ID: 1117625353

View in Genome Browser
Species Human (GRCh38)
Location 14:57631530-57631552
Sequence AAATTTTGATACAAATGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 372}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117625353_1117625355 -4 Left 1117625353 14:57631530-57631552 CCTGTGCATTTGTATCAAAATTT 0: 1
1: 1
2: 2
3: 33
4: 372
Right 1117625355 14:57631549-57631571 ATTTGCCTGCCTCGTTATGAGGG 0: 1
1: 1
2: 1
3: 6
4: 96
1117625353_1117625359 12 Left 1117625353 14:57631530-57631552 CCTGTGCATTTGTATCAAAATTT 0: 1
1: 1
2: 2
3: 33
4: 372
Right 1117625359 14:57631565-57631587 ATGAGGGAGGTTTGCTTTTCAGG 0: 1
1: 0
2: 1
3: 13
4: 193
1117625353_1117625354 -5 Left 1117625353 14:57631530-57631552 CCTGTGCATTTGTATCAAAATTT 0: 1
1: 1
2: 2
3: 33
4: 372
Right 1117625354 14:57631548-57631570 AATTTGCCTGCCTCGTTATGAGG 0: 1
1: 1
2: 2
3: 2
4: 83
1117625353_1117625356 -1 Left 1117625353 14:57631530-57631552 CCTGTGCATTTGTATCAAAATTT 0: 1
1: 1
2: 2
3: 33
4: 372
Right 1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG 0: 1
1: 1
2: 1
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117625353 Original CRISPR AAATTTTGATACAAATGCAC AGG (reversed) Intronic
902118748 1:14143542-14143564 AAATTCTGACACAATTACACTGG - Intergenic
902283981 1:15394458-15394480 AAATATTGGTCCAAATGCGCAGG - Intronic
903584337 1:24399111-24399133 AAATTTATATGGAAATGCACTGG + Intronic
903755679 1:25658850-25658872 AAAGTTTGATGGAACTGCACGGG - Intronic
904821600 1:33248527-33248549 AGATTTAGATAAAAATGGACTGG + Intergenic
906466895 1:46089823-46089845 TAATTGTGATATAAATACACTGG + Intronic
907573599 1:55506161-55506183 CAACTTTGAGACAAAGGCACAGG + Intergenic
908228052 1:62075956-62075978 CAATTTTGATACAACTACAAGGG + Intronic
909204186 1:72732164-72732186 AAAAATTGATACATATGCAAGGG - Intergenic
909734386 1:78937813-78937835 AGAGTTTGATACAAATTCAACGG - Exonic
910151160 1:84148700-84148722 AAATCATGATAAAAATACACAGG - Intronic
910637079 1:89420517-89420539 AAATTTAAATACAAAGTCACGGG - Intergenic
910907977 1:92201756-92201778 AAATTATGATACAAGTACGCTGG - Intergenic
912143895 1:106767910-106767932 ATATTTTTATACAAATGTAAAGG - Intergenic
914880768 1:151544948-151544970 AAATTGTAATACAATTACACTGG - Intronic
915175279 1:154009443-154009465 AAATTATAATAGAAAAGCACAGG + Intronic
916415173 1:164585565-164585587 ACATTTTTATTTAAATGCACTGG - Intronic
916462359 1:165039589-165039611 AAATATTCATAAAAATGCAATGG + Intergenic
916983491 1:170165777-170165799 TAAATTTGAGACAAATCCACAGG - Intronic
918604543 1:186406459-186406481 AAATTTTGGTACAATTTCCCAGG - Intronic
919389960 1:196971159-196971181 AAATTTATATTAAAATGCACAGG + Intergenic
919389988 1:196971688-196971710 AAATTTATATTAAAATGCACAGG + Intergenic
921118525 1:212116934-212116956 AATTTTTGATAGAAATACAAGGG + Intergenic
921689901 1:218136655-218136677 AATTTATGATGAAAATGCACAGG + Intergenic
921980636 1:221253969-221253991 AAATTTACATAAAAATGCAAAGG + Intergenic
922610678 1:226924690-226924712 AAATTTTAATAAAAGAGCACAGG - Intronic
923442306 1:234032216-234032238 AAATAATGATATAAATGAACTGG - Intronic
923648943 1:235853791-235853813 AAATTTTAATAGAAATTCAGAGG + Intronic
923839478 1:237652709-237652731 ATTTTTTGATACAAATGAGCTGG + Intronic
923854913 1:237835891-237835913 AAATCTTGATACAAGTGCATGGG + Intergenic
924686678 1:246299619-246299641 AAAATGTGGTACATATGCACTGG + Intronic
1063384762 10:5609180-5609202 ATATTTTAAAACAAATGCAGTGG + Intergenic
1063954074 10:11249688-11249710 GAATTCTGATGCAAATGCATTGG - Intronic
1065672873 10:28140648-28140670 AACTTTGGATACAAATCAACAGG + Intronic
1078805584 11:14697566-14697588 AAAATTACATACAAATGCAAAGG - Intronic
1078810361 11:14755491-14755513 AAATATTGATACCAGTCCACAGG - Intronic
1079017693 11:16883390-16883412 AAATTTGGAGACAAAGCCACAGG - Intronic
1079768326 11:24423870-24423892 AATTTTTGATAAAGATGCAAAGG + Intergenic
1082043436 11:47706020-47706042 AGATTTAGATAGAAATGCAGGGG - Intronic
1083111909 11:60418742-60418764 ATATTTTACTACAAAGGCACAGG - Intergenic
1085208673 11:74753678-74753700 AAATTTTGTAGTAAATGCACTGG + Intronic
1085731832 11:79006653-79006675 AAATTTAGATATACAGGCACAGG + Intronic
1086040483 11:82471315-82471337 AAATTTATATATAAATGCAAAGG - Intergenic
1086118426 11:83280162-83280184 AACTTTTGATACCCATGCATTGG - Exonic
1086660785 11:89414167-89414189 AAATAGTGAAACAAATGCCCTGG - Intronic
1086789139 11:91013449-91013471 AAATTTAGATGAAAATGCAAAGG + Intergenic
1087967200 11:104431317-104431339 AAATTTTGATAAAAATGGAAAGG - Intergenic
1088863607 11:113825042-113825064 AAATTTACATAGAAATGCAAAGG + Intronic
1089137503 11:116261533-116261555 AGATTTGGATACAAATGCACTGG - Intergenic
1091830616 12:3547914-3547936 AAATTTATATAGAAATGCAAAGG + Intronic
1091988362 12:4932853-4932875 AAATTTGGACACAAACGCACAGG - Intergenic
1093536194 12:20226449-20226471 ATATTTTGTTATAAAGGCACTGG - Intergenic
1093842587 12:23922552-23922574 ATATTTTGCTTCATATGCACAGG + Intronic
1094385848 12:29892490-29892512 AAGTTCTGATACACATGCTCAGG + Intergenic
1094636119 12:32228307-32228329 AAATTTTGACAAAAGTGCAAAGG - Intronic
1095570003 12:43674320-43674342 AAATTTTTATAGAAATGCAAGGG + Intergenic
1096287125 12:50309822-50309844 AAATTTATATACAATTGCAGGGG + Intergenic
1097815841 12:64072537-64072559 AAATTTGGATACAGAGACACAGG + Intronic
1098979252 12:76937239-76937261 AAATTTATATAGAAATGCAGAGG + Intergenic
1099748592 12:86740770-86740792 TAATTTAGATACAAATGCTAGGG + Intronic
1100510722 12:95270006-95270028 AAAATGTGATACAACTGTACAGG - Intronic
1100742744 12:97612540-97612562 AAATTTAGATAAAAATGTAAAGG + Intergenic
1101683167 12:106988683-106988705 AAGTTTTGATTACAATGCACGGG - Intergenic
1102370363 12:112377916-112377938 AAATTTTAATTCAAATACTCTGG + Intronic
1102711426 12:114931151-114931173 AAAATTTGCTGCAAATGCATGGG + Intergenic
1103193070 12:119019191-119019213 AAATTCTAATTCAAATGCTCTGG + Intronic
1103217532 12:119213796-119213818 CAATTTTGAGTCAAAAGCACAGG - Intronic
1104511383 12:129382585-129382607 AAATATTGATTCAAGTGAACCGG + Intronic
1105599420 13:21872822-21872844 AGATTTTGAAACACAGGCACTGG + Intergenic
1106353917 13:28960743-28960765 ATATTGTGATACAAATGTTCTGG + Intronic
1106668340 13:31877460-31877482 ACATTTTTATTGAAATGCACAGG + Intergenic
1107309370 13:39060818-39060840 AAATTATGATTCACATGCAAAGG - Intergenic
1107350431 13:39508372-39508394 AAATTTTGATGCACATACAATGG + Intronic
1107651527 13:42549949-42549971 AAATGTAGATACAAAGGCAATGG - Intergenic
1108236540 13:48413693-48413715 AAATATTAATACAACTGCATAGG - Intronic
1108277956 13:48830425-48830447 AAATTATGATACAGCTACACAGG - Intergenic
1108435096 13:50394164-50394186 AAATTTATATAGAAATGCAAAGG + Intronic
1109356971 13:61243173-61243195 AACTATTGGTACAAATGCAGAGG - Intergenic
1109790045 13:67234151-67234173 AAATTGTGCTAAAAATGCTCAGG + Intergenic
1109833005 13:67817077-67817099 TAATTTTGATACCAATGAAAAGG - Intergenic
1110194979 13:72778703-72778725 AAATTATAATACAATTTCACAGG + Intronic
1111094385 13:83493347-83493369 AATTTTTGCTACTAATGCAGAGG + Intergenic
1111219840 13:85189778-85189800 AAATTTAGATTCACATGCAAAGG + Intergenic
1111714129 13:91857226-91857248 AAATTTATATAGAAATGCACAGG - Intronic
1112673163 13:101665138-101665160 AAATTTATACACAAATGCAAAGG - Intronic
1113015087 13:105819854-105819876 GAATTCTGATACAAATATACTGG + Intergenic
1116003811 14:39271487-39271509 AAATTTATATAGAAATGCAAGGG - Intronic
1116098258 14:40400735-40400757 ATATTTTGTTACATATGCAGAGG - Intergenic
1117488914 14:56226519-56226541 AAATTTTTAAATAAATGTACAGG + Intronic
1117625353 14:57631530-57631552 AAATTTTGATACAAATGCACAGG - Intronic
1117888355 14:60389639-60389661 AAATTTATATAAAAAGGCACAGG + Intergenic
1119795247 14:77390560-77390582 AAATAATGAAACAAATTCACAGG - Intronic
1120321539 14:82968260-82968282 ATATTTTAATACGATTGCACTGG - Intergenic
1120380835 14:83777136-83777158 AAGGTTTTATACACATGCACAGG + Intergenic
1120676960 14:87431729-87431751 AAATTTTGATACAGAGAAACAGG - Intergenic
1121173285 14:91872044-91872066 AAATATTGATCTAAAAGCACAGG + Intronic
1121808773 14:96858867-96858889 AAATTTAAATAGAAATGCAAAGG - Intronic
1121931810 14:97978927-97978949 AACTCTTGATTCAAATGCTCCGG + Intergenic
1122403836 14:101485354-101485376 AAATTTATATAGAAATGCAGTGG - Intergenic
1123584759 15:21748397-21748419 AAATTATGCTACAAAGCCACAGG + Intergenic
1123621404 15:22191004-22191026 AAATTATGCTACAAAGCCACAGG + Intergenic
1124698297 15:31886854-31886876 AAATTTATATAAAAATGCAATGG - Intergenic
1125130011 15:36273300-36273322 AAAGTTTTACACAAATGAACTGG + Intergenic
1125254071 15:37742732-37742754 AAATTTTTTTAAAAAAGCACTGG - Intergenic
1126247276 15:46523469-46523491 CAATTTTGATACAAATATATTGG - Intergenic
1126391148 15:48154005-48154027 AAATTTTCATATAAAAGCACTGG + Intronic
1126672941 15:51132909-51132931 AAATCTTGAGTCACATGCACTGG - Intergenic
1126719126 15:51557535-51557557 AAATTTATATAGAAATGCAAAGG + Intronic
1126776973 15:52108718-52108740 AAATTTTAATACACATCCATTGG + Intergenic
1126900051 15:53305546-53305568 AAATTATGATTCAAATGCTATGG - Intergenic
1127537346 15:59902679-59902701 AAATTGTATTAAAAATGCACAGG + Intergenic
1127818502 15:62633971-62633993 AAATTTGGACACAGATACACAGG - Intronic
1130075837 15:80689104-80689126 AAATTTAGATAAAAATTCATGGG - Intronic
1130361050 15:83186529-83186551 AAATTTTGAAATAAATTTACCGG - Intronic
1131813148 15:96193858-96193880 AAATTTAAATAGAAATGCAAGGG - Intergenic
1132334746 15:101039105-101039127 AAATTTAGATGAAAATGCAAAGG - Intronic
1133976676 16:10604070-10604092 AAATTTGGACACAAACACACAGG + Intergenic
1135823837 16:25708752-25708774 AACTTTTGACACAGATACACAGG - Intronic
1138662463 16:58530914-58530936 AAATTTTGCTACAGGTACACAGG - Intronic
1140391828 16:74593740-74593762 AAATTATGTTAAAAATGCTCTGG - Intronic
1141301286 16:82817977-82817999 ACATTTTTATAGAAATGCATAGG + Intronic
1141551144 16:84807502-84807524 AAGTTTGGACACAGATGCACCGG + Intergenic
1141664772 16:85460317-85460339 AGATTCTGATACAACTGCTCAGG + Intergenic
1142010949 16:87713831-87713853 AAATTTTCTTACTAAAGCACAGG - Intronic
1143298888 17:5894291-5894313 AAATTCTGATAAAATTTCACAGG + Intronic
1148145076 17:45359349-45359371 AAATTTTTATGGAAATGCAAAGG - Intergenic
1149281975 17:55115756-55115778 AAATTTTAAGGCAAATGCAAAGG + Intronic
1149330896 17:55580058-55580080 AAATTTACATAAAAATACACAGG - Intergenic
1149884273 17:60325524-60325546 AAATTGTGATATAATTTCACTGG + Intronic
1149958872 17:61084600-61084622 AAAATTAGTTAAAAATGCACAGG - Intronic
1150104699 17:62453900-62453922 ACAGTTTGAGACAGATGCACTGG + Intergenic
1151058309 17:71059991-71060013 AAATAGTGAGACAAATGAACTGG - Intergenic
1152179319 17:78808040-78808062 AAATCTTGATGAAAATGTACTGG - Intronic
1153548537 18:6236097-6236119 AAATTCAGATAGAAATGCAAGGG + Intronic
1156014046 18:32527600-32527622 AAAATATCCTACAAATGCACAGG - Intergenic
1156101292 18:33598413-33598435 ACATTTTTATACAGAGGCACTGG - Intronic
1156525220 18:37760916-37760938 AAATTTAAATTCACATGCACAGG + Intergenic
1159193091 18:65073716-65073738 TAATTCTGTTAGAAATGCACTGG - Intergenic
1159482071 18:69002283-69002305 ATATTTTGATACAATTGTAGAGG + Intronic
1160621154 18:80171467-80171489 AAATTTTAAACAAAATGCACAGG - Exonic
1160761826 19:789328-789350 AAATTTGGACACAGATGCAGAGG - Intergenic
1161497257 19:4593468-4593490 AAATTTTGAAAAAAATTAACAGG + Intergenic
1161762181 19:6182162-6182184 AAATTTATATAGAAATGCAGAGG - Intronic
1162080215 19:8213476-8213498 AAAATTTTATACACATGGACAGG + Intronic
1162835253 19:13312720-13312742 AAATGTTTATAAAAATGTACGGG - Exonic
1166027974 19:40106320-40106342 AAAACTTGAAACTAATGCACAGG + Intergenic
1168467556 19:56616310-56616332 GATTTTTGATAAAAATGCAAAGG - Intronic
1168573908 19:57492281-57492303 ATATTTTGATACCAAGGCAAGGG + Intronic
927816927 2:26226330-26226352 AAATTTGTACACAAATGCAAAGG + Intronic
928643833 2:33329867-33329889 AAATTTATATAGAAATGCAAAGG - Intronic
929650097 2:43670661-43670683 AAATTTGTATAGAAATGCACAGG - Intronic
930793683 2:55363970-55363992 AGATTTTGATACAAAAGCAGCGG - Exonic
931373366 2:61685148-61685170 AAATTTAGATGGAAATGCAAAGG - Intergenic
931443917 2:62310879-62310901 AAGTTTGGACACAAATACACAGG - Intergenic
933200944 2:79447787-79447809 CAATTTAGATTCAAATGTACTGG - Intronic
933325522 2:80831709-80831731 AAATTTTGATTTAAATGGTCGGG + Intergenic
933567778 2:83971935-83971957 AAATTTTCATAGAAATGCTTTGG + Intergenic
933700957 2:85255273-85255295 GATTTTTAATACAAATGCAGGGG + Intronic
934914185 2:98285731-98285753 AAATTTACATATAAATGCAGAGG - Intronic
936432606 2:112477547-112477569 AAATTTATATAGAAATGCAAGGG - Intergenic
936817926 2:116483058-116483080 AAGTTTTCATACAAATGCAAAGG - Intergenic
937655970 2:124376936-124376958 AAATATTGATACCTATGCATAGG + Intronic
938690583 2:133785492-133785514 AGATTTTATTCCAAATGCACTGG + Intergenic
938771545 2:134505282-134505304 AAATTCTGATAAAATTGAACTGG - Intronic
939833004 2:147095197-147095219 GAATTTGGATACAAAGGGACAGG + Intergenic
940747387 2:157583529-157583551 AAATTTAAATAAAAATGCAAAGG + Intronic
941342221 2:164321295-164321317 AAAATGTGATATAAATTCACTGG + Intergenic
941453494 2:165688363-165688385 AACTTTTAATACATATGTACTGG + Exonic
941539071 2:166759694-166759716 AAATTTATATAAAAATGCAAAGG - Intergenic
941699347 2:168587315-168587337 AAATTGTGTTACAAATGACCAGG + Intronic
941795212 2:169591259-169591281 AAATTTTTTTACACATGAACTGG + Intronic
942864883 2:180661627-180661649 AATTTTTGCTGCAACTGCACTGG - Intergenic
943148660 2:184080659-184080681 AAATTTATATAAAAATGCAAAGG - Intergenic
943267866 2:185758948-185758970 AAATTTGTATAGAAATGCAAAGG - Intronic
943454537 2:188088206-188088228 AAATTTTTAGACAAAAACACAGG + Intergenic
945728414 2:213502408-213502430 AAATTTTGAGACAGGTGCAGTGG - Intronic
946100867 2:217320941-217320963 AAATTTTTATAGAAATGTTCAGG + Intronic
947054192 2:226082564-226082586 AAATGTTGATACCAAAGAACTGG + Intergenic
1169573632 20:6933380-6933402 AAATTATGATAAAATTGCACAGG - Intergenic
1170734276 20:19000472-19000494 TAATTTTTATTCAAATGCTCTGG + Intergenic
1172648492 20:36486634-36486656 AAATTTTGCTTCAGTTGCACAGG + Intronic
1173104180 20:40116770-40116792 AAATTTTGATGGTTATGCACAGG - Intergenic
1173184085 20:40826928-40826950 AAATTATGATACAACTATACTGG + Intergenic
1173347406 20:42213649-42213671 AAATTTGGACAGAAGTGCACTGG + Intronic
1173719650 20:45244145-45244167 AAATTTGTATACAAATGCAAGGG - Intergenic
1174136128 20:48381343-48381365 AACTTTTGAGACCAGTGCACAGG - Intergenic
1174598892 20:51708116-51708138 AATTTTTGATACAACTGCCATGG - Intronic
1174697539 20:52575245-52575267 AAAAATTGATCCAAAAGCACAGG - Intergenic
1174997540 20:55587106-55587128 CAATGTTGCTAGAAATGCACTGG - Intergenic
1176912762 21:14587219-14587241 CATTTTTGATACAAATGCCTAGG - Intergenic
1177042022 21:16125075-16125097 AAATCTCAAAACAAATGCACGGG - Intergenic
1177057620 21:16327517-16327539 AAATTTTCATATAAATGAAGAGG - Intergenic
1177279009 21:18954081-18954103 AAATTTAGATATAGATACACAGG - Intergenic
1179945892 21:44675239-44675261 AAATTATCATACAGATGCAAGGG + Intronic
1181840737 22:25657912-25657934 AAATTTGAAGACAAATCCACAGG - Intronic
1184326130 22:43787736-43787758 AAATTCATATACAAATGCAAGGG + Intronic
1184908586 22:47509775-47509797 ACAAGTTGATACAACTGCACAGG - Intergenic
949833795 3:8246058-8246080 ACATTTGGATAGAAAAGCACAGG - Intergenic
951961311 3:28325156-28325178 AAAGTTTTGTACAAATGCAATGG + Intronic
952672385 3:35985918-35985940 AAATCTTGATCCAAAGACACTGG + Intergenic
954842955 3:53528519-53528541 AAATTTAGATAGAAATGCAAAGG - Intronic
954935483 3:54322945-54322967 ATATTTTAAAATAAATGCACAGG + Intronic
955980714 3:64524187-64524209 AGACTTTGATATAAATGCAAAGG + Intronic
956819111 3:72936821-72936843 ATATTTTGATACAATTGTATTGG + Intronic
957017618 3:75086809-75086831 AAATTTTCCAACAAATGCATGGG + Intergenic
957408801 3:79809325-79809347 AAATCTTGATAGCAATGTACTGG + Intergenic
957717021 3:83941736-83941758 AAATTTTGACACAGATACAGAGG - Intergenic
959442710 3:106397863-106397885 AACTTTTGATACATATGGAGGGG + Intergenic
959509248 3:107190846-107190868 AAATTTATATGGAAATGCACAGG + Intergenic
959650604 3:108746856-108746878 AATTCTTTATACAAAGGCACTGG - Intronic
960146138 3:114205407-114205429 AAATTTTGTGACAAATGAACAGG - Intergenic
960544420 3:118896448-118896470 AAACATTGATACAAATAGACTGG + Intergenic
960933021 3:122873846-122873868 AAATTGTGATACAACTGAAGTGG - Intronic
961925662 3:130477402-130477424 AAAATTTCAAACAAATGGACAGG - Intronic
963422506 3:145077869-145077891 AAACTTTAAGACAAATGCTCTGG - Intergenic
963504780 3:146170401-146170423 AAATTGTGACACACATGCAGAGG - Intergenic
963598359 3:147356454-147356476 AAATTTTGAAGAAAATGCAAAGG + Intergenic
966116237 3:176466056-176466078 AAATTTTTAAAGAAATGCAAAGG + Intergenic
966701316 3:182855073-182855095 AAATTTAGATAGAAAAGCAAAGG + Intronic
967178395 3:186882130-186882152 AAATTTTTATAGGAATGCAGAGG + Intergenic
968314288 3:197709752-197709774 AGAAGTTGATACAAATGCATAGG + Intronic
969833702 4:9820236-9820258 GAATTTTGACAAAAATGCAAAGG - Intronic
969901118 4:10350356-10350378 AAATTTTAATCCAAATCCAATGG - Intergenic
969932514 4:10644605-10644627 AAATTTTGCTATCAATGCAAGGG - Intronic
971554099 4:27990020-27990042 AAATTTACATGCAAAAGCACAGG - Intergenic
972978881 4:44671422-44671444 AAATTATGATACAAAGTCTCAGG + Intronic
973281028 4:48361661-48361683 AAATTTATATAAAAATGCAAAGG - Intronic
973994822 4:56447979-56448001 AAATTTTGATCCAGGTGCAGTGG - Intronic
974193388 4:58537422-58537444 AAATTAAGATACAGATGTACAGG - Intergenic
974701206 4:65449766-65449788 AGATTTGGAAACAAATACACAGG + Intronic
974728742 4:65833900-65833922 AAATTTGTATAGAAATGCAGAGG + Intergenic
974974073 4:68867771-68867793 AGATATTGATACAAACTCACTGG - Intergenic
974981063 4:68957556-68957578 AGATATTGATACAAACTCACTGG - Intergenic
975467753 4:74728816-74728838 AAATTTGGACAAAAATGGACAGG - Intergenic
975475797 4:74821865-74821887 AAAGTTTGATAAGAATCCACTGG + Intergenic
976482971 4:85566091-85566113 TAAGATTGATACAAAGGCACAGG + Intronic
977181658 4:93882377-93882399 AAATTTAGAAACAAATGAGCTGG - Intergenic
977319038 4:95487892-95487914 AAATTTTGATACTATAGCCCAGG - Intronic
977486210 4:97649717-97649739 AAATTTAGATACAATTGAACTGG - Intronic
977507614 4:97922555-97922577 AAATATGTATAAAAATGCACAGG + Intronic
978219933 4:106257873-106257895 AAAATTTAATACAAATGCAATGG + Intronic
978804612 4:112787143-112787165 AAATTTTGTTAAATATGCAATGG + Intergenic
978907179 4:114019977-114019999 AAATTCTGTTACAAATTAACTGG + Intergenic
979086645 4:116419251-116419273 AAATTTGTATAAAAATGCAAAGG + Intergenic
979767914 4:124484310-124484332 ATATTTTTATACAAAGGCAGTGG + Intergenic
981111937 4:140944901-140944923 ATATTATCAAACAAATGCACTGG - Intronic
981241916 4:142487437-142487459 AAATTTATATAGAAATCCACAGG - Intronic
981334007 4:143547157-143547179 AAATTAAGATAAAAATGCAAGGG - Intronic
981622362 4:146716830-146716852 AAATTTTCATAAGAATGAACTGG + Intronic
981806808 4:148725369-148725391 AAATTATCATGGAAATGCACAGG - Intergenic
983422838 4:167542332-167542354 AACTTTTGATAAAAATGCACAGG - Intergenic
983816785 4:172139337-172139359 AAAATTTCAGACAAATGCATAGG + Intronic
983921704 4:173352766-173352788 AAATTTGTGTATAAATGCACTGG + Intergenic
984110936 4:175613277-175613299 AAATATATATAGAAATGCACTGG - Intergenic
984306431 4:177997977-177997999 AAATTTTTATAAAACTGCACTGG - Intergenic
984377507 4:178951854-178951876 AAATTTATATACAACTGCAAGGG + Intergenic
986343175 5:6810189-6810211 CATTTATGATACAAATGCTCAGG - Intergenic
986832246 5:11592770-11592792 AAATTTATATCGAAATGCACAGG + Intronic
987180557 5:15363394-15363416 AAATTTTGAAATAAAGGCCCGGG + Intergenic
987628141 5:20430172-20430194 AAATTTTGAGCCAAAATCACAGG - Intronic
987683791 5:21170474-21170496 AAATTTTTTTAAAAATGTACAGG - Intergenic
988493349 5:31723983-31724005 AAATTTTGATATAAATGCACAGG + Intronic
988548568 5:32179729-32179751 AAAATTTGAAATAAATTCACAGG + Intergenic
989277696 5:39608941-39608963 AGCTCTTGATACAAATGCAAAGG - Intergenic
989502742 5:42188235-42188257 AATTTTTCTTACAAATACACAGG - Intergenic
990314372 5:54570148-54570170 AAATTTGGACACAGATGCACTGG + Intergenic
990424486 5:55672376-55672398 AAATTTAGATAAGAATGAACTGG + Intronic
990523327 5:56600950-56600972 AAAATCTGATAAAAATGCTCTGG - Intronic
991478430 5:67049574-67049596 AAAATTTGATAAATTTGCACAGG - Intronic
993760214 5:91785720-91785742 AATTTTTCATACAAATGTGCTGG - Intergenic
994282500 5:97922264-97922286 AAATTTGGAAACAAATACAGAGG - Intergenic
994403062 5:99306865-99306887 AATTTTTGATAAAAATGTCCTGG + Intergenic
994771177 5:103983360-103983382 AAAATGTGGTACATATGCACTGG + Intergenic
996280874 5:121727545-121727567 ATATTTTGATACATGTGTACAGG - Intergenic
996655759 5:125933955-125933977 AAATTTTCATAGAAATTAACAGG + Intergenic
1000142106 5:158415380-158415402 AGAATTTTATAAAAATGCACTGG - Intergenic
1000307119 5:160004958-160004980 AAATGTAGACATAAATGCACAGG + Intergenic
1002463828 5:179393471-179393493 AAATTGATATGCAAATGCACAGG + Intergenic
1003197010 6:3923883-3923905 AAATTTTTATGGAAATGCAAAGG + Intergenic
1003233930 6:4279528-4279550 AAATTTATATAGAAATACACGGG - Intergenic
1003362365 6:5440464-5440486 AAATATTAAGACAAGTGCACAGG - Intronic
1004744241 6:18493984-18494006 AGATTTATATACAACTGCACTGG - Intergenic
1005149939 6:22737279-22737301 AGATTTAGATACAAATCTACAGG - Intergenic
1006992225 6:38225114-38225136 GAATTTTGGTACAAATGCAAAGG - Intronic
1007848530 6:44781183-44781205 AAATATTGCTAGATATGCACAGG - Intergenic
1007911937 6:45524428-45524450 AGCTTTAGATACAAAAGCACAGG - Intronic
1008383123 6:50856253-50856275 AAATTCTGATCCAATTGGACTGG + Intergenic
1008715040 6:54278564-54278586 ATATTTTGAGACAAATGAAAAGG + Intergenic
1009286229 6:61821470-61821492 ACATTTTAATGCTAATGCACAGG + Intronic
1009293497 6:61913882-61913904 AATCTTTGATACATATGCACTGG - Intronic
1009930241 6:70168730-70168752 AAATTTTGAAAGAAAAGCATCGG + Intronic
1010176857 6:73037858-73037880 AAATTTATATGGAAATGCACAGG - Intronic
1010657057 6:78524139-78524161 CAATTTTGATACATATCCTCGGG - Intergenic
1011794965 6:90942600-90942622 AAACTTTGAGACAAATGCAAAGG + Intergenic
1012463969 6:99496557-99496579 AAATTATGAGCCAAATGCATTGG + Intronic
1012967795 6:105694128-105694150 AAATCTTCAGACAAATGCTCTGG - Intergenic
1013709673 6:112881965-112881987 GAATTTTAATTCAAATGCAATGG - Intergenic
1013786624 6:113788756-113788778 GAATTTGGACACAGATGCACAGG - Intergenic
1013887361 6:114986041-114986063 GAATTTAGATACAAATGGATAGG + Intergenic
1015104017 6:129515331-129515353 CAATGTTGATAGAAATGCAATGG + Intronic
1015110244 6:129584892-129584914 AAATTTTGGTTCAATTGAACAGG - Intronic
1015232421 6:130930941-130930963 AAATTATAATCCAAATGGACAGG + Intronic
1016642404 6:146364256-146364278 CAATTTTGAAGCACATGCACTGG - Intronic
1018267227 6:162038487-162038509 ATATTTTGATACAGATGTATAGG - Intronic
1018667345 6:166150665-166150687 CAATTTAAATACAAAAGCACAGG - Intergenic
1019555678 7:1629735-1629757 TAATTTTGACACAGATGCAAAGG - Intergenic
1020251851 7:6475459-6475481 ACATTTTTATACAAATACAATGG - Intronic
1020377545 7:7504943-7504965 AAGTTTTGATAAAATTGCATTGG - Intronic
1020531330 7:9340412-9340434 AAATTTATATAGAAATGCAAAGG - Intergenic
1020575917 7:9928132-9928154 AATTTTTGACAAAGATGCACAGG - Intergenic
1021347931 7:19550325-19550347 AAATTTTTATAAAATTGCATGGG - Intergenic
1021657995 7:22890852-22890874 ACATTTTGCTACAAATGCTTTGG + Intergenic
1022005054 7:26259980-26260002 TATTTGTGATCCAAATGCACAGG - Intergenic
1022778413 7:33552771-33552793 AAATTTTGAAATAAATGGATGGG - Intronic
1022831840 7:34075469-34075491 ACATATGGATACAAATGCACAGG - Intronic
1024001346 7:45191224-45191246 AGATTTTAATAGAAATGTACTGG - Intergenic
1024121163 7:46242432-46242454 AAATTTATATAAAAATGCAAAGG + Intergenic
1024352867 7:48384892-48384914 AAATTTGGACACAGATACACAGG - Intronic
1024391701 7:48820887-48820909 AAAGTTTGATAGAAATGCTGAGG + Intergenic
1024575226 7:50757838-50757860 CAATTCTGATTCAAATGCCCAGG + Intronic
1026401843 7:70021833-70021855 AAATGTAGATTCAAATACACAGG + Intronic
1026761575 7:73130808-73130830 ATGTTTTGATACATATGCACAGG + Intergenic
1027037915 7:74939624-74939646 ATGTTTTGATACATATGCACAGG + Intergenic
1027085646 7:75261851-75261873 ATGTTTTGATACATATGCACAGG - Intergenic
1027632412 7:80622775-80622797 AATTCTTTATACAAATGCATGGG - Intronic
1027725349 7:81798706-81798728 AACTTTTCATACACATGCTCAGG + Intergenic
1027963057 7:84971254-84971276 AAATTTTAAGAAAAATGGACAGG + Intergenic
1028386954 7:90266087-90266109 AAATATTTTTAAAAATGCACTGG - Intronic
1029083158 7:97990744-97990766 AAACCATGTTACAAATGCACTGG + Intronic
1029995530 7:105004328-105004350 AAAATTTGATGCAAATGGTCTGG - Intergenic
1030538468 7:110799067-110799089 AAATTTTGAAAAAAATGTAAAGG + Intronic
1031068123 7:117130269-117130291 AAATTTTAAGACAAAAACACAGG + Intronic
1032033873 7:128507117-128507139 ACAGTTTGAGACAGATGCACTGG + Intergenic
1033186976 7:139235980-139236002 AAATATTGATACAGATTCAATGG - Intronic
1036021251 8:4849252-4849274 AAAATATGAAACACATGCACAGG - Intronic
1036583046 8:10094946-10094968 AAATTTTACTACAGATGTACAGG - Intronic
1036952642 8:13155902-13155924 ATATTTTTAAATAAATGCACTGG + Intronic
1037018944 8:13944262-13944284 AAATTCGGACAAAAATGCACAGG + Intergenic
1038490196 8:27965260-27965282 AAATTTTGAGGCAAATGGCCAGG - Intronic
1038566663 8:28624880-28624902 AAATTTAAATACAAATTCATGGG + Intronic
1039663282 8:39490703-39490725 AATATTTTATACAAATACACTGG + Intergenic
1041482612 8:58339913-58339935 AAATTTTTATGAAAATGCAATGG - Intergenic
1042020298 8:64366531-64366553 CAATTTCCATACAAATTCACTGG + Intergenic
1042205453 8:66325455-66325477 AAATTTTTATAGAAATGCAAAGG + Intergenic
1042375627 8:68048098-68048120 AAATTTGGCCACAAATGCAAAGG - Intronic
1042418226 8:68552192-68552214 AAATTTAGATAGAAATGCAAGGG - Intronic
1042626496 8:70763763-70763785 AAATTATTATTCAAATGTACTGG + Intronic
1043530784 8:81147571-81147593 AAATTTGGAAGCAAATGCATGGG + Intergenic
1043662496 8:82761781-82761803 AAATTTACATAAAAATGCAATGG + Intergenic
1044226626 8:89726224-89726246 AAATATTGATGCCAATGTACTGG - Intergenic
1044708567 8:95032757-95032779 AAATTTTGACACAGATTCTCAGG + Intronic
1045769608 8:105720524-105720546 AGGTTTTGATACAAATATACTGG - Intronic
1046122976 8:109867922-109867944 CAGTGTTGGTACAAATGCACTGG - Intergenic
1046845998 8:118916829-118916851 AATTTTTGACAAAAATGCAAAGG + Intergenic
1047583467 8:126242703-126242725 ATCTTTTGATACACATGAACAGG + Intergenic
1047676001 8:127202758-127202780 AAGTTTATATACAAATGCAAAGG + Intergenic
1047767671 8:128002658-128002680 AAATTTGGACACAAACACACAGG - Intergenic
1048128984 8:131671264-131671286 AAATTGTGATACATATACATTGG + Intergenic
1048607779 8:135987478-135987500 AAATTAAGATACTAAAGCACAGG - Intergenic
1049309533 8:141926053-141926075 CTGTTTTGATACAAATGCACTGG - Intergenic
1049957213 9:704678-704700 ATATTTTAAGACAAATGCCCAGG + Intronic
1050757353 9:9022442-9022464 ATATTTAGATACACATACACTGG + Intronic
1051517537 9:17946746-17946768 AAATTTCCCTACAAATGCAAGGG - Intergenic
1052035949 9:23681251-23681273 AAATTTTCATACAATTGGAGAGG - Intergenic
1052285243 9:26777286-26777308 AATTTCTGATGCACATGCACAGG + Intergenic
1052512848 9:29443847-29443869 AAATTTTCATAGAAATGCAAGGG + Intergenic
1052600474 9:30621896-30621918 AAAATTTGGTACAAATTCATGGG - Intergenic
1055165923 9:73193519-73193541 AATATTTTATACAAATACACTGG - Intergenic
1055900873 9:81235540-81235562 ATAATTTGATACAAATACACAGG + Intergenic
1056134296 9:83616094-83616116 AAATTTATATAAAAATGCAAAGG - Intergenic
1057350341 9:94291978-94292000 AAATTTGCATAGAAAGGCACAGG + Intronic
1058813965 9:108666969-108666991 AAATTTGGAGACAGATGCACGGG + Intergenic
1059266231 9:113034004-113034026 TAATTTTGATATGAATGCACTGG + Intergenic
1060378798 9:123144500-123144522 TAAGTTTGATGCAAATTCACTGG - Intronic
1060756027 9:126214384-126214406 AAGTTTTGCTACAAATGGAAGGG - Intergenic
1061447106 9:130645650-130645672 AAATTTGTATAGAAATGCAAAGG - Intergenic
1186260294 X:7770715-7770737 AAATTTTGAAACATATTCATTGG - Intergenic
1186291685 X:8107354-8107376 AACTTTTGTCACACATGCACAGG + Intergenic
1186325210 X:8468405-8468427 AAATATTTATATAAATGCACAGG + Intergenic
1186553796 X:10535646-10535668 AAATTTGTATACAAATGCTTTGG - Intronic
1186603324 X:11062144-11062166 AAATTATTATAGAAAAGCACTGG + Intergenic
1187722777 X:22169284-22169306 AAATATTGATACAGTTGCTCTGG + Intronic
1188179179 X:27033037-27033059 AAATTTTGAAAAATATGCATAGG - Intergenic
1188922400 X:35993300-35993322 AAAGTTTGATACAAGAGCAAAGG + Intergenic
1189041602 X:37546492-37546514 AAATTTTTATAGAAATTCAAAGG - Intronic
1189648417 X:43159926-43159948 AATTTTTAGTACAAATGTACTGG - Intergenic
1191031193 X:55974377-55974399 AAATTTTGATAAATATGGGCTGG - Intergenic
1191170069 X:57436153-57436175 AATTTTTGAAACAAATGAAAAGG + Intronic
1191201075 X:57782356-57782378 AATATGTGATCCAAATGCACAGG - Intergenic
1192216199 X:69160774-69160796 AGCTTTTGATGCAAATGCAAGGG + Intergenic
1192347010 X:70318499-70318521 AAATTCTTATACATATGCATTGG - Intronic
1192372671 X:70527935-70527957 AAATGTTAATACAAATCAACTGG + Intergenic
1192834331 X:74783259-74783281 AGAATGTGATACAAATGCAAGGG + Intronic
1193408814 X:81139128-81139150 AAATTTCTATGAAAATGCACAGG + Intronic
1193412601 X:81182684-81182706 AAATTGTGGTACATATACACAGG - Intronic
1193800155 X:85925329-85925351 AACTTTTGATGGAAAAGCACTGG + Intronic
1194297969 X:92150582-92150604 AAATTTTTATTGAAATGCAAAGG - Intronic
1194406995 X:93508977-93508999 AAATTTATATAAAAATTCACAGG + Intergenic
1194875332 X:99180181-99180203 GAATTGTGTTACAAATGCAATGG - Intergenic
1195010272 X:100726821-100726843 CAATTTTGTTACATATGCAGTGG + Intronic
1195024402 X:100861786-100861808 AAATTTTGAAACAAAAGGACAGG - Intronic
1195785484 X:108516108-108516130 TAATTGTGTTAGAAATGCACAGG + Intronic
1195977064 X:110538674-110538696 AAATTTATATAGAAAGGCACAGG + Intergenic
1196263850 X:113618059-113618081 AAATTTTGAGACAAGTGATCAGG + Intergenic
1196309062 X:114139851-114139873 AAATTATTATACAAATGACCTGG - Intergenic
1199569049 X:149248862-149248884 AAATTTTTATAGAAATGTAAGGG - Intergenic
1199978940 X:152910388-152910410 ATATTTACATAAAAATGCACAGG - Intergenic
1200615578 Y:5375554-5375576 AAATTTTTATTGAAATGCAAAGG - Intronic
1200957009 Y:8959436-8959458 AAATTTTTCTACACATACACAGG - Intergenic