intergenic
983138133 4:164111166-164111188 ATTACTCTGTATCCTAAAGATGG + Intronic
985801049 5:2005438-2005460 ATCCCGCTGTGCCCTAGAGAGGG - Intergenic
985805838 5:2042598-2042620 ATCACACTGTCCCCTAGAGCTGG + Intergenic
986104424 5:4646081-4646103 ATCCCTCTGTATCACAGTGGAGG - Intergenic
986995492 5:13602581-13602603 ATCCCTCTGCATCATGGACCTGG - Intergenic
987859418 5:23465430-23465452 ATCCCACTGGTTCCCAGAGCTGG + Intergenic
988205222 5:28125155-28125177 ATCGGTCTGTATTCTAGAGTTGG + Intergenic
993880404 5:93353888-93353910 ATCCATCTTTATCCTTTAGCAGG + Intergenic
994373696 5:98994790-98994812 GTCCATCTATTTCCTAGAGCTGG + Intergenic
997054286 5:130422343-130422365 AGCCCTCTGCAGTCTAGAGCTGG + Intergenic
1003724918 6:8750297-8750319 ATCGCTCTGTTTCCTACTGCAGG - Intergenic
1004003246 6:11615092-11615114 TTCCCTCGGTATTCTAGTGCGGG + Intergenic
1004286943 6:14329968-14329990 ATCCCTGAGTATCTGAGAGCTGG - Intergenic
1004735534 6:18402448-18402470 ATATCTCTGTTTCCCAGAGCTGG - Intronic
1005774546 6:29116500-29116522 ATCCCCCTGAAGCCTGGAGCTGG + Intergenic
1007584403 6:42979914-42979936 TTCACTTTCTATCCTAGAGCGGG + Intergenic
1011135474 6:84095262-84095284 CTCCCTCTGGAGCATAGAGCAGG - Intergenic
1012494437 6:99818966-99818988 CTCTCTCTTTCTCCTAGAGCTGG + Intergenic
1013221774 6:108083965-108083987 ATTCCTCTGTGGCCTAGAGTAGG - Intronic
1018496977 6:164358879-164358901 ATCCCTCTGCCTCCCAGAACTGG + Intergenic
1022265923 7:28754766-28754788 ATCCCTCTCTATTGTAAAGCAGG - Intronic
1026054202 7:66970622-66970644 AGCCCTCTGCATCCTTCAGCAGG - Intergenic
1026391332 7:69905554-69905576 CTCTCTCTCTCTCCTAGAGCTGG - Intronic
1029273769 7:99392553-99392575 GCCCGTCTGTATCCTTGAGCTGG + Intronic
1033718284 7:144026313-144026335 CTCTCTCTCTTTCCTAGAGCTGG + Intergenic
1035077345 7:156189505-156189527 CTCTCTCTGTCTCCCAGAGCTGG - Intergenic
1035083150 7:156233921-156233943 AGCATTCTGCATCCTAGAGCAGG - Intergenic
1040221879 8:45168692-45168714 AACCTTCCGTATCATAGAGCAGG + Intergenic
1043131969 8:76473117-76473139 ATCCCTCTGGACACTTGAGCTGG - Intergenic
1048221376 8:132545248-132545270 AATCCTCTGTCTCCCAGAGCAGG + Intergenic
1051769974 9:20566862-20566884 ATTCCTCCGTATCCTTGTGCTGG - Intronic
1054969673 9:71070809-71070831 AGCACTCTCTATCCTAGAGTGGG + Intronic
1059658070 9:116374466-116374488 ACCCCTCTGTGTGCTAGAACTGG - Intronic
1060816789 9:126639280-126639302 GTCCCTCTGCATCCTGGGGCCGG + Intronic
1061259581 9:129472555-129472577 ATCCATCTGCCTCCCAGAGCAGG + Intergenic
1189385108 X:40530890-40530912 TTTCCTCTTTTTCCTAGAGCTGG + Intergenic
1189607650 X:42696912-42696934 AGCTCTCTGAATCCCAGAGCTGG - Intergenic