ID: 1117624134

View in Genome Browser
Species Human (GRCh38)
Location 14:57618382-57618404
Sequence GAGGGTAAGCAGAAGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3016
Summary {0: 7, 1: 218, 2: 640, 3: 931, 4: 1220}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117624126_1117624134 11 Left 1117624126 14:57618348-57618370 CCTGGGACTGGTTAGACAGTGGG 0: 2
1: 3
2: 5
3: 12
4: 196
Right 1117624134 14:57618382-57618404 GAGGGTAAGCAGAAGCAGGGTGG 0: 7
1: 218
2: 640
3: 931
4: 1220
1117624124_1117624134 12 Left 1117624124 14:57618347-57618369 CCCTGGGACTGGTTAGACAGTGG 0: 4
1: 8
2: 7
3: 13
4: 111
Right 1117624134 14:57618382-57618404 GAGGGTAAGCAGAAGCAGGGTGG 0: 7
1: 218
2: 640
3: 931
4: 1220
1117624122_1117624134 24 Left 1117624122 14:57618335-57618357 CCTGGTTCATCTCCCTGGGACTG 0: 2
1: 328
2: 820
3: 1295
4: 1094
Right 1117624134 14:57618382-57618404 GAGGGTAAGCAGAAGCAGGGTGG 0: 7
1: 218
2: 640
3: 931
4: 1220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117624134 Original CRISPR GAGGGTAAGCAGAAGCAGGG TGG Intronic
Too many off-targets to display for this crispr