ID: 1117625356

View in Genome Browser
Species Human (GRCh38)
Location 14:57631552-57631574
Sequence TGCCTGCCTCGTTATGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117625353_1117625356 -1 Left 1117625353 14:57631530-57631552 CCTGTGCATTTGTATCAAAATTT 0: 1
1: 1
2: 2
3: 33
4: 372
Right 1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG 0: 1
1: 1
2: 1
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117625356 Original CRISPR TGCCTGCCTCGTTATGAGGG AGG Intronic
900886824 1:5421143-5421165 TGCATGCCTCCTTATCATGGAGG + Intergenic
900905106 1:5551614-5551636 TGCCTGCCAGGAGATGAGGGTGG - Intergenic
901400127 1:9010157-9010179 TGCCTGCCTGGTGCTGACGGTGG - Exonic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
905904437 1:41608467-41608489 TGCCTGCCTCTTTGTGAAGAAGG + Intronic
907893901 1:58665523-58665545 TACCTGCCTGGTTATAAGTGAGG - Exonic
908356699 1:63329816-63329838 TTCTTGCCTCGTGATGTGGGAGG + Intergenic
909681454 1:78296003-78296025 TGCCTGACTTTTTATGAGGGAGG + Intergenic
913258011 1:116972862-116972884 TGCCTGCAGCGTTTTCAGGGAGG + Intronic
915909847 1:159908186-159908208 TGCCTCCCTACTTATCAGGGTGG - Intergenic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
1067925462 10:50504032-50504054 TACCTGCATCGATATGAGAGAGG + Intronic
1070312436 10:75283514-75283536 GGCCTGCCTCTTCCTGAGGGTGG + Intergenic
1071789397 10:88938419-88938441 TGCCTGCCTTCTAATGAGGAAGG + Intronic
1073468237 10:103706895-103706917 TTCCTGCCTATTTATGAGGACGG + Intronic
1074113210 10:110437255-110437277 TGCCTGCCTGCTTCAGAGGGTGG + Intergenic
1075022280 10:118960646-118960668 TGCCTGCCTCTTCATGGGGCTGG + Intergenic
1075894495 10:125983407-125983429 TGCCTTCATCATCATGAGGGAGG - Intronic
1076152914 10:128177936-128177958 GGCCAGCCTGGTTATGGGGGCGG - Intergenic
1085703295 11:78764038-78764060 TGTCTGCGTCCTTATCAGGGAGG + Intronic
1088395984 11:109370178-109370200 TGACTGCCTTGTTATCAAGGGGG - Intergenic
1089916343 11:122160762-122160784 TCCCTGCCTCGCTATGATAGTGG + Intergenic
1090620512 11:128556590-128556612 TCCCTGCGTCTTTATGTGGGGGG - Intronic
1091334470 11:134755993-134756015 TGCCACCCTCGTTATGTTGGGGG + Intergenic
1102815616 12:115863298-115863320 TGCCTGCGTCTTTATGAAGGTGG - Intergenic
1104337589 12:127914313-127914335 TGCTTGCCAAGTTGTGAGGGAGG + Intergenic
1105933346 13:25073755-25073777 TTCCTTCCTCTTTTTGAGGGGGG - Intergenic
1106118848 13:26840663-26840685 TGCCTGGCTCGTTATGATTCTGG - Intergenic
1107819690 13:44275208-44275230 TGCTTGCTTCTTTATGAGGCTGG - Intergenic
1117007417 14:51435979-51436001 TGCCTGCTTCCTGATGAGCGAGG + Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1121337234 14:93084884-93084906 TTCCTGCCTCTTGATGAGGAAGG - Intronic
1122004558 14:98691325-98691347 TGCCTGTCTCTCTATGAGGTAGG - Intergenic
1123040251 14:105487434-105487456 CGCCTGCCCCGGGATGAGGGTGG + Intronic
1131962592 15:97805177-97805199 TGGCTGCCTGGTTGTAAGGGAGG + Intergenic
1133611865 16:7441116-7441138 TGCCTTCCTCTATATGAGGTGGG + Intronic
1137610129 16:49812345-49812367 TGCCTGGCTGGCTATGAGAGGGG + Intronic
1141004710 16:80341350-80341372 TGCCTGCATGGTTGTGAGTGTGG + Intergenic
1144768574 17:17746362-17746384 TGCCTGCCTCGCTCTGAAAGAGG - Intronic
1145264207 17:21371762-21371784 TGCCTGCCTCCTGATGGGGCAGG + Intergenic
1146058331 17:29592074-29592096 TTCCTGCCTTGTTCTGAGGTGGG + Intronic
1147957036 17:44141898-44141920 TGCCTGCCCCTTTAAGAAGGCGG + Exonic
1148143220 17:45342869-45342891 TTCCTGCCTTGCTAGGAGGGTGG + Intergenic
1157393998 18:47326736-47326758 TGCCTGACTCGGTGTTAGGGAGG - Intergenic
1157862774 18:51156244-51156266 TGCCTACCTCTTTATGAGGGAGG - Intergenic
1160335207 18:78032705-78032727 CGCCTGCCTGATTATGAGGCGGG + Intergenic
1162116717 19:8434485-8434507 TGGCTGCCTCGTTGTGTGTGTGG - Intronic
1162580830 19:11529243-11529265 GGCCTGGCTCGTTATGAGGCGGG - Intergenic
1164501542 19:28824280-28824302 TGGCTGATTAGTTATGAGGGAGG - Intergenic
1166641663 19:44499381-44499403 TGCCAGCATCGTTATGAAGCAGG - Intronic
1168243458 19:55098556-55098578 TGCCTGCCTGGTGGTGGGGGCGG - Intronic
925442930 2:3903943-3903965 AGCCTGCTTGGTTTTGAGGGTGG + Intergenic
926146271 2:10398727-10398749 TGCCTTCCTCTTCCTGAGGGAGG + Intronic
931716354 2:65032198-65032220 AGCCTTCCACGTTATAAGGGAGG - Intergenic
937336374 2:121064801-121064823 TGCCTTCTTCATTATCAGGGTGG - Intergenic
1171486934 20:25491897-25491919 TGCCTCCCTCCTTGGGAGGGAGG - Intronic
1172810183 20:37641792-37641814 TCTGTGCCTCATTATGAGGGTGG + Intergenic
1173861952 20:46289682-46289704 TGCCTGGGGCGATATGAGGGAGG + Intronic
1174257786 20:49271132-49271154 TGCCTGCCTGCTTATGTGGTAGG - Exonic
1177481453 21:21695148-21695170 TGCCTGTCCGGTAATGAGGGAGG - Intergenic
1179873892 21:44257816-44257838 TGCCTGGCGCCTTCTGAGGGAGG - Intronic
1179911764 21:44454681-44454703 TGCTTGCCTGGGGATGAGGGAGG + Intergenic
1184676846 22:46048039-46048061 TGGCTGCCTTGTTAGGAGGTGGG - Intergenic
949516877 3:4815306-4815328 TGCCTGCCCAGTTATGCGGGAGG + Intronic
950718944 3:14868820-14868842 TGCCTGGCTCATTGTCAGGGAGG + Intronic
955948305 3:64216826-64216848 TGCCTGCCTCATTAGGAAGGAGG - Intronic
955962496 3:64355238-64355260 AGCCTGCCTAGTTACAAGGGAGG + Intronic
968963480 4:3757706-3757728 TGCCTGCCTCGTGGAGAGAGGGG + Intergenic
972398183 4:38674828-38674850 TGCCTGCCCCTTCCTGAGGGAGG - Intronic
974125822 4:57693958-57693980 TTCCTGCCTCTTTGTGAGGAAGG + Intergenic
975791459 4:77957106-77957128 TGCCTGCTTCTTTATGTGGGAGG - Intergenic
988493348 5:31723962-31723984 TTCCTGCCTCTTCATGAGAGAGG - Intronic
1001300084 5:170527094-170527116 AGCCAGCCTTGTGATGAGGGAGG - Intronic
1009878465 6:69535594-69535616 TTCCTGCCTGGTTTTGAGTGAGG - Intergenic
1019748735 7:2715440-2715462 TGCCTGGCTCATGCTGAGGGTGG + Exonic
1028614191 7:92746770-92746792 TGCTTGCCTCAATATGATGGGGG + Intronic
1029026979 7:97427161-97427183 TGCCTGGCTCCGTATGTGGGGGG - Intergenic
1033863357 7:145658543-145658565 TCCCTGACTAGTTATGAGGTAGG - Intergenic
1034342010 7:150363532-150363554 TGCCTGACTCATGATGAGGCCGG + Intergenic
1037974275 8:23199108-23199130 TGCCTGTCCCCTTGTGAGGGTGG + Intronic
1038330498 8:26604499-26604521 TGCCTGCCTCATCTTGAGAGAGG + Intronic
1042674931 8:71309752-71309774 TCCCTGCCTCATTATGAAGTGGG - Intronic
1046596652 8:116269373-116269395 TGCTTGCCTCAGAATGAGGGAGG + Intergenic
1190157895 X:48008381-48008403 TGCATGGCTCATTATGAGAGTGG + Exonic
1190173667 X:48131266-48131288 TGCATGGCTCATTATGAGAGTGG + Exonic
1192506231 X:71685328-71685350 GGCCTGCCTGGTGATGAGGTGGG + Intergenic
1192520466 X:71796220-71796242 GGCCTGCCTGGTGATGAGGTGGG - Intergenic
1192524301 X:71828348-71828370 GGCCTGCCTGGTGATGAGGTGGG + Intergenic