ID: 1117619752

View in Genome Browser
Species Human (GRCh38)
Location 14:57573305-57573327
Sequence ACTCCTGCTGTTTTTCATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 265}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117619752 Original CRISPR ACTCCTGCTGTTTTTCATTA AGG (reversed) Intronic
902419451 1:16266908-16266930 ACACCAGCAGTTTTTCTTTAAGG - Intronic
902967842 1:20022913-20022935 ATTCATACTGTTTTTCATAATGG + Intergenic
904536815 1:31204851-31204873 CCTCCTGCTTGTTTTCATTCTGG - Intronic
905622415 1:39460034-39460056 AGGCCTGCTGTTTTCCATCAAGG + Intronic
906720781 1:48002737-48002759 ATTCATTCTGTTTTTCATAATGG + Intergenic
908995605 1:70149372-70149394 ACTATTGCTTTTTTTCATCAAGG - Intronic
909263483 1:73526388-73526410 CCTCATACTGTTTTTCATAATGG + Intergenic
909655028 1:78022004-78022026 ACTGCTGCTGTTTTTGCTAAAGG + Intronic
910110682 1:83679680-83679702 ATTCATACTGTTTTTCATAATGG + Intergenic
911652996 1:100410854-100410876 TCTCCTGCTCCTTTTTATTAAGG + Intronic
912003723 1:104866712-104866734 ACTCATGCTGTTTTTGTTAAAGG + Intergenic
912758939 1:112348735-112348757 ACTGCTTATTTTTTTCATTATGG - Intergenic
913153607 1:116071293-116071315 AGTTTTGCTGTTTTTCATTGAGG - Intergenic
918345525 1:183604264-183604286 GCTCCAGCTGTCTTTAATTAGGG - Intergenic
918843045 1:189569229-189569251 TCTCATACTGTTTTTCATAATGG - Intergenic
919373160 1:196757381-196757403 ATTCCTGGTGTTCTTCACTAAGG + Intergenic
919379604 1:196842058-196842080 ATTCCTGGTGTTCTTCACTAAGG + Intronic
921114432 1:212074646-212074668 ACTCCTCCTTTTTTTAATCATGG - Intronic
921730438 1:218572209-218572231 ATTCCTGCTGTAGGTCATTAGGG - Intergenic
922968132 1:229709832-229709854 ACTCCAGCTGTTTTCCTTCAGGG + Intergenic
923325093 1:232873811-232873833 ACACCTGCTGGTTTTCAGAAAGG - Intergenic
924649675 1:245914191-245914213 CCTCATGCTGTTTTCCATAATGG - Intronic
1064145162 10:12821166-12821188 CCTCTTCCTGTTTTTCATGAGGG + Intronic
1064460134 10:15526862-15526884 AATCTTGTTGTTTTTTATTATGG + Intronic
1065467518 10:26041208-26041230 ACTCCTGCTTTTTTTGGTTCCGG + Intronic
1065518151 10:26545237-26545259 ACTCTTGCTATTCTTTATTAGGG + Intronic
1066275250 10:33862443-33862465 ACTCCTGCTGGTTTCCATATCGG + Intergenic
1067719747 10:48719352-48719374 GCTTCTGAAGTTTTTCATTAAGG + Intronic
1067897148 10:50195462-50195484 CCTCTTGCTGCTTTTCATAATGG - Intronic
1067951820 10:50746573-50746595 CCTCTTGCTGCTTTTCATAATGG + Intronic
1071101056 10:82038077-82038099 AATCTTGCTTTTGTTCATTATGG + Intronic
1074616076 10:115069451-115069473 ACTCATGCTGTTTTTCATTGGGG + Intergenic
1075315769 10:121452088-121452110 AATCCAGCTGTTTTCTATTAAGG + Intergenic
1075711279 10:124531935-124531957 ACTCCTGGTGTTTTACTTTAAGG + Intronic
1078194862 11:9127848-9127870 ACATCTACTGTTTTTGATTATGG - Intronic
1078865684 11:15295305-15295327 ACTCCCTCTGTTCTTCATTAAGG - Intergenic
1078962929 11:16300636-16300658 ATTCCTGCTGTTTTGCAACAGGG - Intronic
1079821123 11:25130345-25130367 AGGCCTGCTGTTTTCCATTTCGG + Intergenic
1082741822 11:56919129-56919151 ACTCCTGCTGACTTGCATTGGGG + Intergenic
1084829518 11:71758132-71758154 CCTCCTGGTGTTATTCATTGTGG + Intergenic
1089999746 11:122946304-122946326 ACTCCTCCTCTTTTTCCTTTAGG - Intronic
1090450762 11:126804099-126804121 ACTCTGGCTGTATTTCAATAAGG + Intronic
1092413722 12:8273563-8273585 CCTCCTGGTGTTATTCATTGTGG - Intergenic
1092830017 12:12434589-12434611 ATTCCAGCTGTTTTCTATTAAGG + Intronic
1093592468 12:20919283-20919305 ATCCATGCTGTTTTTCATAATGG + Intergenic
1093853776 12:24073164-24073186 CTTCCAGCTGTTTTTCATCAAGG + Intergenic
1095321193 12:40829705-40829727 ACACCTGAAGTTTTTCCTTAGGG + Intronic
1097515830 12:60604453-60604475 ACTGCTGCTGTTTGTCAGAATGG - Intergenic
1097641459 12:62188338-62188360 ACTTCTGCAGTATTTTATTAGGG - Intronic
1098678388 12:73319586-73319608 CCTCCTGCTGTTTTCCAAGAAGG + Intergenic
1099455582 12:82858965-82858987 ATTCCTGCTCTTTGTCCTTAGGG + Intronic
1099741902 12:86648482-86648504 ACTCCTCCTCTTTTTCACAAGGG - Intronic
1100455305 12:94745815-94745837 ACTCCTGCTTCTCTTCTTTAAGG + Intergenic
1101462659 12:104912617-104912639 ACTCTACCTGTTTCTCATTAAGG - Intronic
1105581647 13:21703374-21703396 CCTCCTGCTGATGTGCATTAAGG + Exonic
1107348880 13:39493056-39493078 ACTCCTGCTGTTGGTCATTCAGG + Intronic
1108771488 13:53706986-53707008 AGTCCTGCTATTTTTCATTAAGG - Intergenic
1108995206 13:56722839-56722861 ACTCTTGGTGTTTTACATTCTGG - Intergenic
1110130775 13:72006827-72006849 CTTCCTGCTGTTTTCCATAATGG - Intergenic
1110821193 13:79918877-79918899 ACTCTCGCTGCTTTCCATTAAGG - Intergenic
1111331399 13:86764389-86764411 ACTCCAGATGTTTTTCAATTTGG + Intergenic
1112109026 13:96274131-96274153 ACTCCCGCTCTTTCTTATTAAGG + Intronic
1112217526 13:97448857-97448879 CCTCCTGTTGCTTTTCCTTAGGG - Intronic
1112650964 13:101398092-101398114 ATTCCTGCTTCTTTTCATTCAGG - Intronic
1113344840 13:109467183-109467205 ACTCTTGCTGTGTATCATTGTGG - Intergenic
1114138070 14:19876333-19876355 ACTACAGATGTTTTTCTTTATGG + Exonic
1114974453 14:28077084-28077106 ACTACTGTTTTTTTTCATTTTGG - Intergenic
1116177973 14:41497413-41497435 AATCCTGATGCTTTGCATTATGG + Intergenic
1117124224 14:52603837-52603859 CCTCATACTGTTTTTCATAACGG + Intronic
1117619752 14:57573305-57573327 ACTCCTGCTGTTTTTCATTAAGG - Intronic
1117799519 14:59428636-59428658 CCTCTTGCTTTTTTTCCTTAAGG - Intergenic
1118982861 14:70730391-70730413 ACTCCTGCTGGATCTCATAAGGG + Exonic
1121807312 14:96840426-96840448 TCTCCTGCTTCTTTTCATGATGG + Intronic
1122177447 14:99931538-99931560 TCTCCAGCTGATTTTCATTTTGG + Intronic
1125964652 15:43864324-43864346 CCTCATACTGTTTTCCATTATGG + Intronic
1126431528 15:48590218-48590240 TCTCCTGGTGTTTTTCAGGAAGG - Intronic
1130630998 15:85569110-85569132 ATTGCTGCTGCTTTTGATTATGG + Intronic
1133354889 16:5128750-5128772 CCTCCTGGTATTATTCATTATGG - Intergenic
1134488677 16:14679119-14679141 ACTCCTGCTTTTTGTTATTGGGG + Intronic
1136739518 16:32503674-32503696 ATTCCTTCTGTTTTTTATCATGG - Intergenic
1138074207 16:54025094-54025116 ACTCCTTCAGACTTTCATTAAGG - Intronic
1138132595 16:54493632-54493654 ACCACTGCTCTTTTTCATAATGG - Intergenic
1138955178 16:61962852-61962874 ACTTCTGTTTTTTTTCTTTATGG + Intronic
1139007964 16:62596522-62596544 AATACTGCTGTGTTTCATCAAGG + Intergenic
1139044769 16:63043353-63043375 ACTCCTACTGCTTTTCATAGTGG + Intergenic
1140243766 16:73229662-73229684 ACTCATGCTTTTATTCAGTAAGG + Intergenic
1203013700 16_KI270728v1_random:328122-328144 ATTCCTTCTGTTTTTTATCATGG + Intergenic
1203032035 16_KI270728v1_random:601281-601303 ATTCCTTCTGTTTTTTATCATGG + Intergenic
1203039686 16_KI270728v1_random:733150-733172 ATTCCTTCTGTTTTTTATCATGG - Intergenic
1144659526 17:17059214-17059236 AACCCAGCTGTCTTTCATTATGG - Intronic
1145193071 17:20864545-20864567 GCACCTTCTGTTTTTCTTTAAGG + Exonic
1145298951 17:21616574-21616596 GCACCTTCTGTTTTTCTTTAAGG - Intergenic
1145351333 17:22086711-22086733 GCACCTTCTGTTTTTCTTTAAGG + Intergenic
1145403484 17:22566547-22566569 GCACCTTCTGTTTTTCTTTAAGG + Intergenic
1145739674 17:27262667-27262689 ACTCTTGCTCTTTCTAATTAGGG + Intergenic
1147945841 17:44079742-44079764 ACTGATGCTGTATTTTATTATGG - Intronic
1148137405 17:45303090-45303112 ACTTCTGCTGTTTTTCACTCTGG - Intronic
1149980582 17:61308169-61308191 ACTCCTGGTGTTGTTGTTTATGG + Intronic
1150450747 17:65265633-65265655 ACTCCTGCTGTTATTGACAAAGG + Intergenic
1151577984 17:74962486-74962508 ACTCCTGCTCTTGTGCATGAGGG - Intronic
1152194804 17:78911288-78911310 ACTCCTGCCTTTCTTCCTTAAGG + Intronic
1152825176 17:82460114-82460136 ACTGCTGCTGTTTTTCTCTTTGG + Intronic
1153377791 18:4400367-4400389 TCTCCTGCTGTTGTTCAGAACGG + Intronic
1156837126 18:41567695-41567717 ACTTCTGCTGTGCTTCTTTAAGG - Intergenic
1156929736 18:42627398-42627420 ACTGCTGCTGTTCTGTATTATGG - Intergenic
1157635757 18:49152554-49152576 CCTCCTGCTGCTTTTCATAATGG - Intronic
1158258268 18:55578312-55578334 CCTCATGCTGCTTTTAATTAAGG - Intronic
1159851244 18:73529312-73529334 AGGCCTGCTGTTCTTCATTTTGG + Intergenic
1161214121 19:3084844-3084866 ACGCCGGCTGATTTTCTTTATGG + Intergenic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
925930868 2:8706769-8706791 ACTGCTGCTGCTTTTCATTCTGG - Intergenic
926767874 2:16338154-16338176 ATCCCTGCTGTTTTTGATGATGG - Intergenic
927149795 2:20189002-20189024 GCCCCAGGTGTTTTTCATTAAGG + Intergenic
930655341 2:54002229-54002251 ACTCCTGCTGTATAACATTCTGG - Intronic
930890774 2:56384244-56384266 ACTCCTTCTTTTTTTTTTTAAGG + Exonic
931045164 2:58343082-58343104 TCTCTTGTTGTTTATCATTATGG - Intergenic
931517919 2:63060999-63061021 ACTTATTCTGTTTTTAATTAGGG - Intergenic
931578806 2:63751009-63751031 CCTCCTTCTGTTTTTTATAAGGG + Intronic
934490739 2:94760708-94760730 CCTCTTGCTGTTTTCCTTTATGG + Intergenic
935526647 2:104178835-104178857 ACTCCTGCTGTCTTTCTTTGTGG + Intergenic
939304341 2:140390960-140390982 TCTCTTGCTGGTTTTCATAAAGG + Intronic
939594871 2:144110784-144110806 ACTCCTGCTGCCTTACATGATGG - Intronic
939866139 2:147474798-147474820 AGTCTTCCTGTTTTTCATTGGGG + Intergenic
939976737 2:148726364-148726386 ACTACTCCTGTTTTTCATAAGGG + Intronic
942208551 2:173647933-173647955 AGTCCTTCTGTCTCTCATTAAGG - Intergenic
943395955 2:187334646-187334668 TTTCATGCTGTTTTTCATAAAGG - Intergenic
944475665 2:200102766-200102788 TCTCATGCTGTTTTTTATTTTGG + Intergenic
944791003 2:203126845-203126867 TCTCCTGCTGTCTTTAATGATGG - Exonic
945379005 2:209116727-209116749 ACTCCTGCTTTTATTCATTTTGG + Intergenic
947369686 2:229432308-229432330 ATTCCAGAAGTTTTTCATTATGG + Intronic
947419401 2:229928650-229928672 ACTCCTGCTGTTTTTGTGGAAGG + Intronic
1170463687 20:16602871-16602893 ACTCTCACTGTTTTTCTTTAGGG + Intergenic
1170492282 20:16889894-16889916 GCTCCTGCAGTGTTTCATCATGG - Intergenic
1171516000 20:25736405-25736427 AATCATGCTGTTTTCCATAATGG + Intergenic
1171561582 20:26131696-26131718 GCACCTTCTGTTTTTCTTTAAGG + Intergenic
1173185020 20:40833840-40833862 GCGCCTGCTGTTTTGCATAAGGG - Intergenic
1173429784 20:42976699-42976721 ACTCAGGCTGTTTATTATTATGG + Intronic
1174669817 20:52296624-52296646 AGTCCAGCTGTTTGTCCTTATGG + Intergenic
1176649670 21:9533605-9533627 GCACCTTCTGTTTTTCTTTAAGG - Intergenic
1177428367 21:20956053-20956075 ACTCTTGTTGCTTTCCATTAAGG - Intergenic
1178148684 21:29769261-29769283 ACTCCTGTTGTATGGCATTAGGG - Intronic
1178270140 21:31182151-31182173 GCTTCTGCTGTTTCTCATTTTGG - Intronic
1179260380 21:39752583-39752605 CCTCCTACTGTTTTTCATAGTGG + Intronic
1179992653 21:44956694-44956716 TCTCATGCTGATTTTCCTTAGGG + Intronic
1180849133 22:19004050-19004072 ACCCCTGCTTTTTTCCCTTAGGG + Intergenic
1181664385 22:24382234-24382256 ACCCCTGCTTTTTTCCCTTAGGG + Intronic
1184605244 22:45569316-45569338 ACTCCTGCTGTATTGGATTAGGG - Intronic
950087957 3:10274128-10274150 ACTCCTGTTGTTTTTCAGCTGGG + Intronic
950773394 3:15330290-15330312 GCACATGTTGTTTTTCATTATGG - Intronic
951781082 3:26363224-26363246 ACTCTTGGAGTATTTCATTAAGG - Intergenic
954846869 3:53566882-53566904 ACCCCTGCTGTTTTCCTTCAGGG + Intronic
957447683 3:80336630-80336652 ACTCCTGTTGTTTATGATTGTGG + Intergenic
959146484 3:102551869-102551891 ACTCCTACTGTCATTAATTAGGG + Intergenic
959499749 3:107092522-107092544 ATTCCTGTTTTTTTTCCTTAGGG - Intergenic
960568291 3:119158113-119158135 AATCCTGCTGTCTTTCTGTATGG - Intronic
960656884 3:120014578-120014600 TATCCTGCTGTTGATCATTAGGG - Intronic
961294686 3:125875286-125875308 CCTCCTGGTGTTATTCATTGTGG + Intergenic
961891275 3:130132195-130132217 CCTCCTGGTGTTATTCATTGTGG - Intergenic
961971999 3:130977811-130977833 AATCTTTCTGTTCTTCATTACGG - Intronic
962465559 3:135654901-135654923 GCTACTGCTGATGTTCATTAAGG - Intergenic
964434908 3:156641254-156641276 ACTCCTGCTTGTCTTCATGATGG + Intergenic
964640744 3:158907546-158907568 ACTACAGCTGTTTTGCATTGTGG - Intergenic
964643152 3:158931255-158931277 TCTCCTGCTGCCTTTCATTAGGG - Intergenic
965960120 3:174418920-174418942 TCTCCTGTTCTTTGTCATTATGG - Intergenic
967707620 3:192670164-192670186 AATCCAGCTGTCTTTTATTAAGG + Intronic
969002667 4:3994636-3994658 CCTCCTGGTGTTATTCATTGTGG - Intergenic
969751355 4:9113892-9113914 CCTCCTGGTGTTATTCATTGTGG + Intergenic
969811264 4:9650176-9650198 CCTCCTGGTGTTATTCATTGTGG + Intergenic
970618204 4:17788086-17788108 ACTCCTGCTGTTTTTGGTGGTGG + Intergenic
972477928 4:39470001-39470023 AGTCCTGCTGTTTTCCAGTAAGG + Exonic
973164012 4:47054447-47054469 ACACCTGCTGCTATTCATGAAGG - Intronic
973928317 4:55762901-55762923 AGTCTTTGTGTTTTTCATTAGGG - Intergenic
973985403 4:56347553-56347575 ACTGCTGCTTAGTTTCATTAAGG - Intronic
975184194 4:71382128-71382150 ACTCCTGATGTTTTTGGTTAAGG + Intronic
978292783 4:107165188-107165210 ACTCAAGCTGTTTTCCATAATGG - Intronic
979024188 4:115546911-115546933 CTTCATGCTGTTTTTTATTAGGG - Intergenic
979573960 4:122264552-122264574 GCTCCTCCTGTTTTGCATGAAGG - Intronic
981663885 4:147199639-147199661 ACATCTGTTGGTTTTCATTATGG - Intergenic
981670648 4:147282882-147282904 CCTCCTACTGTTTTCCATAATGG - Intergenic
982123480 4:152163869-152163891 ACCCCTGCTGTTTTCCTTTGAGG + Intergenic
982447965 4:155516643-155516665 AATCCTGCAGTTTTTTATTGTGG - Intergenic
982487856 4:155989502-155989524 AATTCTGCTGTTATTCCTTAGGG - Intergenic
982898506 4:160966258-160966280 CTTCATGCTGTTTTTCATAATGG + Intergenic
984170768 4:176356884-176356906 AAAGCTGCTGTTTTTCCTTATGG - Intergenic
986049385 5:4074307-4074329 TCTCTTGCTGTTTTTCACTGTGG + Intergenic
986840361 5:11689675-11689697 ACTGCTTCTGTATTTTATTATGG + Intronic
988018633 5:25595002-25595024 ACTTAGGCTGCTTTTCATTATGG - Intergenic
988198148 5:28034247-28034269 ACTAGTGCTGTTTTACATAATGG - Intergenic
988256021 5:28821197-28821219 ACTGCTGCTGTTTTGGGTTATGG + Intergenic
988982720 5:36587564-36587586 ACTTCTGCTGCATTTTATTAAGG - Intergenic
991440344 5:66640802-66640824 TCTCATACTGTTTTTCATAATGG + Intronic
992256517 5:74926749-74926771 ACTCCTGCTATTTTCTTTTAGGG - Intergenic
992269045 5:75047240-75047262 ACTCCTACAGTTTTTCAGTTGGG - Intergenic
995079610 5:108033859-108033881 ACTCTTATTATTTTTCATTAAGG + Intronic
995565047 5:113425767-113425789 ACGAGTGTTGTTTTTCATTAGGG + Intronic
995674690 5:114650299-114650321 ACTCATGCTGTTTATCAGGATGG + Intergenic
999637578 5:153638925-153638947 CCTCCTGCTTTCTTTCTTTAAGG - Intronic
1000133787 5:158324678-158324700 ACTCCTGTTGCTATTCAATATGG + Intergenic
1000170769 5:158701123-158701145 ACTCCCGCTGTCTTTAATAAAGG - Intronic
1000656498 5:163885521-163885543 ACTCCAGCTGCTTTTGACTACGG + Intergenic
1002404036 5:179014938-179014960 ACTCCTGTTGTTTTTCTCTTGGG - Intergenic
1002551843 5:179999937-179999959 TCTCCTATTGTTTATCATTAAGG + Intronic
1003521144 6:6859642-6859664 AGCCCTGCTGTTTATGATTATGG + Intergenic
1005256018 6:24003965-24003987 AATCCTGCAGCTTTTCATTATGG + Intergenic
1005913467 6:30330774-30330796 ACTTCTGCAGTTTTTCCTGAGGG - Exonic
1005915496 6:30347106-30347128 ACTGCTGCTGTTTTTAAACAAGG + Intergenic
1008075294 6:47139358-47139380 ACCCCTTCTGCTTTTCATTTGGG - Intergenic
1008187837 6:48416365-48416387 CTTCATGCTGTTTTTCATAATGG + Intergenic
1008777401 6:55057375-55057397 ATTCATACTCTTTTTCATTATGG + Intergenic
1009700064 6:67165376-67165398 AGTTCTGCTTTTTTGCATTATGG - Intergenic
1010365263 6:75043324-75043346 TATCTTGTTGTTTTTCATTATGG - Intergenic
1010605761 6:77888348-77888370 TCTCTTACTGTTTGTCATTATGG + Intronic
1010618763 6:78047006-78047028 AATTCTGCTGTTTTCCATAAAGG + Intergenic
1011419180 6:87154023-87154045 ACTGATACTGTTTTTCATAAGGG + Intronic
1011836293 6:91435484-91435506 ACTTATGCTGTTTTACTTTAAGG - Intergenic
1012090032 6:94880584-94880606 ACTGCTCCTGTTTTTCAATGTGG - Intergenic
1013828191 6:114240579-114240601 TCTACTGCAGTTTTTCATGAAGG - Intronic
1013943945 6:115699816-115699838 ACTCCATATGTTTTTCATAATGG + Intergenic
1016600974 6:145859776-145859798 TCTGCTACTCTTTTTCATTATGG - Intergenic
1017200408 6:151747426-151747448 ACTCATGCTATTTTTCTTTCTGG + Intronic
1017803559 6:157922367-157922389 ACTCCTGCTTTTATTCTTTAGGG - Intronic
1018545156 6:164927775-164927797 GCTTCTGCTGTCTCTCATTAAGG + Intergenic
1019186327 6:170222735-170222757 ACTTCTGTTGTTGTTCACTATGG - Intergenic
1019865914 7:3709846-3709868 CCTCCTGCTGTTTGTCATCAAGG + Intronic
1020321613 7:6942757-6942779 CCTCCTGGTGTTATTCATTGTGG - Intergenic
1020718005 7:11702379-11702401 ATTCTTGCTGTTTGTCAGTAGGG + Intronic
1022944816 7:35271915-35271937 TCTCCTGCTCTGTTTCATAAGGG - Intergenic
1022985900 7:35652986-35653008 TCTCATGTTGTTTTTCATTGTGG - Intronic
1023486164 7:40689524-40689546 ACTCCTGCTGATCTTCCATAAGG + Intronic
1025276242 7:57583682-57583704 GCACCTTCTGTTTTTCTTTAAGG - Intergenic
1025526739 7:61822899-61822921 ATTCCTTCTATTTTTTATTATGG - Intergenic
1025575565 7:62636232-62636254 GCTCCTTCTCGTTTTCATTATGG + Intergenic
1026365648 7:69645790-69645812 GCTCCTGCTGTGTTACCTTAGGG + Intronic
1029744770 7:102510805-102510827 TCTCCAGCTGTTTTACATTTGGG + Intronic
1029762762 7:102609967-102609989 TCTCCAGCTGTTTTACATTTGGG + Intronic
1031056856 7:117001381-117001403 TTTCCTGCTGTTTTCTATTATGG + Intronic
1031621070 7:123934410-123934432 ACTCCTACTGTTTTCCATAATGG - Intronic
1033391493 7:140932822-140932844 ACTCCTGCTTCTTTTCTTGAAGG + Intergenic
1033766102 7:144492099-144492121 TCTTCTACTGTTTTTCAGTAGGG + Intronic
1036628197 8:10490350-10490372 TCTCCTGCTCTTTTTCATGATGG + Intergenic
1037676882 8:21058855-21058877 ACCCCTTCTGTTTATCAATAAGG + Intergenic
1038396442 8:27249116-27249138 ACTCATTCTGTGTTTCCTTACGG - Intronic
1038815852 8:30903328-30903350 AGTCCAGCTGCTTTTCATCACGG + Intergenic
1040559117 8:48508228-48508250 AGTCCTGGTGCTTTCCATTAAGG - Intergenic
1040837508 8:51747840-51747862 ACTCCTGCTATTTTGGAATAAGG - Intronic
1041105216 8:54436085-54436107 ACTCCTTCTGTTTATTATTAAGG - Intergenic
1042020265 8:64365785-64365807 ACTAGTGTTGTTTTTCATGATGG - Intergenic
1042078822 8:65026771-65026793 ACTACTACTGTTTTTCAGTCTGG - Intergenic
1045166189 8:99607947-99607969 AATCTAGCTGTCTTTCATTAAGG - Intronic
1045589184 8:103574441-103574463 ACTCCTGCTCTAGTTTATTATGG + Intronic
1045836189 8:106524460-106524482 GCTCCTGATGTTTTTCTATATGG + Intronic
1046164353 8:110410751-110410773 TTTCATGCTGTTTTTCATAAGGG - Intergenic
1046374931 8:113365117-113365139 ACTCTTGCTCATTTTCCTTAAGG - Intronic
1046382635 8:113471334-113471356 ACTCCTGCTGTTATTCCTAGGGG + Intergenic
1046457564 8:114486869-114486891 ACTTCTGCTTTTTTTCCTTTAGG + Intergenic
1048245008 8:132785533-132785555 AGTTCTGCTGTTCTTCATTAAGG + Intronic
1052091046 9:24328126-24328148 ACTCATGCTGGTTTTCATGCTGG + Intergenic
1052227942 9:26111230-26111252 ATTCATGGTGTATTTCATTATGG - Intronic
1052525482 9:29613453-29613475 ATTCATACTGTTTTTCATAACGG - Intergenic
1052744126 9:32423123-32423145 ACTGATGCTGCTTTTTATTAGGG - Intronic
1052753947 9:32522121-32522143 ACTCCTGCTGTGTTTCATATTGG - Intronic
1053350830 9:37412287-37412309 ACTCCTGCTGTTTCTCAGCTTGG + Intergenic
1053561207 9:39196318-39196340 ATTCCTGCTTTGTTTTATTAAGG + Intronic
1053667254 9:40324986-40325008 CCTCTTGCTGTTTTCCTTTATGG - Intronic
1053825304 9:42016552-42016574 ATTCCTGCTTTGTTTTATTAAGG + Intronic
1053916834 9:42950091-42950113 CCTCTTGCTGTTTTCCTTTATGG - Intergenic
1054135912 9:61422629-61422651 ATTCCTGCTTTGTTTTATTAAGG - Intergenic
1054378399 9:64465014-64465036 CCTCTTGCTGTTTTCCTTTATGG - Intergenic
1054517356 9:66051297-66051319 CCTCTTGCTGTTTTCCTTTATGG + Intergenic
1054605263 9:67170805-67170827 ATTCCTGCTTTGTTTTATTAAGG - Intergenic
1055007617 9:71526590-71526612 ACTGCTGCTGGTTTTCTTTCAGG - Intergenic
1057299254 9:93867659-93867681 ACTCAGGCTGTTTTCCATAATGG + Intergenic
1059248195 9:112866140-112866162 AATCCTGCTGTTTATCAATTTGG - Intronic
1060328938 9:122646527-122646549 ACTCCTGCTCTTTTTTTTTTTGG - Intergenic
1203627411 Un_KI270750v1:37153-37175 GCACCTTCTGTTTTTCTTTAAGG - Intergenic
1185920940 X:4091548-4091570 ACTCCAGCTGTCTTTGATCATGG - Intergenic
1186909153 X:14143150-14143172 ACTCCTGATCTTTTTCACCATGG - Intergenic
1188259095 X:28001445-28001467 ACTCCAGGTGTGTTTCCTTATGG - Intergenic
1188445609 X:30250341-30250363 ACTTCTGCTGGTTTTCTTGAGGG - Intronic
1188671647 X:32888579-32888601 CTTCCTGCTGTTTTCCATAATGG - Intronic
1189099186 X:38171585-38171607 ACTCCTGCTGATTTTAGTTCGGG - Intronic
1190436879 X:50434186-50434208 ACTCCTGCTGCTTCTAATGAGGG - Intronic
1190640627 X:52480842-52480864 ACTCCTGATGGTTTTCAAGAAGG + Intergenic
1190647045 X:52532023-52532045 ACTCCTGATGGTTTTCAAGAAGG - Intergenic
1191834680 X:65451918-65451940 GCTGCTGCTTTTTTTCTTTATGG + Intronic
1197508511 X:127340280-127340302 ACTCCTGCTTTTTTTTTTTCTGG + Intergenic
1198836251 X:140807580-140807602 ACTCCTGTTGTTTCTCACTCTGG + Intergenic
1202177137 Y:22108274-22108296 ACTCCTGCTATTTTTCTCTGTGG - Intergenic
1202214224 Y:22478110-22478132 ACTCCTGCTATTTTTCTCTGTGG + Intergenic