ID: 1117622687

View in Genome Browser
Species Human (GRCh38)
Location 14:57603664-57603686
Sequence GAGCCACAGCTGTAACAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117622687_1117622690 11 Left 1117622687 14:57603664-57603686 CCAGATTGTTACAGCTGTGGCTC 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1117622690 14:57603698-57603720 TGATTCCTGCACATTTTTCAAGG 0: 1
1: 0
2: 0
3: 29
4: 268
1117622687_1117622691 15 Left 1117622687 14:57603664-57603686 CCAGATTGTTACAGCTGTGGCTC 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1117622691 14:57603702-57603724 TCCTGCACATTTTTCAAGGCTGG 0: 1
1: 0
2: 6
3: 16
4: 191
1117622687_1117622693 16 Left 1117622687 14:57603664-57603686 CCAGATTGTTACAGCTGTGGCTC 0: 1
1: 0
2: 1
3: 7
4: 128
Right 1117622693 14:57603703-57603725 CCTGCACATTTTTCAAGGCTGGG 0: 1
1: 0
2: 1
3: 21
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117622687 Original CRISPR GAGCCACAGCTGTAACAATC TGG (reversed) Intronic
900507910 1:3038865-3038887 GAGCCACAGCTGGGACCAGCTGG + Intergenic
901880468 1:12191049-12191071 GAGCCACAGCTCAAGCACTCGGG - Exonic
903065992 1:20699835-20699857 CCTCCACAGCTGTCACAATCTGG - Intronic
904754630 1:32761297-32761319 GAGCCACAGGTGTATAGATCTGG + Intronic
905046365 1:35005949-35005971 GAGCCAAAGCTCTGTCAATCAGG + Intronic
905262617 1:36730326-36730348 GAGTGACAGCTGTCACAATGCGG + Intergenic
906479537 1:46191085-46191107 GAGCCACAGATGTCAGAAACAGG + Intronic
907504961 1:54911407-54911429 CAGCTCCAGCTGTAACAAACAGG + Intergenic
911695324 1:100884278-100884300 GAGCCAGAGGAGAAACAATCTGG - Intronic
914015940 1:143818569-143818591 ATGCCACAGCTGTACTAATCTGG + Intergenic
914161843 1:145142439-145142461 ATGCCACAGCTGTACTAATCTGG - Intergenic
914654556 1:149727110-149727132 ATGCCACAGCTGTACTAATCTGG + Intergenic
914956460 1:152167136-152167158 GAGCCCCAGCTGTCACCAGCAGG + Intergenic
916686221 1:167149687-167149709 AAGCAACAGCTGAAACATTCTGG + Intergenic
917723698 1:177810729-177810751 GAGCCACATCTTTAAAACTCTGG + Intergenic
919108785 1:193190787-193190809 GAGGCACAGCTGTTTCAGTCAGG + Intronic
923074078 1:230593514-230593536 GAGCCACAGGTGTGGCCATCAGG + Intergenic
923685062 1:236147982-236148004 GAGCCACAGCTGGAAACAACAGG - Intronic
924919534 1:248613100-248613122 ATGACACAGCTGTAACACTCTGG + Intergenic
1066484236 10:35828083-35828105 GAGGCACTGCCGTAACAACCAGG - Intergenic
1071386291 10:85124581-85124603 GAGCTTCAGCTGTAAATATCAGG - Intergenic
1073620040 10:105037195-105037217 CAGCCACAGATGTAAAAATCTGG + Intronic
1075683060 10:124345958-124345980 GAGCCAAACCTGTAACCAACTGG + Intergenic
1076466033 10:130682162-130682184 GAGCCACTGCCTTAACACTCAGG - Intergenic
1079268690 11:18960890-18960912 TAGCCATAGCTGTAGCAATAGGG - Intergenic
1086060072 11:82691386-82691408 GCTCCAAAGCTGTAAGAATCAGG + Intergenic
1087861531 11:103163739-103163761 GACCTACACCTGTAACAGTCTGG - Intronic
1090448451 11:126784964-126784986 GAACCAGAGCTGTAACTCTCCGG - Intronic
1099134279 12:78875474-78875496 GAGCCAGCCCTGTAACTATCAGG + Intronic
1107819598 13:44274246-44274268 GGGTCACAGCTGTTACAATCAGG + Intergenic
1113146276 13:107211412-107211434 GAGCCACAGCTTCAACCTTCTGG + Intronic
1114793908 14:25690366-25690388 GTGCCACAGCTGTATCAAGGAGG + Intergenic
1117622687 14:57603664-57603686 GAGCCACAGCTGTAACAATCTGG - Intronic
1119504697 14:75162353-75162375 TAGCTAAAGCTGAAACAATCAGG + Intronic
1122462765 14:101909058-101909080 GAGGCTCAGCTGGAACAATTTGG + Intronic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1127659641 15:61088394-61088416 AAGCCACAGCTGCAAGAAACGGG + Intronic
1137281312 16:46979063-46979085 GAGACACAGGTGAAACAACCTGG + Intergenic
1139556380 16:67713496-67713518 GAGGCACAGTTGAAACAACCTGG - Intronic
1141544816 16:84758836-84758858 GAGGGACAGCTGCAACAAGCTGG - Intronic
1141875872 16:86824070-86824092 GAGTCACCGCCGTAACCATCAGG - Intergenic
1143470430 17:7171143-7171165 GAGCCACATCTGAAACAGGCTGG - Intergenic
1147799592 17:43074378-43074400 GAGCAACAGCTGGAAGAGTCTGG - Exonic
1152132604 17:78486139-78486161 GAGACACAGAAGTAAAAATCAGG + Intronic
1153011964 18:547470-547492 CAGCCAAAGCTGGAACAATTGGG + Intergenic
1153939362 18:9964618-9964640 GTGCCACTTCTGTAGCAATCAGG - Intergenic
1156750141 18:40443133-40443155 CTGTCACAGCTGGAACAATCAGG + Intergenic
1163746377 19:19051160-19051182 GTCACACAGCTGTAACAAACTGG - Intronic
926163003 2:10501491-10501513 GAGCCCCAGCTGTAACATTAGGG + Intergenic
927410606 2:22821006-22821028 GAGGCACAGGTAAAACAATCTGG + Intergenic
927642804 2:24855988-24856010 GAGCCTCAGCTGTAACAGCTCGG - Intronic
930062794 2:47304774-47304796 GAGCAACAGCTCTATCAGTCTGG - Intergenic
930571514 2:53092275-53092297 GAGCCCCAGCTCAAGCAATCAGG + Intergenic
933048162 2:77565353-77565375 TGGCCAAAGCTGGAACAATCTGG + Intronic
938137412 2:128770554-128770576 GCCCCACAGCTGTAGCATTCCGG + Intergenic
939196446 2:138979020-138979042 GAGCCCCAGCAGTGACAATTTGG + Intergenic
941811063 2:169756576-169756598 GAGCCACAGCTGCTACAGCCTGG - Intronic
943276692 2:185876438-185876460 GAGCCATAGCTGAAATGATCAGG - Intergenic
945007766 2:205427273-205427295 AAGCCACAGTGGTAACAATATGG + Intronic
946837047 2:223783212-223783234 CAGCAACAGCTGTAACATCCAGG + Intronic
946861737 2:224006473-224006495 GAACCTCATCTTTAACAATCAGG - Intronic
948169852 2:235892201-235892223 GAGCCACAGCTGTTTTAATGTGG - Intronic
948184141 2:236006151-236006173 GAGCCACGGGTGGAATAATCTGG - Intronic
1170678933 20:18507933-18507955 CACCCACAGCTGCAACAAGCAGG - Exonic
1172030293 20:31977164-31977186 CAGCCACAACTGTATCATTCTGG - Intronic
1172131957 20:32661804-32661826 GGGCCACAGCTCTAACAAAAGGG + Intergenic
1175189305 20:57200339-57200361 GAGCCCGAGCTCTAACCATCAGG + Intronic
1175786189 20:61713015-61713037 GAGCCACAGCTCTAGAAAGCAGG + Intronic
952697220 3:36280292-36280314 GAGCTAAAACTCTAACAATCTGG + Intergenic
955402595 3:58603855-58603877 GAGCCCCATCTGTAAAAAGCAGG - Intronic
956538343 3:70304995-70305017 GAGCCAGTGCTGCAAAAATCTGG - Intergenic
964779456 3:160319460-160319482 GAGAAAAAGCTGTAACAAACAGG - Intronic
965423947 3:168498442-168498464 GAGTAAGAGCTGTAGCAATCAGG + Intergenic
976778549 4:88733366-88733388 AAGTCACAGCTGAGACAATCTGG - Intronic
979219288 4:118202816-118202838 AAGTCATAGCTGGAACAATCAGG - Intronic
983176970 4:164601071-164601093 CAGCCAAAGCTGGAACAATTAGG + Intergenic
983469497 4:168139101-168139123 GAGCCCTAGCTGGAGCAATCAGG - Intronic
986824879 5:11509772-11509794 CAGACACAGCTGTACCAAACAGG + Intronic
986950023 5:13071713-13071735 GAGCAGAAGCTGGAACAATCTGG - Intergenic
987695361 5:21321963-21321985 GAGCCATAGCTGAAAAAATATGG - Intergenic
987989522 5:25192485-25192507 GAGCCACTGTTTTCACAATCTGG - Intergenic
988659873 5:33253798-33253820 GTGCCACAGATGTAAGCATCTGG - Intergenic
988844887 5:35117617-35117639 GAGACACAGCAGTAACATTACGG + Intronic
989273978 5:39565464-39565486 AAGACACAGCTGGAACAATAGGG - Intergenic
990337162 5:54786213-54786235 GAGCCACAGCTGTACCCATCAGG + Intergenic
990574804 5:57114095-57114117 GAGGCACATCTGTATCAAGCAGG - Intergenic
991745047 5:69730141-69730163 GAGCCATAGCTGAAAAAATATGG + Intergenic
991752658 5:69825081-69825103 GAGCCATAGCTGAAAAAATATGG - Intergenic
991796616 5:70309870-70309892 GAGCCATAGCTGAAAAAATATGG + Intergenic
991802276 5:70381817-70381839 GAGCCATAGCTGAAAAAATATGG - Intergenic
991824426 5:70605455-70605477 GAGCCATAGCTGAAAAAATATGG + Intergenic
991831977 5:70700210-70700232 GAGCCATAGCTGAAAAAATATGG - Intergenic
991888995 5:71309427-71309449 GAGCCATAGCTGAAAAAATATGG + Intergenic
992383215 5:76258952-76258974 GAGCCACACATGCAACAACCAGG - Intronic
996616778 5:125451546-125451568 GAACTACAGCTGTAAAACTCAGG + Intergenic
998500279 5:142626708-142626730 GAGGCACAGGAGTGACAATCAGG - Intronic
1000324797 5:160164125-160164147 GAGCCAAAGTTTTAATAATCGGG - Intergenic
1002650772 5:180691577-180691599 GAGCTGCAGCTGTGACAATGAGG - Intergenic
1004477553 6:15987973-15987995 CAGCAACAGCTTAAACAATCAGG - Intergenic
1005555433 6:26976258-26976280 GAGCCATAGCTGAAAAAATATGG + Intergenic
1007005462 6:38358352-38358374 GATCCACAGCTGAATCTATCAGG - Intronic
1009480969 6:64157612-64157634 CAGCCACAGCTGGAGCAATTGGG - Intronic
1012135497 6:95551357-95551379 GAGCCACAGATGGGACAAACTGG + Intergenic
1012612643 6:101234729-101234751 GAGCCACAGCAGAAACACTTTGG + Intergenic
1014063001 6:117094650-117094672 GTGCCACAACTGAAACATTCCGG - Intergenic
1015244572 6:131062709-131062731 GAGCAACAGCGGGAAAAATCCGG - Intronic
1017550896 6:155506197-155506219 GAGTGAAAGCTGTAAAAATCAGG + Intergenic
1018146331 6:160893312-160893334 GAGCCACATCCTGAACAATCAGG - Intergenic
1021496760 7:21283662-21283684 GAGACACAGCTGTGAGAGTCAGG + Intergenic
1024409807 7:49027387-49027409 GAGCCACACATGTAACAACCAGG - Intergenic
1025623004 7:63191503-63191525 GACTCACAACTGTAACATTCCGG + Intergenic
1026300280 7:69091673-69091695 GAGCAACAGCTCTATTAATCAGG + Intergenic
1029192171 7:98779619-98779641 GAGCCAGAGCTGTAGGGATCGGG - Intergenic
1031250880 7:119378991-119379013 CAGCTCCAGCTGTAACAAACAGG + Intergenic
1033770623 7:144547342-144547364 GAGCCACTGCAGAAACAATTAGG - Intronic
1039282267 8:35998368-35998390 GACCCACGGCAGTAGCAATCTGG - Intergenic
1039466298 8:37787719-37787741 GAGCCACAGCTCTGAAAACCGGG + Intronic
1041239369 8:55836127-55836149 GAGCCACAGTTGTTTCAAACTGG - Intergenic
1042036872 8:64542559-64542581 GAACCACAGGTAAAACAATCTGG + Intergenic
1042401955 8:68360070-68360092 AAGCCACAGCTGAAACAAAGAGG - Intronic
1042515785 8:69657422-69657444 GAGCCACAGCACTGACAATGAGG - Intronic
1043470850 8:80560878-80560900 GAACCACAGTTGGAAAAATCTGG - Intergenic
1045506630 8:102783179-102783201 AAGCCCCAGCTGTGACAACCAGG - Intergenic
1045888162 8:107123747-107123769 GAGCCACACGTGAAACAATGAGG - Intergenic
1047990037 8:130276580-130276602 CAGCCACAGCTGAGACAATCTGG + Intronic
1048571065 8:135657185-135657207 GAGCCACCGCTCTAACACACAGG - Intergenic
1048790817 8:138101628-138101650 TAGCCAAGGCTGGAACAATCAGG + Intergenic
1049304128 8:141890434-141890456 GGACCACAGCAGTAACAATTAGG - Intergenic
1049449911 8:142655042-142655064 GAGCCACAGCTGGAACCATGGGG + Intergenic
1050125153 9:2348989-2349011 GAGCCACAGCTGGAAAAACTGGG - Intergenic
1051696479 9:19773393-19773415 GGGCCACAGCTGGAATAAACTGG + Intronic
1057283285 9:93727670-93727692 GAGGCACAGCTGTCACCATCTGG - Intergenic
1058810495 9:108634277-108634299 GAGCTCCACCTGTTACAATCCGG - Intergenic
1061505790 9:131031189-131031211 GAGCCCCTGCTTTAGCAATCAGG - Intronic
1061599458 9:131657634-131657656 CAGCCACAGCAGCCACAATCAGG - Intronic
1185558791 X:1042721-1042743 GAGGTACAGCTGGAACACTCGGG + Intergenic
1186000457 X:5003226-5003248 GACACACACCTGCAACAATCAGG + Intergenic