ID: 1117629703

View in Genome Browser
Species Human (GRCh38)
Location 14:57677711-57677733
Sequence ACATATATGCATAAAATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1436
Summary {0: 1, 1: 1, 2: 5, 3: 98, 4: 1331}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117629700_1117629703 -10 Left 1117629700 14:57677698-57677720 CCCCTTCACACATACATATATGC 0: 1
1: 1
2: 6
3: 94
4: 838
Right 1117629703 14:57677711-57677733 ACATATATGCATAAAATGAAAGG 0: 1
1: 1
2: 5
3: 98
4: 1331
1117629699_1117629703 7 Left 1117629699 14:57677681-57677703 CCTATAGGCAAAATGCTCCCCTT 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1117629703 14:57677711-57677733 ACATATATGCATAAAATGAAAGG 0: 1
1: 1
2: 5
3: 98
4: 1331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117629703 Original CRISPR ACATATATGCATAAAATGAA AGG Intronic
902601724 1:17544251-17544273 ATATATATGTATAAAATTTATGG - Intronic
902880084 1:19366302-19366324 ATATATATAAATAAAATAAATGG + Intronic
904231325 1:29075751-29075773 AAATAAATAAATAAAATGAATGG - Intronic
905566922 1:38973115-38973137 TCATAACTGCATAAAATTAATGG - Intergenic
906174906 1:43762700-43762722 ATACATATGCATAAAATAACTGG + Intronic
906252735 1:44323532-44323554 ACAGAGATGAATACAATGAAAGG + Intronic
906700640 1:47855421-47855443 ACATATGTGCATAAACAGTATGG + Intronic
906758352 1:48344651-48344673 ACACATAGGCTTAAAATAAAGGG + Intronic
906893172 1:49740172-49740194 ACACATAGGCTTAAAATAAAGGG + Intronic
906911576 1:49957729-49957751 ACACATAGGCTTAAAATAAAGGG - Intronic
906951725 1:50340463-50340485 ATATTTAGGAATAAAATGAATGG - Intergenic
907043006 1:51280301-51280323 ACAGATATGTATTAAATGAAGGG + Intergenic
907835347 1:58103433-58103455 ACCCATATTAATAAAATGAATGG + Intronic
908306281 1:62821751-62821773 ACATACATGCAAATATTGAAAGG - Intronic
908469462 1:64429330-64429352 ACATATATGAATGAAAAAAAAGG - Intergenic
908593942 1:65665398-65665420 ACACATAGGCTGAAAATGAAGGG - Intergenic
908767549 1:67568186-67568208 ACAAATATTCATTAAATAAATGG - Intergenic
908840504 1:68275572-68275594 ATATATTTCCATAACATGAAGGG + Intergenic
908945393 1:69490014-69490036 AAATATATGAATAAAATTGATGG + Intergenic
909117613 1:71558503-71558525 ACATATATGAATGACATGGAAGG - Intronic
909211742 1:72832728-72832750 ACACATATGCTCAAAATAAAGGG + Intergenic
909239776 1:73197540-73197562 ACATATATCCATATATTGAAAGG + Intergenic
909305001 1:74062784-74062806 GTATATATGGATACAATGAAGGG + Intronic
909316490 1:74226006-74226028 ACATATAGGCTGAAAATAAAGGG + Intronic
909380174 1:74988787-74988809 ACACATAGGCTCAAAATGAAGGG + Intergenic
909439311 1:75679885-75679907 ACATATAGGCTCAAAATAAAAGG + Intergenic
909493615 1:76253123-76253145 ACATATATACACTAAAAGAATGG + Intronic
909509006 1:76429881-76429903 ACATATATCAATAAAAGGAATGG - Intronic
909513936 1:76486594-76486616 ACATATAGGCTCAAAATAAAGGG - Intronic
909751214 1:79164313-79164335 ATAAATAAGTATAAAATGAAGGG - Intergenic
909811979 1:79942261-79942283 ACACATACGCTCAAAATGAAAGG - Intergenic
909834425 1:80235551-80235573 ATATATATGTATATAATTAAAGG - Intergenic
910327109 1:86022503-86022525 TCATATTTACATAAAATTAATGG + Intronic
910596665 1:88987988-88988010 ACCTATATTCATAACTTGAAGGG + Intronic
910815920 1:91290323-91290345 ACACATAGGCTTAAAATAAAAGG + Intronic
910816782 1:91299061-91299083 ACATATAGGCTCAAAATAAAGGG + Intronic
910821123 1:91348485-91348507 TCATACATGTAAAAAATGAAGGG + Intronic
910822739 1:91368871-91368893 ACATATATGCTCAAAATAAAGGG + Intronic
911360377 1:96868462-96868484 AAATATATACATAATATGCATGG + Intergenic
911516967 1:98879462-98879484 ACACATAGGCTTAAAATAAAGGG - Intergenic
911668723 1:100584676-100584698 TCATCTAGGCATCAAATGAAAGG + Intergenic
911815849 1:102349666-102349688 ACATATAGGCACAGAATTAAAGG - Intergenic
911946579 1:104117227-104117249 ATATATATACATAAAATAAGAGG - Intergenic
912041294 1:105394560-105394582 ACACATAGACTTAAAATGAAGGG - Intergenic
912101239 1:106208684-106208706 ACATTCATCCATTAAATGAATGG + Intergenic
912135335 1:106654424-106654446 ACATATAATGATGAAATGAATGG + Intergenic
912150740 1:106855489-106855511 ACACATAGGCTCAAAATGAAGGG + Intergenic
912152075 1:106872066-106872088 ACATATAGGCTCAAAATAAAGGG + Intergenic
912460968 1:109831112-109831134 ACACATATGCATAAAAGTATGGG + Intergenic
912743430 1:112223545-112223567 ACATATAGGCTCAAAATAAAAGG + Intergenic
912940611 1:114041534-114041556 ACATATATTTGTTAAATGAATGG + Intergenic
913005351 1:114624938-114624960 AGATATATTAATAAAATGGAAGG + Intronic
913342001 1:117767832-117767854 ACATATAGGCTCAAAATAAAGGG - Intergenic
913472804 1:119206477-119206499 ACATATATATATAATTTGAAAGG - Intergenic
913931095 1:124965709-124965731 ACATATAGGCTCAAAATAAAAGG - Intergenic
915011722 1:152693161-152693183 ACATATAGGCTCAAAATAAAAGG + Intergenic
915858061 1:159411567-159411589 ACATATAGGCTCAAAATAAAAGG - Intergenic
915872159 1:159572822-159572844 ACATATAGGCTCAAAATAAAAGG - Intergenic
915886998 1:159732707-159732729 ACATATAGGCTCAAAATAAAGGG + Intergenic
916224549 1:162476264-162476286 AAATAAATAAATAAAATGAAAGG - Intergenic
916327960 1:163584294-163584316 AAATATATGCATATAAATAAAGG + Intergenic
916467570 1:165087222-165087244 ACATATAGGCTCAAAATAAAAGG + Intergenic
916543634 1:165781876-165781898 ACATATAGGCTCAAAATAAAGGG - Intronic
916612590 1:166407802-166407824 ACATATAGGCTCAAAATAAAGGG - Intergenic
916654464 1:166861477-166861499 AACTAAATGAATAAAATGAATGG + Intronic
916940676 1:169673974-169673996 ACATATGTACATACAATGGACGG - Intronic
916949699 1:169767046-169767068 ATATATATTGATACAATGAATGG + Intronic
916968406 1:169979792-169979814 ACATATGTTCACCAAATGAAAGG + Intronic
917126423 1:171692705-171692727 ACACATAGGCTTAAAATAAACGG - Intergenic
917308589 1:173653974-173653996 ACACATATGCTCAAAATAAAGGG - Intronic
917313166 1:173697938-173697960 ACATATAGGCTCAAAATAAAGGG + Intergenic
917553684 1:176061942-176061964 ACTTATATCCATAATATAAAAGG + Intronic
917564255 1:176195412-176195434 ACAAGTATACAGAAAATGAATGG + Intronic
917767282 1:178235394-178235416 CCATATATGTGTAAAATGCAGGG - Intronic
917935056 1:179858332-179858354 ACATAAATACATAAATGGAAAGG + Intronic
918088807 1:181269738-181269760 ACACATAGGCTTAAAATAAATGG - Intergenic
918408328 1:184233120-184233142 ACACATATGCTCAAAATAAAGGG - Intergenic
918553917 1:185776740-185776762 ATAAAAATGCATAATATGAATGG + Intronic
918646605 1:186913392-186913414 ACATAGATGAAATAAATGAATGG - Intronic
918922085 1:190725859-190725881 ATATATATTTGTAAAATGAATGG - Intergenic
918974998 1:191472662-191472684 ACATATAGGCTCAAAATAAAGGG + Intergenic
919376884 1:196806234-196806256 ACTTATATACATGAAAGGAATGG + Intergenic
919386587 1:196931116-196931138 ACTTATATACATGAAAGGAATGG + Intronic
919514519 1:198506098-198506120 ACATATAGGCTGAAAGTGAAAGG - Intergenic
919531684 1:198729222-198729244 AAATAAATAAATAAAATGAATGG - Intronic
920225970 1:204439333-204439355 ATATATAAGAATAAAAAGAATGG + Intronic
920461889 1:206146874-206146896 ATATATATGCATAAAAAGGCAGG + Intergenic
920837765 1:209527888-209527910 ATATCTAAGGATAAAATGAAGGG - Intergenic
921004348 1:211077881-211077903 ACATATAGGCTCAAAATAAAGGG + Intronic
921018803 1:211217300-211217322 ACATATATATATAAAATAAAAGG - Intergenic
921113871 1:212067878-212067900 AAATATATGCAGAATATTAAAGG + Intronic
921296613 1:213710384-213710406 ACATATAGGCTCAAAATAAAGGG - Intergenic
921547325 1:216487719-216487741 ACACATAGGCTTAAAATGAAAGG + Intergenic
921575227 1:216827722-216827744 GGATGTATGGATAAAATGAAGGG + Intronic
921720766 1:218468437-218468459 ACTTATATACAGAAAATAAAAGG - Intergenic
921760580 1:218909144-218909166 ACATTTATGAATAAAAGTAAAGG - Intergenic
921830970 1:219727172-219727194 ACAAATAGGCAGAAAGTGAAGGG + Intronic
922200770 1:223399402-223399424 ACATATAGGCTCAAAATAAAAGG - Intergenic
922374173 1:224944360-224944382 ACATATAGGCTCAAAATAAAGGG - Intronic
922895499 1:229096991-229097013 AAAAATATCCAGAAAATGAATGG - Intergenic
923180505 1:231513703-231513725 CAATATATGCATAAAAAGAAAGG - Intergenic
923282364 1:232456208-232456230 ACATACATATATAAAATAAATGG - Intronic
923411062 1:233709555-233709577 ACATATATGTATAATATGTTAGG - Intergenic
923824620 1:237486166-237486188 ACATATATACGTACAAAGAAAGG + Intronic
923835227 1:237603698-237603720 ACACATATGCTCAAAATAAAGGG + Intronic
923855524 1:237841147-237841169 ACACATAGGCTTAAAATAAAGGG + Intergenic
923916169 1:238508056-238508078 ACATAGATTCATCAAATAAATGG + Intergenic
923943306 1:238854070-238854092 ACATATAGGCTCAAAATAAAGGG - Intergenic
924152204 1:241140817-241140839 ACTTTTATGCATAAAACAAATGG + Intronic
924172895 1:241359571-241359593 ACATACATTAATGAAATGAATGG + Intergenic
924575129 1:245273727-245273749 ACACATAGGCTGAAAATGAAAGG - Intronic
924873914 1:248079740-248079762 ACATATATGCAAAAACTAATTGG + Intronic
924901205 1:248402432-248402454 ACATGAATGCATAAAATAACTGG + Intergenic
1063026883 10:2188119-2188141 ACAGATATGCACAAAATCATTGG - Intergenic
1064835175 10:19519326-19519348 ACATATAAGCATGAAGTGAAAGG + Intronic
1064840383 10:19585094-19585116 ACACATAGGCACAAAATAAAAGG - Intronic
1065196511 10:23271045-23271067 ACACATATGCTCAAAATAAAGGG + Intronic
1065735750 10:28750781-28750803 ACATATAGGCTCAAAATAAAGGG - Intergenic
1065985733 10:30949523-30949545 ACATATAGGCTCAAAATAAAAGG + Intronic
1066096376 10:32076410-32076432 TCATATTTGGATAAAATGACTGG + Intergenic
1066284777 10:33954083-33954105 TCACATATGCAGAATATGAAAGG + Intergenic
1066347897 10:34607039-34607061 AGATAGATGCATAAGATGAGAGG + Intronic
1066589473 10:36978446-36978468 ATATAAAGTCATAAAATGAAAGG - Intergenic
1066927440 10:41715292-41715314 ACATATAGGCTCAAAATAAAGGG + Intergenic
1067127411 10:43531335-43531357 ACATATAGGCTCAAAATAAAGGG - Intergenic
1067324254 10:45251236-45251258 ACAGATACACAAAAAATGAAAGG - Intergenic
1067361051 10:45579198-45579220 ACATATATGCATAAAAAGAAAGG + Intronic
1067785974 10:49247745-49247767 ACATATAGGCTCAAAATAAAAGG + Intergenic
1067916858 10:50409005-50409027 ATCTATATGAATAAAATGAATGG - Intronic
1068245075 10:54354849-54354871 AAATATATGTATTAAATGGAAGG + Intronic
1068435496 10:56985664-56985686 ACACATAGGCTTAAAATAAAGGG - Intergenic
1068567845 10:58594992-58595014 ACATATAGGCTCAAAATAAAGGG + Intronic
1068820128 10:61365863-61365885 ACATATGTGCATAAAATGTTAGG + Intergenic
1069073995 10:64019246-64019268 ACACATAGGCTTAAAATAAAGGG - Intergenic
1069093248 10:64227859-64227881 ACACATATGCTCAAAATAAAGGG - Intergenic
1069110435 10:64440240-64440262 ACATATAGGCTCAAAATAAAGGG - Intergenic
1069148049 10:64920156-64920178 ACATATAAACAGAAAATAAAGGG + Intergenic
1069499534 10:68938738-68938760 ACACATATGGATAAACGGAATGG - Intronic
1070214293 10:74360804-74360826 ACATAGATGCTGAAAGTGAAGGG - Intronic
1070221030 10:74444924-74444946 ACATACATGCAGAAGATTAAAGG + Intronic
1070405714 10:76092868-76092890 AAAAAAATGCATAAATTGAAAGG - Intronic
1070411540 10:76146560-76146582 ACATATAGGCTCAAAATAAAGGG - Intronic
1070473910 10:76813522-76813544 ACATATATGATTACATTGAATGG + Intergenic
1071844555 10:89507851-89507873 ACATATAGGCTCAAAATAAAGGG + Intronic
1072476719 10:95768541-95768563 AAATAAATGAAGAAAATGAAAGG - Intronic
1072774853 10:98180918-98180940 ACACATAGGCTTAAAATAAAGGG - Intronic
1072858164 10:98971937-98971959 ACATAAAAACATAAAATGTAGGG - Intronic
1072859279 10:98985764-98985786 ACACATAGGCACAAAATAAACGG + Intronic
1072902148 10:99418064-99418086 ATATATATATATAAAAAGAAGGG + Intronic
1073022451 10:100456716-100456738 ACACATAGGCTCAAAATGAAGGG + Intergenic
1073437833 10:103532051-103532073 ACATATAGACTGAAAATGAAGGG - Intronic
1073508703 10:104027377-104027399 ACATATATACATATTATGTATGG + Exonic
1073917607 10:108424860-108424882 ACATATAAGAATAAACTCAAAGG - Intergenic
1073987495 10:109225748-109225770 ACATATAGGCTCAAAATAAAAGG + Intergenic
1074286893 10:112106058-112106080 ACATATAGGCTCAAAATAAAAGG + Intergenic
1074348774 10:112714497-112714519 ATAAATATTCATCAAATGAAAGG + Intronic
1074355937 10:112783121-112783143 ACATATATACATTGAATGAAAGG + Intronic
1074651971 10:115534473-115534495 ACACATAAGCTCAAAATGAAAGG - Intronic
1074657782 10:115614886-115614908 ACACATAGACTTAAAATGAAGGG - Intronic
1074668270 10:115757027-115757049 ACACATAGGCTCAAAATGAATGG - Intronic
1074795263 10:116937032-116937054 ACACATAGGCTTAAAATAAAGGG - Intronic
1074801999 10:117009145-117009167 CCAAATATGCACAAAAGGAAAGG + Intronic
1075193559 10:120334014-120334036 AGATATATTCATAAACTGACAGG - Intergenic
1075579805 10:123608758-123608780 ACATAAATGCACAGAATGGAAGG - Intergenic
1075591764 10:123696802-123696824 ACCTATATGCATAAAATCATGGG - Intergenic
1076299855 10:129417127-129417149 ACATTTAAGCAGAAAATAAAGGG - Intergenic
1077428080 11:2496552-2496574 ACACATATGCTCAAAATAAAGGG - Intronic
1077591658 11:3496824-3496846 ACACATATGCTCAAAATAAAGGG - Intergenic
1077683080 11:4264625-4264647 ACATATAGGCTCAAAATAAAGGG + Intergenic
1077831387 11:5874991-5875013 ATATATATGTATAAAATTGATGG - Intronic
1078393819 11:10960402-10960424 ACACATATGCTGAAAGTGAAGGG + Intergenic
1078394272 11:10965475-10965497 ACACATAGGCTCAAAATGAACGG + Intergenic
1078553604 11:12299646-12299668 ACGTTTATGCAAAAAATTAAAGG - Intronic
1078691531 11:13584905-13584927 ACATATAGGCTCAAAATAAAGGG + Intergenic
1078962780 11:16298356-16298378 ACATAAATGTCTAAAATGTAAGG + Intronic
1079046539 11:17109097-17109119 GCATTTAAGCATAAATTGAATGG + Intronic
1079598880 11:22286906-22286928 ACACATAGGCTTAAAATAAAAGG + Intergenic
1079782681 11:24627887-24627909 AAATATATGCACACATTGAAGGG - Intronic
1079841662 11:25408966-25408988 ACATATCTGCATACAAGAAATGG + Intergenic
1079859341 11:25647642-25647664 ACATATAGGCTCAAAATAAAAGG - Intergenic
1079909299 11:26289493-26289515 ACATATATACTTAGAATCAAAGG - Intergenic
1080150737 11:29049512-29049534 ACACATAGGCACAAAATAAAGGG - Intergenic
1080488207 11:32733041-32733063 ACATATAGGCTCAAAATAAAGGG + Intronic
1080965393 11:37208971-37208993 ACATATAGGCTCAAAATAAAGGG - Intergenic
1080968982 11:37247227-37247249 ATATATATATATAAAATTAAGGG - Intergenic
1081079988 11:38729980-38730002 ACATATAGGCTCAAAATAAAGGG - Intergenic
1081172230 11:39883158-39883180 ACATATAGGCTCAAAATAAAAGG + Intergenic
1081363522 11:42207600-42207622 ACATATAGGCTCAAAATAAAGGG + Intergenic
1081389913 11:42516905-42516927 ACATATAGGCTCAAAATAAAGGG + Intergenic
1081433576 11:43003238-43003260 ACATATAGGCTTAAAATAAAAGG - Intergenic
1081516530 11:43836741-43836763 AGAAATATAGATAAAATGAAAGG + Intronic
1082133356 11:48517939-48517961 ACACATAGGCTCAAAATGAAAGG - Intergenic
1082216331 11:49574402-49574424 ACTTAAATGAATAAAATGAATGG + Intergenic
1082298463 11:50474273-50474295 ACATATAGGCTCAAAATAAAGGG - Intergenic
1082315966 11:50722622-50722644 AAATATATTCATATAATAAATGG - Intergenic
1082578686 11:54840122-54840144 ACATATAGGCTCAAAATAAAAGG + Intergenic
1082617218 11:55375545-55375567 ACACATAGGCTCAAAATGAAGGG + Intergenic
1082618902 11:55397133-55397155 ACATATAGGCTCAAAATAAAGGG - Intergenic
1082872442 11:57955791-57955813 ACATTTAAGCAGAAAATGAAAGG - Intergenic
1082951256 11:58818220-58818242 ACATATAGGCTCAAAATAAAGGG + Intergenic
1083128404 11:60597282-60597304 ACATATAGGCTGAAAGTGAAGGG + Intergenic
1083557352 11:63641308-63641330 ACATATATGTAGATTATGAATGG - Intronic
1084402011 11:68949958-68949980 ACATATATGCATAGAAAAGATGG + Intergenic
1084874572 11:72121440-72121462 ATATATATATATAAAATGTATGG + Intronic
1085850310 11:80111614-80111636 ACATATAGGCTCAAAATAAAGGG + Intergenic
1085898598 11:80669571-80669593 ATATAAAGTCATAAAATGAAAGG + Intergenic
1086175495 11:83886221-83886243 ACATATAGGCTCAAAATAAAAGG + Intronic
1086186520 11:84023729-84023751 TCATAAATGCATAAAATATAGGG + Intronic
1086308380 11:85507079-85507101 ACACATAGGCTTAAAATAAAGGG - Intronic
1086326235 11:85702756-85702778 ACATATGATCAAAAAATGAACGG + Intronic
1086409340 11:86528128-86528150 ACATATAGGCTTAAAATAAAGGG + Intronic
1086462981 11:87023850-87023872 ACACATGGGCTTAAAATGAAGGG + Intergenic
1086529001 11:87762258-87762280 ACATATAGGCTCAAAATAAAGGG - Intergenic
1086548753 11:88029502-88029524 ACACATAGGCTTAAAATAAAAGG + Intergenic
1086633250 11:89050090-89050112 ACTTAAATGAATAAAATGCATGG - Intronic
1087080362 11:94165039-94165061 ACATATAGGCTGAAAATGAAGGG - Intronic
1087489110 11:98800701-98800723 AAATCTCAGCATAAAATGAAAGG + Intergenic
1087690130 11:101311255-101311277 ATATATATATATAAAATGGATGG - Intergenic
1087695076 11:101367665-101367687 ACATATAGGCTCAAAATAAAGGG - Intergenic
1087779108 11:102284690-102284712 ATGTTTATCCATAAAATGAAAGG - Intergenic
1088397075 11:109380813-109380835 GCAGTTATGCAGAAAATGAAAGG + Intergenic
1088845139 11:113658869-113658891 ACATATAGGCTCAAAATAAAAGG + Intergenic
1088923287 11:114277384-114277406 ATATATATGCATGAAATGAGTGG + Intronic
1088935803 11:114399529-114399551 ACATATCTGAAAAAAGTGAAGGG + Intronic
1088974946 11:114807464-114807486 ACATATAGGCTCAAAATAAAGGG + Intergenic
1089100255 11:115957095-115957117 ACATAAAAGCAAAAAATGGATGG + Intergenic
1089142248 11:116295008-116295030 ATATATATTCATAAAAATAAGGG - Intergenic
1089142619 11:116299167-116299189 AGATAAATGCAGAAATTGAAAGG - Intergenic
1090547352 11:127780566-127780588 ACATATAGGCTCAAAATAAAAGG - Intergenic
1090576404 11:128109338-128109360 ACATATAGGCTCAAAATGAAGGG + Intergenic
1091246823 11:134103635-134103657 ACACATAGGCTTAAAATAAAGGG + Intronic
1091572335 12:1698688-1698710 ATAAATATACATAAAATGTATGG - Intronic
1092638373 12:10476837-10476859 ACACATAGGCTTAAAATAAAGGG - Intergenic
1092671792 12:10870400-10870422 ACATATAGACTGAAAATGAAGGG + Intronic
1092956204 12:13552484-13552506 ACAAATACCCATAAAAGGAAAGG - Exonic
1093256062 12:16869821-16869843 AAATACATGCATAAATTGATTGG + Intergenic
1093307941 12:17542981-17543003 ACATATAGACATAAAGGGAAGGG - Intergenic
1093370576 12:18359813-18359835 ACAAATAGGCCAAAAATGAAAGG - Intronic
1093402517 12:18763125-18763147 ACACATAGGCACAAAATTAAGGG + Intergenic
1093550038 12:20398643-20398665 AAATATATAAATTAAATGAATGG + Intronic
1093672086 12:21888980-21889002 AAATATATGTATGAAATAAATGG + Intronic
1093676616 12:21947959-21947981 ACATATAGGCTGAAAATGAAGGG + Intergenic
1093982205 12:25487503-25487525 ACACATATGCTCAAAATAAAAGG - Intronic
1094273572 12:28644139-28644161 ACACATAGGCTCAAAATGAAGGG - Intergenic
1094631677 12:32181568-32181590 ATTTATATGCATAAAATGAGAGG - Intronic
1094755634 12:33464987-33465009 ACATATAGGCTCAAAATAAAGGG + Intergenic
1095059360 12:37664459-37664481 ACATATAGGCTCAAAATAAAAGG - Intergenic
1095060632 12:37683873-37683895 ACATATAGGCTCAAAATAAAAGG + Intergenic
1095065250 12:37763965-37763987 ACATATAGGCTCAAAATAAAAGG + Intergenic
1095128553 12:38510273-38510295 ACACATAGGCACAAAATAAAGGG + Intergenic
1095140763 12:38659168-38659190 ACACATAGGCTCAAAATGAAGGG + Intronic
1095185442 12:39195900-39195922 ACATATAGGCTCAAAATAAAAGG - Intergenic
1095191456 12:39262676-39262698 ACATATAGGCTCAAAATAAAGGG + Intergenic
1095720428 12:45394118-45394140 ACATATAGGCTCAAAATAAAGGG + Intronic
1095751865 12:45721457-45721479 ACATATATGTAAAACATGATGGG + Intergenic
1096032878 12:48436031-48436053 ACACATAGGCTCAAAATGAAGGG + Intergenic
1096044458 12:48550745-48550767 ACATATAGGCTCAAAATAAAGGG - Intergenic
1096371559 12:51073243-51073265 ACATACATACATAAAATTGAGGG + Intronic
1096568738 12:52505228-52505250 ACATATATGATTAAAAGTAAAGG - Intergenic
1096950314 12:55461575-55461597 ACATATAGGCTCAAAATAAAGGG + Intergenic
1097150062 12:56970565-56970587 ACATATAGGCTCAAAATAAAGGG + Intergenic
1097460707 12:59858404-59858426 ACATATAGGCTCAAAATAAAGGG + Intergenic
1097948592 12:65401478-65401500 ACATATAAGCTCAAAATAAAAGG - Intronic
1098181067 12:67847676-67847698 ACATATAGGCTCAAAATAAAAGG - Intergenic
1098294826 12:68993297-68993319 ACATATAGGCTCAAAATAAAAGG + Intergenic
1098583664 12:72131574-72131596 ATATATTTGCATGAAATGATTGG + Intronic
1098667769 12:73185522-73185544 ACATATAGGCTCAAAATGAAGGG - Intergenic
1098668676 12:73197505-73197527 ACACATAGGCTTAAAATAAAAGG - Intergenic
1099489859 12:83275133-83275155 ACACATAGGCTCAAAATGAAGGG - Intergenic
1099697252 12:86038604-86038626 ACATATAAGCTCAAAATAAAGGG - Intronic
1099767625 12:87008670-87008692 ACTTGTATGAAAAAAATGAACGG + Intergenic
1099901103 12:88712723-88712745 ACATATAGGCTCAAAATAAAAGG - Intergenic
1100051678 12:90456855-90456877 ACACATATGCACACAATGGATGG - Intergenic
1100231576 12:92613805-92613827 AAATGTATACATAAAATAAAAGG - Intergenic
1100653169 12:96612662-96612684 ACACATAGGCTCAAAATGAAGGG + Intronic
1100681487 12:96928023-96928045 ACATGTAGGCATAAAATAAATGG + Intronic
1101175037 12:102141354-102141376 ACATATAGGCTCAAAATAAAGGG - Intronic
1101636729 12:106549775-106549797 ACACATAGGCATAAAATAAAGGG - Intronic
1101649475 12:106661843-106661865 ACCTAAATGCATATTATGAATGG - Intronic
1102397222 12:112597090-112597112 ATATATCTGCATAAAATCATAGG + Intronic
1102632958 12:114298301-114298323 ATATTTATGCATAAAATTATTGG + Intergenic
1103071671 12:117949120-117949142 ACATATATAAATAAAAGTAATGG + Intronic
1103375676 12:120453939-120453961 ACATACATACATAAATAGAAAGG + Intronic
1104199299 12:126572548-126572570 ACATAAAAGTATAAAATGATAGG - Intergenic
1104298204 12:127538330-127538352 ACATATAGGCCTAAAATGAAGGG - Intergenic
1105232088 13:18505733-18505755 ACACATATGCTCAAAATAAAAGG + Intergenic
1105508494 13:21031918-21031940 AAATATATTCAGACAATGAAAGG - Intronic
1106214367 13:27681631-27681653 GAATATATACATATAATGAATGG + Intergenic
1106336323 13:28786749-28786771 ACATATAGGCTCAAAATAAAGGG - Intergenic
1106374217 13:29168871-29168893 ACACAGATTCATAAAGTGAAAGG - Intronic
1106689437 13:32097972-32097994 ACATATACACAGAAAATAAAGGG + Intronic
1106874076 13:34053427-34053449 ACATATAGGCTCAAAATAAAGGG - Intergenic
1106967078 13:35083849-35083871 ACACATAGGCTTAAAATAAAGGG + Intronic
1107240945 13:38233065-38233087 ACATATAGGCTCAAAATTAAAGG + Intergenic
1107244138 13:38272178-38272200 ACATATAGGCTCAAAATAAAGGG + Intergenic
1107487016 13:40837995-40838017 ACATATAGGCTCAAAATAAAGGG + Intergenic
1108110473 13:47066047-47066069 ACAGATATGCACAAAATCATGGG - Intergenic
1108425756 13:50298222-50298244 ACATATAGGCTCAAAATAAAGGG - Intronic
1108446780 13:50517446-50517468 ACATAGATGGAGAAAATTAAGGG - Intronic
1108479921 13:50858186-50858208 ACATATAGGCTCAAAATAAAGGG + Intergenic
1108657528 13:52549880-52549902 ACATATAGGCTCAAAATAAAAGG - Intergenic
1108787906 13:53928322-53928344 AGAGAAATGCATGAAATGAAAGG - Intergenic
1108920207 13:55663947-55663969 CCATATATGCTTAAGATCAAAGG - Intergenic
1108996663 13:56742941-56742963 ATATATATGTATAAATTAAATGG + Intergenic
1109084180 13:57949579-57949601 ATATATATGAATAAGATAAAGGG - Intergenic
1109185844 13:59266865-59266887 ACAAATATTTAAAAAATGAACGG + Intergenic
1109517834 13:63467303-63467325 ACATATAGGATGAAAATGAAGGG + Intergenic
1109615651 13:64830296-64830318 ACACATAGGCTCAAAATGAAGGG + Intergenic
1109646872 13:65270451-65270473 AAATATGTGCATACAATAAAAGG + Intergenic
1109686348 13:65824952-65824974 ACAAATATATATAAAAGGAAAGG + Intergenic
1109725608 13:66337256-66337278 AAATATATATATAAATTGAATGG - Intronic
1109976389 13:69839309-69839331 ATAAAAATGTATAAAATGAATGG + Intronic
1110020191 13:70459673-70459695 ACATATAGGCTCAAAATAAAAGG + Intergenic
1110152219 13:72269354-72269376 ACATATAGGCTCAAAATAAAGGG - Intergenic
1110178952 13:72592292-72592314 ACATTTTTACCTAAAATGAAAGG - Intergenic
1110199489 13:72832135-72832157 ACATATAGGCTCAAAATAAAGGG - Intronic
1110302026 13:73939873-73939895 TCATAAATGCATAAACAGAAAGG + Intronic
1110485366 13:76034922-76034944 ACATACATGCATACAATGGAAGG + Intergenic
1110631236 13:77710351-77710373 ACATATAGGCTCAAAATAAAGGG + Intronic
1110942249 13:81364800-81364822 ACACATAAGCTCAAAATGAATGG + Intergenic
1110949199 13:81463446-81463468 ACATATAGGCTCAAAATAAAGGG - Intergenic
1110996059 13:82111346-82111368 ACATATAGGCTCAAAATAAAGGG + Intergenic
1111059820 13:83001593-83001615 ATACATATGCATATAAAGAAGGG - Intergenic
1111248312 13:85570902-85570924 ACATATAGGCTCAAAATAAAAGG - Intergenic
1111506694 13:89199054-89199076 AAATATATGCATAAACTCATAGG - Intergenic
1111723119 13:91972335-91972357 ACACATAGGCTTAAAATAAAGGG - Intronic
1112028192 13:95431910-95431932 AGATATATTTATAAAATTAAAGG + Intergenic
1112040654 13:95544367-95544389 ACATATATGGATGAATTGTACGG + Intronic
1112166083 13:96921005-96921027 ACATATAGGCTCAAAATAAAGGG + Intergenic
1112233234 13:97609904-97609926 ACATATAGGCTCAAAATAAAAGG + Intergenic
1112899760 13:104344220-104344242 ACATATAGGCTCAAAATAAAAGG - Intergenic
1113342966 13:109445331-109445353 ACATATAGGCTCAAAATAAAGGG - Intergenic
1114009307 14:18349849-18349871 ACATATAGGCTCAAAATAAAAGG + Intergenic
1114061190 14:19016961-19016983 ACACATAGGCTTAAAATAAAGGG - Intergenic
1114101063 14:19383025-19383047 ACACATAGGCTTAAAATAAAGGG + Intergenic
1114133304 14:19818551-19818573 ACACATAGGCTCAAAATGAAGGG - Intronic
1114599843 14:23945733-23945755 ACACATAGGCTCAAAATGAAGGG + Intergenic
1114869876 14:26643679-26643701 ACATAGAGGCACAAAATAAAGGG - Intergenic
1114892935 14:26948377-26948399 ACTAGTATGTATAAAATGAAAGG + Intergenic
1115278768 14:31637957-31637979 ACATATAGGCTCAAAATAAAAGG - Intronic
1115524783 14:34268878-34268900 ACATATATTCAGAAATAGAAAGG + Intronic
1115792534 14:36896409-36896431 ACATATAAGCTCAAAATAAAGGG - Intronic
1115818661 14:37190060-37190082 ACATATAGGCTCAAAATAAAGGG + Intergenic
1115856031 14:37630979-37631001 ACATATAGGCTCAAAATAAAGGG - Intronic
1115927438 14:38450974-38450996 ACACATAGGCTTAAAATAAAGGG + Intergenic
1116026832 14:39525427-39525449 ACATATAGGCTCAAAATAAAAGG - Intergenic
1116052646 14:39823896-39823918 ACATATAGGCTCAAAATAAAGGG - Intergenic
1116212525 14:41966684-41966706 ACACATAGGCTTAAAATAAAGGG - Intergenic
1116231116 14:42218016-42218038 GCAAATATGTACAAAATGAAGGG - Intergenic
1116331284 14:43600024-43600046 ACATATAGGCTCAAAATAAAAGG + Intergenic
1116771226 14:49129640-49129662 ACACATAGGCTTAAAATAAAGGG - Intergenic
1117005455 14:51417023-51417045 ACATATAGGCTCAAAATAAAGGG - Intergenic
1117121315 14:52570619-52570641 ACATATAGGCTAAAAATAAAGGG + Intronic
1117265074 14:54078193-54078215 ATATATATGCATAGAAAGACTGG + Intergenic
1117629703 14:57677711-57677733 ACATATATGCATAAAATGAAAGG + Intronic
1117712691 14:58548778-58548800 ACATAAATACATAAAATTAAAGG + Intronic
1117808104 14:59515439-59515461 ACATATAGGCTCAAAATAAAGGG + Intronic
1117822087 14:59660013-59660035 ACACATAAGCTTAAAATAAAGGG + Intronic
1117822565 14:59665714-59665736 ACACATAAGCTTAAAATAAAGGG + Intronic
1118052956 14:62049345-62049367 ACATATATGCTCAAAATAAAGGG - Intronic
1118104168 14:62638815-62638837 ACATATAGGCTCAAAATAAAAGG + Intergenic
1118138897 14:63057874-63057896 TCATAAATGCATAAAATATATGG + Intronic
1118556980 14:67034566-67034588 ACATATAGGCTGAAAATGAAAGG + Intronic
1118575478 14:67238153-67238175 GTATATATGCAAAAACTGAAGGG - Intergenic
1119211008 14:72831783-72831805 ACACATGTGCATAAAAGGTAGGG + Intronic
1120467673 14:84881294-84881316 AAATAAAAGAATAAAATGAAAGG + Intergenic
1121180076 14:91922344-91922366 AAATAAATAAATAAAATGAAGGG + Intronic
1121603550 14:95224258-95224280 AAATAAATAAATAAAATGAAGGG - Intronic
1122443135 14:101748070-101748092 ACACATAGGCTTAAAATAAAGGG - Intergenic
1122494705 14:102144561-102144583 ACAGATGTCCATAAAATGAGAGG - Intronic
1202928205 14_KI270725v1_random:12663-12685 ACACATAGGCTCAAAATGAAAGG + Intergenic
1202935033 14_KI270725v1_random:79990-80012 AAATGTTTGCAGAAAATGAATGG + Intergenic
1123392496 15:19890448-19890470 ACATATAGGCTCAAAATAAAAGG + Intergenic
1123576390 15:21674360-21674382 ACACATAGGCTCAAAATGAAGGG - Intergenic
1123613014 15:22116828-22116850 ACACATAGGCTCAAAATGAAGGG - Intergenic
1124226819 15:27902023-27902045 AAATGTATTCATAAAATGAAAGG + Intronic
1124235188 15:27983927-27983949 ACATAGATGAATAAAACAAAGGG - Intronic
1124724454 15:32143787-32143809 ACACATAGGCTCAAAATGAAGGG - Intronic
1125227401 15:37410396-37410418 ACATATAAGCTCAAAATAAAGGG + Intergenic
1125498713 15:40223079-40223101 ACAAATAAGCATAAAATATAAGG - Intergenic
1126057129 15:44740588-44740610 ACACATAGGCTCAAAATGAAAGG + Intronic
1126234718 15:46370215-46370237 ACATAGAGGCATAAAATACATGG - Intergenic
1126620247 15:50631362-50631384 ATATACATACATAAAATAAAAGG + Intronic
1127021306 15:54751518-54751540 ACATATAGGCTCAAAATAAAGGG + Intergenic
1127858154 15:62969498-62969520 ACACACATGCATAACATAAAAGG + Intergenic
1127934214 15:63620862-63620884 ACATATAGGCTCAAAATAAAGGG - Intronic
1128681499 15:69655679-69655701 ACATACATACATAAAAGGAAGGG - Intergenic
1129495343 15:75975219-75975241 ACATATAGGCTCAAAATAAAGGG - Intronic
1129837690 15:78721965-78721987 ACATATAGGCTCAAAATAAAAGG + Intronic
1130185726 15:81679495-81679517 ACATATAGGCTCAAAATAAAAGG + Intergenic
1130452831 15:84074343-84074365 ACACATAGGCTTAAAATAAAGGG + Intergenic
1131533028 15:93210788-93210810 ATATATATACATAAACTGAGAGG + Intergenic
1131812392 15:96185916-96185938 GCATAAATGAATGAAATGAATGG + Intergenic
1131902954 15:97108673-97108695 ACACATAGGCTTAAAATAAAGGG + Intergenic
1131942530 15:97583316-97583338 ACATATAGGCTCAAAATAAAAGG - Intergenic
1132126265 15:99227911-99227933 ACATAGATGCAAAACACGAAGGG - Intronic
1202985258 15_KI270727v1_random:408605-408627 ACACATAGGCTCAAAATGAAGGG - Intergenic
1132477867 16:150967-150989 ACTTATTTGTAAAAAATGAATGG - Intergenic
1133660580 16:7912957-7912979 ACATATATTCTTATAAAGAAAGG + Intergenic
1133993029 16:10725492-10725514 ATATATATGTATAAAATAAATGG + Intergenic
1135080766 16:19432958-19432980 AAATATATACATAAATTGTATGG + Intronic
1135267267 16:21038175-21038197 ACATATATGTATAACATGTATGG + Intronic
1135649257 16:24191361-24191383 ACACATATGCACAAAATCACTGG + Intronic
1136643289 16:31586913-31586935 ACATATAGGCTCAAAATAAAGGG - Intergenic
1136675759 16:31904654-31904676 ACATATAGGCTCAAAATAAAGGG - Intronic
1136983229 16:35077046-35077068 ACATATAGGCTCAAAATAAAGGG + Intergenic
1136987553 16:35124660-35124682 ACATGTATGTAGAAAAAGAAAGG + Intergenic
1137051707 16:35719676-35719698 ACATATAGGCTCAAAATAAAGGG - Intergenic
1137471286 16:48760982-48761004 ACATATAGGCTCAAAATAAAGGG + Intergenic
1137851851 16:51753880-51753902 ACATACATGCATATAAATAAAGG + Intergenic
1138019169 16:53461499-53461521 ATATATATATATAAAATAAAAGG + Intronic
1138102439 16:54264416-54264438 ACATATAGGCTCAAAATAAAAGG - Intronic
1138814207 16:60185675-60185697 AAATAAATGAATAAAATGGAGGG + Intergenic
1138945744 16:61847529-61847551 ATATATATATATAAAATGATTGG - Intronic
1138960179 16:62019789-62019811 ATATATATGCATATACTGAAGGG + Intronic
1138978854 16:62242065-62242087 CCATATATGTATAAAAAGATGGG + Intergenic
1139059685 16:63233906-63233928 AAATATACACATAAAATTAATGG - Intergenic
1139146979 16:64337238-64337260 ACATATATAAATAAAATGGCAGG - Intergenic
1140772304 16:78216187-78216209 AAATATATACATAAAAACAATGG + Intronic
1140991387 16:80215665-80215687 AGGTATATGCATAAAAACAAAGG - Intergenic
1141051903 16:80774101-80774123 AAATAAATGCATAAAAGTAAAGG + Intronic
1141052356 16:80781758-80781780 ACAAATATGTAGAAAATAAATGG + Intronic
1141256903 16:82411046-82411068 ACATATTTTTAAAAAATGAATGG + Intergenic
1203012631 16_KI270728v1_random:312678-312700 ACAAATATGCATACACAGAATGG - Intergenic
1203030966 16_KI270728v1_random:585837-585859 ACAAATATGCATACACAGAATGG - Intergenic
1203040755 16_KI270728v1_random:748594-748616 ACAAATATGCATACACAGAATGG + Intergenic
1142778341 17:2160153-2160175 ATATATTTACATACAATGAAAGG - Intronic
1142920283 17:3178662-3178684 ACATATAGGCTCAAAATAAAAGG + Intergenic
1143244489 17:5471613-5471635 ACAAGTATGCATATAATGTAGGG + Exonic
1144293318 17:13847914-13847936 ACATATATATATAAAACAAAGGG + Intergenic
1144314294 17:14045344-14045366 ACATTTATACATAAATTAAATGG + Intergenic
1144315305 17:14055125-14055147 AAATATTTGAATAAAATGAAAGG - Intergenic
1146614607 17:34345100-34345122 TCCTATATGCATAAAAAGATTGG + Intergenic
1146898520 17:36564291-36564313 ACACAGATGCATAAAATGCTGGG - Intronic
1147033866 17:37664886-37664908 ACATATCTGCAAAAACTAAAAGG - Intergenic
1147527733 17:41242157-41242179 ACACATATGCTCAAAATAAAGGG + Intronic
1148316875 17:46708795-46708817 ATATATATATATAAAATAAATGG - Intronic
1148950535 17:51307221-51307243 ACATATAGGCTCAAAATAAAGGG + Intergenic
1149036975 17:52145967-52145989 ACATATATGCTTAAAAACAAGGG + Intronic
1149141856 17:53440818-53440840 GTATATATATATAAAATGAAGGG + Intergenic
1149191719 17:54071279-54071301 ACATATAGGCTCAAAATAAAGGG - Intergenic
1149240355 17:54641469-54641491 ACACATAGGCACAAAATAAAGGG + Intergenic
1149246049 17:54709264-54709286 ATATATATATATAAAATAAAAGG - Intergenic
1149619899 17:58036271-58036293 ATATATATATATAAAATAAAAGG + Intergenic
1150094330 17:62359222-62359244 ACATATAGGCTCAAAATAAAGGG + Intergenic
1150717266 17:67582724-67582746 AAGTATGTGCATAAAATAAATGG - Intronic
1151079673 17:71314700-71314722 ACATACATGCATAAAAAGATAGG + Intergenic
1151297179 17:73193899-73193921 ACATACATACATAAAGTTAAGGG - Intronic
1153129955 18:1844263-1844285 ATATATATAAATACAATGAAAGG - Intergenic
1153398957 18:4661109-4661131 ACATATATGCACCAAACGACAGG + Intergenic
1153414752 18:4834630-4834652 AAATAAATAAATAAAATGAAAGG - Intergenic
1153965467 18:10177439-10177461 ACATATAGGCTCAAAATAAAGGG - Intergenic
1154073967 18:11180809-11180831 ATATATCTTCGTAAAATGAATGG - Intergenic
1154466482 18:14647439-14647461 ACATATAGACTGAAAATGAAGGG - Intergenic
1154517389 18:15187694-15187716 ACATATAGGCTCAAAATAAAAGG - Intergenic
1154521235 18:15232973-15232995 ACACATATGCTCAAAATAAAAGG - Intergenic
1155595173 18:27477566-27477588 TTATATATGCATACAATTAATGG + Intergenic
1155622189 18:27792570-27792592 TCATACAGACATAAAATGAACGG + Intergenic
1155684495 18:28532068-28532090 ATATATATATATATAATGAAAGG + Intergenic
1155718139 18:28972151-28972173 ACAAATACAAATAAAATGAAAGG + Intergenic
1156094546 18:33513258-33513280 ACATATATACTGAAAATAAAAGG + Intergenic
1156096063 18:33533539-33533561 ACATACATACATACAAAGAAGGG + Intergenic
1156158677 18:34333240-34333262 ACATATAGGCTCAAAATAAAAGG + Intergenic
1156170578 18:34479862-34479884 ATAGATATGCATGGAATGAAAGG - Intergenic
1156630238 18:38958948-38958970 TTATAGATACATAAAATGAATGG - Intergenic
1156653998 18:39261758-39261780 ACACATAGGCACAAAATAAAGGG + Intergenic
1157071980 18:44418491-44418513 ACACATATGCTCAAAATAAAGGG + Intergenic
1157123210 18:44931808-44931830 ACATATAGGCTCAAAATGAAGGG - Intronic
1157561675 18:48651267-48651289 ACACATATGCTCAAAATAAAGGG + Intronic
1157651053 18:49331660-49331682 AAATGTATGCAAATAATGAATGG - Intronic
1157807129 18:50666455-50666477 GCAAATATCCATTAAATGAATGG - Intronic
1157978031 18:52348688-52348710 ACATCTATGCCTAAAAGCAAAGG - Intronic
1158072889 18:53494681-53494703 ACACATAGGCTCAAAATGAAGGG - Intronic
1158243474 18:55404253-55404275 ACATCTAAGAATAAAATCAAGGG + Intronic
1158423550 18:57318316-57318338 ACACATAGGGAGAAAATGAAGGG - Intergenic
1158580572 18:58678477-58678499 ACATATATGTTTAATATGATGGG + Intronic
1158914966 18:62115415-62115437 ACCTACATGTCTAAAATGAATGG + Intronic
1158980407 18:62755192-62755214 ACGTATCTGCACAGAATGAAAGG - Intronic
1158993097 18:62890185-62890207 TCGTATATACATAAAATGAATGG + Intronic
1159807112 18:72970399-72970421 ACATATAGGCTCAAAATAAAAGG - Intergenic
1160080346 18:75720898-75720920 ACATAAATGGGTAAAATGGAAGG - Intergenic
1160127200 18:76186488-76186510 ACACATATGCAGACTATGAAAGG + Intergenic
1162148661 19:8629630-8629652 ATAAAAATACATAAAATGAAAGG + Intergenic
1162840247 19:13351030-13351052 CTATATAGGCATAAAATCAAGGG + Intronic
1164081078 19:21861916-21861938 AAATATATGCATCAAGTGCAAGG - Intergenic
1164367396 19:27600833-27600855 ACACATATGCTCAAAATAAAGGG - Intergenic
1164377268 19:27699306-27699328 ACACATAGGCTTAAAATAAAGGG - Intergenic
1164496758 19:28772441-28772463 ACATATAGGCTCAAAATAAAAGG - Intergenic
1164721074 19:30431978-30432000 ATATATATGCTTTTAATGAATGG - Intronic
1165254360 19:34566081-34566103 ACATATAGGCTCAAAATAAAGGG - Intergenic
1166086746 19:40481069-40481091 AAATAAATACATAAAATAAATGG + Intronic
1166578164 19:43865152-43865174 ACATATAGGCTCAAAATAAAAGG - Intergenic
1167859490 19:52271234-52271256 TCAGATATGGATAAAATTAACGG - Intronic
1168558029 19:57360140-57360162 ATATATATAAATAAAATAAATGG - Intergenic
925619440 2:5776877-5776899 ACATAAAGGGATAAAATAAAGGG + Intergenic
926496135 2:13591146-13591168 ACATATGAGCATACAATTAATGG + Intergenic
926533762 2:14084349-14084371 ACATATAGGCTTAAAATAAAGGG + Intergenic
926604256 2:14881312-14881334 ACACATAGACATAAAATCAATGG + Intergenic
926970406 2:18462082-18462104 ACATATAGGCTCAAAATAAAGGG - Intergenic
927004190 2:18830745-18830767 AAATATTTGAAAAAAATGAAAGG - Intergenic
927098746 2:19770337-19770359 ATATATATGTATAAAATAATTGG - Intergenic
927705577 2:25294511-25294533 AGTTATATGCATAAAAGGTAGGG + Intronic
927993396 2:27464517-27464539 ACACATATGCATAGATTGAAGGG + Intronic
928389926 2:30901525-30901547 ATATATATGTATTAAAGGAAAGG - Intergenic
928484901 2:31719974-31719996 ACATATAGGCTCAAAATAAAGGG + Intergenic
928557169 2:32439105-32439127 ACATGTATGCATAAGAAGACTGG + Intronic
928587085 2:32770907-32770929 ACATATGTGAATAATATGTACGG + Intronic
928732250 2:34245112-34245134 ACATCTATGAACAAAATGACAGG - Intergenic
928830779 2:35479880-35479902 ACACATAGGCACAAAATAAAGGG + Intergenic
928877912 2:36062789-36062811 ACATATAGGCTCAAAATAAAGGG + Intergenic
928880399 2:36090661-36090683 ACACATAGGCACAAAATAAAGGG + Intergenic
928976001 2:37087127-37087149 CCATATATTCATATAATGTAAGG + Intronic
929062672 2:37939757-37939779 ACCCATATGCACAAAATAAAGGG - Intronic
929257508 2:39828846-39828868 ACATATAGGCTCAAAATAAAGGG - Intergenic
929798389 2:45077884-45077906 ACACATAGGCTCAAAATGAAAGG + Intergenic
930447418 2:51491461-51491483 ATACATTTCCATAAAATGAATGG - Intergenic
930522941 2:52490972-52490994 ACATATAGGCTCAAAATAAAGGG - Intergenic
930576982 2:53162994-53163016 ACACATATGCTCAAAATAAAGGG + Intergenic
930962113 2:57274721-57274743 ACACATATGCTCAAAATAAAGGG - Intergenic
931071767 2:58659516-58659538 ACAAAAATGCAGAAAAAGAAAGG - Intergenic
931140885 2:59456381-59456403 ACACATATATATAAAATGATGGG + Intergenic
931182722 2:59919052-59919074 ACATGTGTGCGTAAAATGAATGG + Intergenic
931533285 2:63242035-63242057 AAATATATGCATAGAAAAAAGGG + Intronic
932990411 2:76779630-76779652 ACATATAGGCTCAAAATAAAAGG - Intronic
933039868 2:77450820-77450842 ACATATATATATAAAATAGATGG - Intronic
933136963 2:78749775-78749797 ACAGATAATCATAAAATGGAAGG + Intergenic
933355862 2:81208259-81208281 ACACATATGCTCAAAATAAAGGG + Intergenic
933365468 2:81347914-81347936 ACATATAAGCTCAAAATAAAGGG + Intergenic
933435236 2:82241232-82241254 ACACATAGGCACAAAATAAAGGG - Intergenic
933550585 2:83770439-83770461 ACACATATGCTCAAAATAAAAGG + Intergenic
933603414 2:84356201-84356223 ACATATAGGCTCAAAATAAAGGG + Intergenic
933638529 2:84733804-84733826 AAATATATACATAAAATATATGG - Intronic
933859575 2:86451882-86451904 ACATATATGTATATAAACAACGG - Intronic
933940500 2:87240937-87240959 ACATATTTCCATAAAAGCAAGGG - Intergenic
934100112 2:88644380-88644402 ACACATAGGCTTAAAATAAAGGG + Intergenic
934140459 2:89041964-89041986 AAATATTTGCTGAAAATGAATGG + Intergenic
934228779 2:90158572-90158594 AAATATTTGCTGAAAATGAATGG - Intergenic
934318729 2:91951347-91951369 ACACATAGGCTCAAAATGAAGGG + Intergenic
934531817 2:95095000-95095022 ACATATAGGCTCAAAATAAATGG + Intronic
934702960 2:96456979-96457001 ACATATAGGCTCAAAATAAAGGG + Intergenic
935181783 2:100697349-100697371 AAATATATTCAAAAAATTAATGG + Intergenic
935383507 2:102477897-102477919 ACATGTAAGTATATAATGAAGGG - Intronic
935524785 2:104152546-104152568 ATATATATATATATAATGAATGG + Intergenic
935616175 2:105084260-105084282 ATATATATATGTAAAATGAAGGG + Intronic
936352636 2:111724839-111724861 ACATATTTCCATAAAAGCAAGGG + Intergenic
936621227 2:114100167-114100189 ACATATAGGCTCAAAATAAAAGG - Intergenic
936707616 2:115093703-115093725 GCATATATGTATATAATTAATGG - Intronic
936727162 2:115333292-115333314 ACACATAGGCTCAAAATGAAGGG - Intronic
936768460 2:115882855-115882877 ACATAGAAGAATAAAATGAATGG - Intergenic
936783002 2:116056158-116056180 ACATATATGTAAAAAATATATGG - Intergenic
936877314 2:117206434-117206456 AAATATAGGCAGAAATTGAATGG + Intergenic
936940058 2:117875198-117875220 ACATATAGGCTCAAAATAAAAGG - Intergenic
937569360 2:123336612-123336634 ACACATAGGCTTAAAATAAAGGG + Intergenic
938278370 2:130048109-130048131 AAATATAGGCAGAAAATCAAGGG + Intergenic
938329343 2:130438968-130438990 AAATATAGGCAGAAAATCAAGGG + Intergenic
938360604 2:130682535-130682557 AAATATAGGCAGAAAATCAAGGG - Intergenic
938437006 2:131289243-131289265 AAATATAGGCAGAAAATCAAGGG - Intronic
938520589 2:132066739-132066761 ACACATATGCTCAAAATAAAAGG - Intergenic
938567380 2:132531126-132531148 ACATATAGGCTCAAAATAAAGGG + Intronic
938997368 2:136694569-136694591 ATATATATGCAAAAAATAAATGG + Intergenic
939097769 2:137854315-137854337 ACATACATGCATAAAGTATATGG - Intergenic
939097945 2:137857343-137857365 ACATATATGCATAAAGTATATGG + Intergenic
939200607 2:139030165-139030187 ACATATAGACTTAAAGTGAAGGG - Intergenic
939242274 2:139576259-139576281 ATCTAAATGAATAAAATGAATGG - Intergenic
939298555 2:140303103-140303125 ATATATATGCATAAAATAAATGG + Intronic
939542945 2:143515766-143515788 ACTTATATGTAGAAAATCAATGG + Intronic
939544872 2:143540249-143540271 ACATATAGGCTCAAAATAAAGGG - Intronic
939555088 2:143663688-143663710 ACATATAGGCTCAAAATAAAAGG + Intronic
939579324 2:143929803-143929825 TCATATATGCATAAACTGCAGGG - Intergenic
939630987 2:144525618-144525640 ACAAATATGCCCAAAGTGAAGGG - Intergenic
939731039 2:145784640-145784662 ACACATATGCTCAAAATAAAGGG + Intergenic
939924143 2:148152808-148152830 ACACATATGCTCAAAATAAAAGG - Intronic
940537046 2:154958512-154958534 ACATATAGGCTCAAAATAAAAGG - Intergenic
940702998 2:157069877-157069899 ACATATAGGCTCAAAATAAAGGG + Intergenic
940935094 2:159483925-159483947 AAATATGTGCAAAAGATGAAGGG + Intronic
941033767 2:160543162-160543184 ACAAAAATGGATAAAATGACAGG - Intergenic
941088938 2:161151446-161151468 ACATATATCCATCAAATAACAGG - Intronic
941239162 2:163015483-163015505 ACACATAGGCTTAAAATAAAGGG - Intergenic
941295545 2:163735071-163735093 ACCTACATGCATATAATTAAGGG + Exonic
941302796 2:163825205-163825227 ACATATAGGCTGAAAATAAAGGG - Intergenic
941429502 2:165396065-165396087 AAATATATTCATAAAATTGAAGG - Intergenic
941593733 2:167451084-167451106 ACATATATACAAGAAATGAGGGG - Intergenic
942056725 2:172191137-172191159 ACATATAGGCTCAAAATAAAGGG - Intergenic
942400030 2:175592422-175592444 ACACATATGCTCAAAATAAAAGG - Intergenic
942434847 2:175959832-175959854 ACATATAGGCTCAAAATAAAGGG + Intronic
942534951 2:176953231-176953253 ACCTATATGCAAAAAAGAAAGGG + Intergenic
942569614 2:177300675-177300697 ACACATAGGCCTAAAATAAAGGG - Intronic
942637437 2:178022967-178022989 ACAGATCTGCATAAAAGGCATGG - Intronic
942734136 2:179091272-179091294 ACACATAAGCTCAAAATGAAGGG - Intergenic
942856738 2:180557621-180557643 ACACATAGGCTCAAAATGAAGGG + Intergenic
942953454 2:181748413-181748435 ACATATAGGCTCAAAATAAAGGG - Intergenic
943130196 2:183844150-183844172 ACACATAGGCTCAAAATGAAGGG + Intergenic
943168030 2:184357361-184357383 ACATTTAAGTATAAAATAAATGG + Intergenic
943282383 2:185952503-185952525 ATATATATATATAAAATGATAGG + Intergenic
943497200 2:188635705-188635727 ACATGTATTCAGAAAATAAATGG + Intergenic
943598871 2:189890787-189890809 ACATATAGGCTCAAAATAAAGGG - Intronic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
944094562 2:195951799-195951821 ACACATAGGCTCAAAATGAAGGG - Intronic
944566705 2:200998932-200998954 AGATATATGGAGAAAGTGAAGGG - Intronic
944597439 2:201274055-201274077 AAAAATATTCATAATATGAATGG - Intronic
944879537 2:203998083-203998105 ACATGTATACATAGAATGACCGG + Intergenic
944964074 2:204909376-204909398 ATTTATATGCATGATATGAATGG - Intronic
945429661 2:209750050-209750072 ACACATATGCTCAAAATAAAAGG - Intergenic
945533279 2:210982662-210982684 ACATATAGGCTCAAAATAAAGGG - Intergenic
945547234 2:211170303-211170325 AAATAAATAAATAAAATGAAGGG + Intergenic
945610772 2:211999570-211999592 ACATAAAAGAATCAAATGAATGG + Intronic
945820618 2:214660514-214660536 ACACATAGGCTCAAAATGAAGGG - Intergenic
945936416 2:215907056-215907078 ACATCTCTGCATTAAAGGAATGG - Intergenic
946065082 2:216980580-216980602 ACACATATGCTCAAAATAAAGGG - Intergenic
946127858 2:217580155-217580177 TAAGAAATGCATAAAATGAAAGG + Intronic
946454891 2:219817375-219817397 ACATATAGGCTCAAAATAAAGGG - Intergenic
946616001 2:221510949-221510971 TCATATATGTATAAAGGGAATGG + Intronic
947287988 2:228539487-228539509 AAATTTATGCATAAAATGCTTGG - Intergenic
947892233 2:233634672-233634694 ACATATAGGCTCAAAATAAAGGG - Intronic
948026077 2:234777737-234777759 ACATATAGGCTCAAAATAAAGGG + Intergenic
1168987278 20:2060603-2060625 ATCTATATGGAAAAAATGAATGG + Intergenic
1169362714 20:4964655-4964677 GCACACATGCAGAAAATGAAGGG + Intronic
1169396825 20:5239608-5239630 ACACATAGGCTCAAAATGAAGGG - Intergenic
1169518119 20:6340054-6340076 ATATACATGCAGAAAATGAGGGG - Intergenic
1169685072 20:8262028-8262050 ACATAAAAACAAAAAATGAAGGG - Intronic
1169739336 20:8873312-8873334 TCATACATTCATAGAATGAATGG - Intronic
1170532102 20:17303903-17303925 ACATATAGTCATAAATTGAGAGG - Intronic
1170543602 20:17413304-17413326 ACATATAGGCTCAAAATTAAGGG + Intronic
1170707573 20:18759105-18759127 ACACATATGCTCAAAATAAAAGG - Intronic
1171491606 20:25523203-25523225 ATATATATTCAGAAAAAGAAAGG - Intronic
1171880238 20:30613278-30613300 AAATATAGGCAGAAAATCAAGGG + Intergenic
1171912262 20:30974320-30974342 ACACATAGGCTCAAAATGAAAGG - Intergenic
1171961720 20:31499440-31499462 ATAAATATTCATCAAATGAATGG - Intergenic
1171995697 20:31729348-31729370 ACATATATGCAATGTATGAAAGG - Intergenic
1172825785 20:37784214-37784236 ACATATAGGCTGAAAATAAAAGG - Intronic
1172996489 20:39073882-39073904 ACATATATGCATACAAATATAGG + Intergenic
1173788818 20:45814288-45814310 ATATATATATATAAAATTAAGGG + Intronic
1174057942 20:47811454-47811476 ACATTTAGGCAGAAAATGAAGGG - Intergenic
1176344222 21:5726927-5726949 ACACATAGGCTTAAAATAAAGGG - Intergenic
1176351036 21:5847511-5847533 ACACATAGGCTTAAAATAAAGGG - Intergenic
1176500605 21:7597529-7597551 ACACATAGGCTTAAAATAAAGGG + Intergenic
1176538543 21:8124996-8125018 ACACATAGGCTTAAAATAAAGGG - Intergenic
1176776061 21:13134031-13134053 ACACATATGCTCAAAATAAAAGG + Intergenic
1177455699 21:21334651-21334673 AAAAAGATGAATAAAATGAAAGG + Intronic
1177541221 21:22495754-22495776 ACATATAGGCTCAAAATAAAGGG + Intergenic
1177642617 21:23863195-23863217 ACACATTTGCATAAACTGACAGG + Intergenic
1177675933 21:24298624-24298646 GCATTTATGAATAAAATGTAAGG + Intergenic
1177755839 21:25346736-25346758 ACATATAGGCTCAAAATAAAGGG - Intergenic
1177903476 21:26946559-26946581 ACAGAGATGTTTAAAATGAATGG + Intronic
1178160941 21:29913842-29913864 ACACATATACATAAAATTTATGG + Intronic
1178171513 21:30045958-30045980 AGATAAAGGCATAAAATGAAAGG - Intergenic
1178344972 21:31818096-31818118 ACACATAGGCTTAAAATAAAGGG - Intergenic
1178965345 21:37111325-37111347 ACATATAGGCTCAAAATAAAGGG + Intronic
1179301158 21:40111688-40111710 ACATATAGGCTCAAAATAAAGGG + Intronic
1179831182 21:43997558-43997580 ACATATAGGCTAAAAGTGAAGGG - Intergenic
1180322524 22:11336041-11336063 ACATATAGGCTCAAAATAAAAGG - Intergenic
1180399045 22:12391108-12391130 ACACATAGGCTCAAAATGAAAGG + Intergenic
1180419871 22:12803594-12803616 ACATATAGGCTCAAAATAAAAGG + Intergenic
1180433808 22:15280659-15280681 ACATATAGGCTCAAAATAAAAGG + Intergenic
1180479675 22:15739573-15739595 ACACATAGGCTTAAAATAAAGGG - Intergenic
1180502109 22:15939363-15939385 ACATATAGGCTCAAAATAAAAGG + Intergenic
1180507102 22:16023150-16023172 ACATATAGGCTCAAAATAAAAGG + Intergenic
1180589610 22:16925819-16925841 ACACATATGCTCAAAATAAAGGG + Intergenic
1181675857 22:24451246-24451268 ACTTATCTGCCTGAAATGAAGGG - Intergenic
1181800241 22:25342729-25342751 ACACATAGGCTTAAAATAAAGGG - Intergenic
1181997790 22:26896644-26896666 ACATATATGCATAAGCTAAATGG + Intergenic
1182699480 22:32223895-32223917 TCATACATGCATACAATAAAAGG + Intronic
1182807451 22:33086447-33086469 TCAAATATGAATAAATTGAAAGG - Intergenic
1182817029 22:33173611-33173633 ACATATAAGCTCAAAATAAAGGG + Intronic
1183846420 22:40545011-40545033 ATATATATACATAAAATCATTGG + Intronic
1185199984 22:49495499-49495521 AAAGATATGCTTAAAATGTAAGG + Intronic
1203243489 22_KI270733v1_random:41351-41373 ACACATAGGCTTAAAATAAAGGG - Intergenic
1203331261 22_KI270738v1_random:91275-91297 ACATATAGGCTCAAAATAAAAGG + Intergenic
949154484 3:811515-811537 ACATATAGGCTCAAAATAAAAGG + Intergenic
949168931 3:975328-975350 AAATAAATATATAAAATGAACGG + Intergenic
949209412 3:1479735-1479757 ACATATAGGCTCAAAATAAAGGG + Intergenic
949252123 3:1997683-1997705 ATATATATATATAAAATGATTGG - Intergenic
949424087 3:3897438-3897460 ACACATAGGCTCAAAATGAAAGG + Intronic
949580359 3:5382165-5382187 ACATATAGGCTCAAAATAAAGGG - Intergenic
949632343 3:5942418-5942440 ACATATAGGCTCAAAATAAAGGG - Intergenic
949712794 3:6891101-6891123 ACATATAGGCTCAAAATAAAAGG - Intronic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
950485450 3:13270917-13270939 ACAAATAGGCTGAAAATGAAAGG + Intergenic
950619466 3:14192646-14192668 ACACATAGGCACAAAATAAAGGG - Intronic
950862535 3:16162713-16162735 ACATATAGGCTCAAAATAAAGGG - Intergenic
950925143 3:16732919-16732941 ACAGATAGGCTCAAAATGAAGGG + Intergenic
950946403 3:16952673-16952695 AAGTATATGCATACAATAAAAGG + Intronic
951018024 3:17750858-17750880 ATATAGATACATAAATTGAATGG - Intronic
951187760 3:19734055-19734077 ACATCTAGCCCTAAAATGAAAGG - Intergenic
951228213 3:20145352-20145374 AAATAACTTCATAAAATGAATGG - Intronic
951247448 3:20357619-20357641 ACATATAGGCTCAAAATAAAAGG - Intergenic
951388333 3:22070281-22070303 AAATATATGCATATAATTATAGG - Intronic
951618808 3:24578668-24578690 ACAAATTTCCTTAAAATGAATGG - Intergenic
951707651 3:25559212-25559234 ACATATATTTCTTAAATGAATGG - Intronic
951964524 3:28368014-28368036 ACATATAGGCTCAAAATAAAGGG - Intronic
952501645 3:33968549-33968571 ACATATAGGCTCAAAATAAAGGG - Intergenic
952651208 3:35728909-35728931 AAAAATATGAATAAAATGACAGG - Intronic
953354196 3:42240757-42240779 ACACATAGGCTTAAAATAAAAGG + Intergenic
954167058 3:48768395-48768417 ACATAGATAGATAAAATAAAAGG + Intronic
954972955 3:54666693-54666715 AAATATATGTATAGAAAGAAAGG + Intronic
954978808 3:54724040-54724062 ACACATAGGCTGAAAATGAAGGG + Intronic
955036775 3:55275555-55275577 ACACATATGACTAAAATGAAAGG + Intergenic
955136740 3:56226571-56226593 ATATATATACATAAAAAGACAGG + Intronic
955163236 3:56485867-56485889 ACATATAGGCAATCAATGAAAGG + Intergenic
955211702 3:56947400-56947422 ACATATAGGCTCAAAATAAAGGG + Intronic
955642752 3:61103935-61103957 ACACATAGGCTTAAAATAAAGGG - Intronic
955854453 3:63257841-63257863 ACACATAGGCTTAAAATAAAGGG + Intronic
956373032 3:68585004-68585026 ACATATAGGCTCAAAATAAAGGG - Intergenic
956394675 3:68812447-68812469 ACATATAGGCTCAAAATAAAAGG + Intronic
957128514 3:76194306-76194328 ATATATATACATAAAAAGAGAGG - Intronic
957130407 3:76216432-76216454 ACATATAGGCTCAAAATAAAGGG + Intronic
957149788 3:76471355-76471377 ACATAGGCTCATAAAATGAAGGG - Intronic
957276455 3:78096640-78096662 ACATGTATGTATATAATAAAGGG + Intergenic
957488639 3:80895516-80895538 ACACATAGGCTCAAAATGAAAGG - Intergenic
957565624 3:81880384-81880406 ACATATAGGCTGAAAATAAAGGG + Intergenic
957594412 3:82243711-82243733 GCATATATAAATAAAATGATAGG - Intergenic
957629860 3:82705270-82705292 ACATATAGGCTCAAAATAAAGGG - Intergenic
957998292 3:87719140-87719162 ACAAATATTAATAAAATTAAGGG + Intergenic
958162437 3:89833971-89833993 ACATATAGGCTCAAAATAAAGGG + Intergenic
958163634 3:89850973-89850995 ATATATATATAGAAAATGAAAGG + Intergenic
958167980 3:89901659-89901681 ACACATAGGCTCAAAATGAAGGG + Intergenic
958200674 3:90310942-90310964 ACACATAGGCTTAAAATTAAAGG - Intergenic
958412479 3:93834516-93834538 AAATATAGGCTTAAAATAAAGGG + Intergenic
958503190 3:94940965-94940987 ATATATATACATAATATGCAGGG + Intergenic
958515963 3:95116496-95116518 AAATGTATTTATAAAATGAAAGG - Intergenic
958553755 3:95647319-95647341 ACATATAGGCTCAAAATAAAGGG + Intergenic
958563347 3:95776899-95776921 ACATATAGGCTCAAAATAAAGGG + Intergenic
958624308 3:96605208-96605230 ACATATAGGCTCAAAATAAAGGG - Intergenic
958817419 3:98930957-98930979 ACACATATGCTCAAAATAAAGGG + Intergenic
958989016 3:100820007-100820029 ACCTATATGCAGAAAATGCAAGG + Intronic
959013883 3:101110595-101110617 ACATATAGGCTCAAAATAAAGGG + Intergenic
959166258 3:102782383-102782405 ACCTATATGTATAAACTAAAGGG + Intergenic
959478513 3:106841800-106841822 CCAAATATTCTTAAAATGAAAGG - Intergenic
959479642 3:106855466-106855488 ACACATAAGCTCAAAATGAAGGG + Intergenic
959504912 3:107146354-107146376 ACATATAGGCTCAAAATAAAGGG + Intergenic
959842419 3:110993682-110993704 ACATATTTGCATAAGATTAGTGG + Intergenic
959848313 3:111058940-111058962 ACATATAGGGTTAAAATAAAGGG + Intergenic
959891328 3:111560077-111560099 ACATATAGGCTCAAAATAAAAGG - Intronic
960203212 3:114863195-114863217 ACATATATCCATAAAGTGGAGGG + Intronic
960307275 3:116076830-116076852 ACATAAATGCAAAAATTGAAAGG - Intronic
960318563 3:116207273-116207295 ACACATAGGCACAAAATAAAAGG - Intronic
960422168 3:117460255-117460277 ACATATAGGCTTAAAATAAAGGG - Intergenic
960432114 3:117581912-117581934 ATATGTATACATAAATTGAAAGG + Intergenic
960566017 3:119132324-119132346 ACATATAGGCTCAAAATAAAGGG + Intronic
960580063 3:119269457-119269479 ACACATAGGCTTAAAATAAAGGG + Intergenic
960725409 3:120664792-120664814 ACATATATGTACAAAAAGAAAGG + Intronic
961392826 3:126565815-126565837 CCATATCTGCACAAAATGAATGG - Intergenic
961419446 3:126789693-126789715 ACATATAGGCTCAAAATAAAGGG - Intronic
961507560 3:127380590-127380612 ACATACATTCATAAAAAGAAGGG + Intergenic
961951134 3:130750339-130750361 AAATATATACATAAAATCAGTGG + Intergenic
962038494 3:131680295-131680317 ACATATAGGCTCAAAATAAAGGG - Intronic
962233129 3:133683473-133683495 ACACATAGGCTTAAAATAAAGGG + Intergenic
962567870 3:136681704-136681726 ACATTCATTAATAAAATGAAAGG + Intronic
962692177 3:137909548-137909570 ACATATAGGCTCAAAATAAAGGG + Intergenic
962836542 3:139194514-139194536 ACATATAGGCTCAAAATAAAGGG - Intronic
963339975 3:144021868-144021890 ACATATAGGCTCAAAATAAAGGG - Intronic
963471323 3:145746033-145746055 ACATATATGTATAAAACATAAGG + Intergenic
963997785 3:151730343-151730365 ACACATATGCTCAAAATAAATGG + Intergenic
964007540 3:151850141-151850163 ACACATAGGCTTAAAATAAAAGG - Intergenic
964132147 3:153301423-153301445 ATATATATATATAAAATTAAGGG + Intergenic
964149653 3:153508540-153508562 ACACATATGCTCAAAATAAAAGG + Intergenic
964189635 3:153987260-153987282 ACACATATGCTCAAAATAAAGGG - Intergenic
964298155 3:155257072-155257094 GCATATATGCATAAAGTGGTAGG + Intergenic
964519606 3:157550012-157550034 ACATATATACTGAAAGTGAAGGG - Intronic
964664388 3:159156021-159156043 ACATATATACCTGAAAGGAATGG + Intronic
964990103 3:162800277-162800299 ACAGCTATGTAAAAAATGAATGG - Intergenic
965137873 3:164797150-164797172 ACGTGTATTCATAAAATAAAAGG + Intergenic
965393255 3:168130559-168130581 ACATATAGGCTCAAAATAAAGGG + Intergenic
965398670 3:168191496-168191518 AAATATCTACATTAAATGAAAGG - Intergenic
965503746 3:169487766-169487788 AGATATATGCAAAAAAGGGAGGG + Intronic
965563570 3:170086164-170086186 ACATATTTGCATGATATGTAAGG - Intergenic
965731610 3:171778034-171778056 ACATATATGAATGCAATGTAAGG - Intronic
965993038 3:174844328-174844350 ACATAAATCAATGAAATGAATGG - Intronic
966533064 3:181002371-181002393 ACATATAGGCTCAAAATAAAGGG - Intergenic
966573581 3:181475241-181475263 ACATATAGGCTCAAAATAAAGGG - Intergenic
966658925 3:182392338-182392360 AAATAAATGCATAGAAAGAAAGG - Intergenic
967660284 3:192099424-192099446 AAATATATGGATAAAATAATAGG + Intergenic
967763193 3:193248267-193248289 ACATATAAGCTGATAATGAAGGG - Intronic
968417067 4:447586-447608 AAATACATGCACCAAATGAAGGG + Intronic
968888673 4:3353696-3353718 AAATATATACATGAAATGACTGG - Intronic
969086016 4:4656990-4657012 ACACAAATGCATGAAATGATAGG - Intergenic
970002897 4:11382614-11382636 ACATATAGGCTCAAAATAAAAGG - Intergenic
970020268 4:11559709-11559731 ACATGTAGGCTCAAAATGAAAGG + Intergenic
970125300 4:12803086-12803108 AAGTATGTGCAAAAAATGAAAGG + Intergenic
970220030 4:13800668-13800690 ACACATAGGCTCAAAATGAAAGG + Intergenic
970600628 4:17638787-17638809 ACATAGCCTCATAAAATGAAGGG + Intronic
970844296 4:20518056-20518078 ACATATATGCACAAAATAAAAGG - Intronic
970917689 4:21354421-21354443 ACACATAGGCTTAAAATAAAGGG + Intronic
970943722 4:21665519-21665541 AAATACATGTATAAAATGAGGGG - Intronic
971528216 4:27650088-27650110 ACAAAAATGAATAAAAAGAAGGG + Intergenic
971641720 4:29142626-29142648 ACACACACCCATAAAATGAAAGG - Intergenic
971724860 4:30297414-30297436 ACATATATACATATATTAAATGG - Intergenic
971955011 4:33406147-33406169 TCCTAAATGAATAAAATGAAAGG + Intergenic
972015082 4:34233434-34233456 ACATATATAATTAAAGTGAAAGG - Intergenic
972433450 4:39007408-39007430 ACATAAATAAATAAAAAGAAAGG - Intronic
972838750 4:42906714-42906736 ACATGTAGGCATTCAATGAAGGG - Intronic
972910967 4:43816620-43816642 TTATATATATATAAAATGAACGG - Intergenic
973251030 4:48060020-48060042 ACATATAGGCTCAAAATAAAGGG + Intergenic
973303080 4:48612095-48612117 AAATATATGCAGAAAACTAATGG - Intronic
973599224 4:52524470-52524492 ACATATAGGCTCAAAATAAAGGG + Intergenic
973753136 4:54043926-54043948 ACATATAGGCTCAAAATAAAGGG + Intronic
973837715 4:54827064-54827086 ACATATAGGCTCAAAATGAGTGG + Intergenic
973882087 4:55283225-55283247 ACAGATAGGATTAAAATGAAGGG - Intergenic
973983741 4:56329099-56329121 ACACATGTGCATACAAAGAAGGG + Intergenic
974024793 4:56723875-56723897 ATAAAAATGCATAACATGAAAGG - Intergenic
974176596 4:58333193-58333215 ACATATAGGCTCAAAATAAAGGG + Intergenic
974288005 4:59894227-59894249 ACATATAGGCTTAAAATAAAGGG + Intergenic
974731369 4:65871082-65871104 ACAAATCTTCATAGAATGAAGGG + Intergenic
974780570 4:66547335-66547357 ACACATAGGCTTAAAATAAAGGG + Intergenic
974908680 4:68088165-68088187 ACACATAGGCACAAAATAAAAGG + Intronic
975023071 4:69514814-69514836 ATATATAGGCTTAAAATAAAGGG + Intronic
975034460 4:69663076-69663098 ACATATAGGCTCAAAATAAAGGG + Intergenic
975064547 4:70044154-70044176 AAATATATGTATATTATGAATGG + Intergenic
975065260 4:70054220-70054242 ACATATATGATTAAACAGAATGG - Intronic
975153716 4:71047357-71047379 ACATGTATGCCCAAAATAAAGGG + Intergenic
975194448 4:71507367-71507389 ACACATAGGCTTAAAATAAAAGG + Intronic
975232379 4:71949827-71949849 ACATATAGGCTCAAAATAAAGGG + Intergenic
975426748 4:74238331-74238353 ACATAAATGAGTAAAAAGAAAGG - Intronic
975528937 4:75380381-75380403 ACAAATATGCTCAAAATAAAGGG + Intergenic
975620100 4:76288499-76288521 ACATATAAGCTGAAAATAAAGGG - Intronic
975723027 4:77266659-77266681 ACTTAGATGCAAGAAATGAACGG + Intronic
975833495 4:78395720-78395742 ACATATAGGCTGAAAGTGAAAGG - Intronic
975905142 4:79200942-79200964 ACATATATGTATAATATATATGG - Intergenic
976007038 4:80441829-80441851 ACACATAGGCTTAAAATAAAGGG + Intronic
976210139 4:82659944-82659966 ACATATAGGCTCAAAATAAAGGG + Intronic
976372093 4:84300915-84300937 ACACATAGGCTCAAAATGAAAGG + Intergenic
976550633 4:86391047-86391069 ACAAATATGGAGAAAATAAAAGG - Intronic
976592743 4:86865255-86865277 ACACATAGGCTTAAAATAAAAGG + Intergenic
976768124 4:88619820-88619842 ACATATTTGCATAAATTCACTGG - Intronic
976803164 4:89015695-89015717 ACATATATGTATAAATAGAATGG - Intronic
977194972 4:94047025-94047047 ACATATAGGCTCAAAATAAAGGG + Intergenic
977462208 4:97339132-97339154 ACACATAGGCTTAAAATAAAGGG + Intronic
977480069 4:97564302-97564324 ACACATAGGCTCAAAATGAAAGG - Intronic
977485227 4:97635613-97635635 ACATATAGGCTCAAAATAAAGGG + Intronic
977526117 4:98147011-98147033 ACATTCATGAATAAAATGGAAGG - Intergenic
977639194 4:99336149-99336171 ACACATTTTCATACAATGAAGGG - Intergenic
977936915 4:102816944-102816966 ACCTACATGCTTAAAATAAAGGG + Intronic
978115616 4:105016849-105016871 ACATATAGGCTCAAAATAAAGGG + Intergenic
978150511 4:105428472-105428494 ACAGATAGGCTTAAAATAAAGGG + Intronic
978236674 4:106469440-106469462 ACATATAGGCTCAAAATAAAGGG - Intergenic
978249622 4:106614729-106614751 CCATCTATGCACAAAGTGAAAGG + Intergenic
978269660 4:106873970-106873992 ACACATAAGCTTAAAATAAAGGG - Intergenic
978278094 4:106976607-106976629 ACATATATGCTTAAAATAAAGGG - Intronic
978313489 4:107411531-107411553 ACATATAGGCACAAAATAAAGGG + Intergenic
978531053 4:109713910-109713932 ACATTTATGCCTAGAAGGAACGG - Exonic
978626492 4:110691533-110691555 ACACATAGGCTCAAAATGAAAGG - Intergenic
978652051 4:111017605-111017627 ACATAAATGCATAAAATTGGAGG - Intergenic
978695071 4:111567397-111567419 ACACATAGGCACAAAATAAAGGG + Intergenic
978736392 4:112088603-112088625 ACATATAGGCTCAAAATAAAAGG + Intergenic
978832750 4:113109031-113109053 AAATATAAGCATCAAATGAATGG - Intronic
978878110 4:113666629-113666651 ACATATAAGCATAAAACCTAAGG + Intronic
978940196 4:114427514-114427536 ACATATAGGCTCAAAATAAAAGG - Intergenic
979151850 4:117327403-117327425 ATATATTTGTATAAAATAAAGGG - Intergenic
979280732 4:118864811-118864833 ACACATAGGCTGAAAATGAAGGG - Intronic
979588012 4:122444182-122444204 ACACATAGGCTTAAAATAAACGG - Intergenic
979735274 4:124074862-124074884 ACATATAGGCTCAAAATAAAAGG + Intergenic
979739274 4:124129683-124129705 ACACATAGGCTTAAAATAAAGGG - Intergenic
979743768 4:124183076-124183098 ACTTATATTCAAAATATGAAAGG + Intergenic
980216259 4:129856040-129856062 ACATATAGGCTCAAAATAAAAGG + Intergenic
980217789 4:129874612-129874634 ACACATATGCTCAAAATAAAGGG - Intergenic
980261756 4:130458379-130458401 ACATATAGGCTCAAAATAAAAGG - Intergenic
980306856 4:131073147-131073169 ACATATAGGCTCAAAATAAAAGG + Intergenic
980331813 4:131420385-131420407 ACATATAGGCTCAAAATAAAAGG - Intergenic
980399079 4:132256309-132256331 ACACATATGCTCAAAATAAAAGG + Intergenic
980426643 4:132635145-132635167 ACATATAGGCTCAAAATAAAAGG - Intergenic
980484860 4:133443141-133443163 AAATAGATCCATAAAATTAAGGG + Intergenic
980503769 4:133689055-133689077 ACACATAGGCTTAAAATAAAGGG - Intergenic
980507086 4:133737805-133737827 ACACATAGGCTCAAAATGAAGGG - Intergenic
980513268 4:133821615-133821637 ACACATAGGCACAAAATAAAGGG - Intergenic
980565088 4:134529329-134529351 TCATAAATGAATAAAATAAAAGG + Intergenic
980607637 4:135112773-135112795 ACATACATGCAAATAATAAATGG + Intergenic
980755890 4:137160016-137160038 AAATATATACATAAAATTAAAGG - Intergenic
980813722 4:137916383-137916405 ACACATAGGCTTAAAATAAAGGG + Intergenic
980887891 4:138783485-138783507 ACACATAGGCTTAAAATAAAGGG - Intergenic
980894916 4:138852906-138852928 TCATATAAACATGAAATGAAAGG + Intergenic
980917916 4:139051529-139051551 ACATATATGAATAAATTGCTGGG - Intronic
981201955 4:141990882-141990904 ACATATAGGCTCAAAATAAAGGG - Intergenic
981254991 4:142650489-142650511 ACATATAGGCTCAAAATAAAGGG + Intronic
981274051 4:142876879-142876901 ACATATAGGCTCAAAATCAAGGG + Intergenic
981293438 4:143102396-143102418 ACATATAGGCTCAAAATAAAAGG + Intergenic
981435320 4:144714170-144714192 ACATATTTTCATAAAGTAAAAGG - Intronic
981445436 4:144831951-144831973 ACATGTATGAATAAAAAGTATGG + Intergenic
981484152 4:145267534-145267556 AAATAAATCCATAACATGAAAGG - Intergenic
981553502 4:145966282-145966304 ACACATAGGCTTAAAATAAAGGG - Intergenic
981629950 4:146806505-146806527 ACATATAGACTTAAAATAAAGGG + Intronic
981684341 4:147436286-147436308 ACATATAGGCTCAAAATAAAAGG + Intergenic
981727897 4:147867206-147867228 GTAAATATGCATAAAATGTAGGG - Intronic
981992259 4:150935636-150935658 AAATATATGAAAAAAGTGAAGGG + Intronic
982310649 4:153981949-153981971 ACATATAGGCTCAAAATAAAGGG - Intergenic
982327904 4:154148452-154148474 ACATATAGGCTCAAAATAAAGGG - Intergenic
982580969 4:157178757-157178779 ACATATAGGCTCAAAATAAAAGG - Intergenic
982733813 4:158983917-158983939 ACATATAGGCTCAAAATAAAAGG + Intronic
983004517 4:162467343-162467365 ACACATAGGCTTAAAATAAAGGG - Intergenic
983215987 4:165002910-165002932 AAATGTATACATAAAATGAAGGG - Intergenic
983292227 4:165821147-165821169 ACACATAGGCTCAAAATGAAGGG + Intergenic
983978555 4:173966801-173966823 ACACATAGGCTTAAAATAAAGGG - Intergenic
984007729 4:174333655-174333677 AAAATTATGCAAAAAATGAAGGG + Intergenic
984508404 4:180649944-180649966 GTATATATATATAAAATGAAAGG - Intergenic
984628286 4:182033904-182033926 ACATATAGGCTTAAAAGAAAGGG - Intergenic
985072744 4:186184254-186184276 ACATATAGGCTCAAAATAAAGGG - Intergenic
985116073 4:186592551-186592573 ACACACCTGCATAAAATAAAAGG + Intronic
985234727 4:187860633-187860655 ACATATAGGCTCAAAATAAAAGG - Intergenic
985978414 5:3441170-3441192 ACATATAGGCTCAAAATAAAAGG + Intergenic
986205171 5:5617435-5617457 ACATATCTGAAAAAAATCAAAGG - Intergenic
986453832 5:7894736-7894758 ACATATATCCACAGAATGATGGG - Intronic
986530651 5:8733114-8733136 ACATATAGGCTCAAAATAAAGGG + Intergenic
986726012 5:10597314-10597336 ACATGTAGGCTGAAAATGAAGGG + Intronic
986885826 5:12234318-12234340 ACATATATTTATAAAATTATTGG + Intergenic
986978438 5:13418634-13418656 ACATATAGGCTCAAAATAAAAGG + Intergenic
986996746 5:13615568-13615590 ACATATAGGCTCAAAATAAAGGG + Intergenic
987424025 5:17753473-17753495 ACACATAGGCTCAAAATGAAAGG - Intergenic
987437889 5:17919803-17919825 TCATGTATGTATGAAATGAAAGG - Intergenic
987530342 5:19110656-19110678 ACATATATGCACACAATAATGGG - Intergenic
987786669 5:22509104-22509126 AAATATATACACACAATGAAAGG + Intronic
987852468 5:23374283-23374305 TCATATATTCATATAATTAAAGG + Intergenic
988248918 5:28728371-28728393 ACATGTATCCATAAAGTGTAAGG + Intergenic
988291859 5:29297334-29297356 ACTTCAATGCATAAAATGCAAGG - Intergenic
988309525 5:29540023-29540045 ACATATAGGTCTAAAATAAAAGG - Intergenic
988381080 5:30497696-30497718 ACATATAGGCTTAAAATAAAGGG - Intergenic
988678176 5:33456130-33456152 ACATCTAAAGATAAAATGAAAGG - Exonic
988775208 5:34471358-34471380 ACATATAGGCTCAAAATAAAGGG + Intergenic
988867479 5:35351922-35351944 ACACATAGGCTTAAAATAAAGGG - Intergenic
988880489 5:35496505-35496527 ACATATAGGCTCAAAATAAAAGG + Intergenic
989086114 5:37678100-37678122 ACATATAGGCTCAAAATAAAAGG - Intronic
989148687 5:38275344-38275366 ACATATAGGCTGAAAGTGAATGG + Intronic
989337743 5:40338160-40338182 ACACATAGGCTTAAAATAAAGGG + Intergenic
989676480 5:43979746-43979768 ACACATAGGCTTAAAATAAAGGG - Intergenic
989682248 5:44043189-44043211 ACACATATGCTTAAAATAAAAGG + Intergenic
989794259 5:45447158-45447180 ACACATATGCTCAAAATAAAAGG + Intronic
989942677 5:50172661-50172683 ACACATAGGCTCAAAATGAAAGG - Intergenic
989950739 5:50294308-50294330 ACATATAGGCTCAAAATAAAAGG - Intergenic
989968837 5:50496855-50496877 ACATATAGGCTCAAAATAAAGGG + Intergenic
990084184 5:51954002-51954024 ACACATAGGCTAAAAATGAAGGG + Intergenic
990239789 5:53805044-53805066 ACATATAGGCTCAAAATAAAGGG + Intergenic
990346004 5:54872333-54872355 ACATATAAGCATATAATTACTGG - Intergenic
990600633 5:57355368-57355390 ACACATAGGCTTAAAATAAAAGG - Intergenic
990945122 5:61241127-61241149 ACATATAGGCTCAAAATAAAGGG + Intergenic
991308525 5:65209078-65209100 ATATGTATGAATAAAATCAAAGG + Intronic
991527110 5:67572302-67572324 ACATATAGGCTGAAAGTGAAGGG - Intergenic
991615347 5:68491427-68491449 ACATAGATGCAGAGAAAGAATGG - Intergenic
991637135 5:68717383-68717405 ACATATAGGCTCAAAATAAAGGG - Intergenic
992055059 5:72980812-72980834 ACACATAAGCACAAAATAAAGGG - Intronic
992355259 5:75975330-75975352 TGATATCTGCCTAAAATGAAAGG + Intergenic
992652047 5:78868935-78868957 ACACATAGGCTCAAAATGAAAGG + Intronic
992740382 5:79768169-79768191 ACATATAGGCTCAAAATAAAGGG - Intronic
993013111 5:82506456-82506478 ACATATAGGCTCAAAATAAAAGG - Intergenic
993163203 5:84316383-84316405 ACATATAGGCTCAAAATTAAGGG + Intronic
993244499 5:85433716-85433738 ACATATAGGCTCAAAATAAAGGG + Intergenic
993301116 5:86211507-86211529 ATATATAATCATAGAATGAAGGG - Intergenic
993402923 5:87474849-87474871 ACATATAGGCTCAAAATAAAGGG + Intergenic
993587103 5:89745087-89745109 ACATATAGGCTCAAAATAAAGGG - Intergenic
993610753 5:90051202-90051224 ACATTTATGCGTAAAATTAAAGG - Intergenic
993685020 5:90927503-90927525 ACATATAGGCTCAAAATAAAAGG - Intronic
993757404 5:91749071-91749093 ACACATAGGCTTAAAATAAAGGG - Intergenic
993776011 5:91997134-91997156 AAATATATATATAAAATAAATGG - Intergenic
994146253 5:96399083-96399105 GCAGATATGCATAAAATGCAAGG - Intronic
994177386 5:96725814-96725836 TTATATTTGCATAAACTGAAAGG + Intronic
994270440 5:97770467-97770489 ACATATAGGCTCAAAATAAAGGG - Intergenic
994446547 5:99881128-99881150 ACATATATACTGAAAATAAAGGG + Intergenic
994542124 5:101112323-101112345 ACACATAGGCTTAAAATAAAAGG - Intergenic
994621575 5:102169880-102169902 ACTTATATGCAAAAAATAAAAGG + Intergenic
994807165 5:104463676-104463698 ACACATAGGCAGAAAATAAAGGG - Intergenic
994846002 5:104989174-104989196 AAATATATGCTTTAACTGAAGGG + Intergenic
994861094 5:105195346-105195368 ACATAAATGTAGAAAATGAGTGG - Intergenic
994978410 5:106841003-106841025 ACACATATGCTCAAAATAAAAGG + Intergenic
995047234 5:107665859-107665881 ACATATAAGCATAAAAACATGGG + Intronic
995329507 5:110931689-110931711 ACATATAAGCTCAAAATAAAGGG - Intergenic
995340696 5:111055979-111056001 ACATATAGGCTCAAAATAAAGGG - Intergenic
995425316 5:112014864-112014886 AGATATATGAGTAAAATGAAAGG - Intergenic
995983167 5:118133155-118133177 ACACATAGGCTCAAAATGAAGGG - Intergenic
996625763 5:125568470-125568492 ACATATAGGCTCAAAATAAAGGG + Intergenic
996675932 5:126174194-126174216 ACACATAGGCTTAAAATAAAAGG + Intergenic
996761845 5:126994038-126994060 ACATATATACATACAAAAAATGG + Intronic
996883284 5:128325477-128325499 ACACATAGGCTTAAAATAAAGGG - Intronic
996996886 5:129707509-129707531 TCATAGAAGTATAAAATGAAGGG - Intronic
997004384 5:129801590-129801612 ACAGATAGGCACAAAATAAAGGG - Intergenic
997501312 5:134376365-134376387 ACACATATGTACAAAATGACTGG + Intronic
998237216 5:140408355-140408377 ACATATATACATAGAAAGATAGG - Intronic
998498725 5:142613799-142613821 ACATAAATGCGTAAAATGTCTGG - Intronic
998583995 5:143406136-143406158 ATATATATGTATATAATTAAGGG + Intronic
998693184 5:144610964-144610986 ACATATATTCCACAAATGAATGG - Intergenic
998925943 5:147126729-147126751 ACATATAGGCTCAAAATAAAGGG - Intergenic
999468896 5:151833422-151833444 ACATATAGGCTCAAAATAAAGGG + Intronic
1000058989 5:157636354-157636376 ACATATAAGAAGAATATGAAGGG - Intronic
1000189150 5:158892059-158892081 GCATATAGGAATAAAATGAAGGG - Intronic
1000479491 5:161754096-161754118 ACATATCTGAATAAAATAACTGG - Intergenic
1000918544 5:167111204-167111226 CCATTTATGAATAAAATCAATGG + Intergenic
1002403556 5:179009945-179009967 AAATATATGTAGAAAATCAAAGG + Intergenic
1002413478 5:179103203-179103225 ACACATAGGCTTAAAATAAAAGG + Intergenic
1002551779 5:179999395-179999417 ACATATAGGCTAAAAATGAAGGG - Intronic
1002657299 5:180760538-180760560 ACACATAGGCTTAAAATAAAGGG - Intergenic
1002850724 6:994554-994576 ACATCTTTGTATAAAATAAATGG - Intergenic
1003473088 6:6455020-6455042 ACACAAATGCTTAAAATAAAAGG - Intergenic
1003542368 6:7029099-7029121 ACATATAGGCTCAAAATAAAGGG + Intergenic
1003727850 6:8786136-8786158 ACACAGATGCATAATTTGAAAGG + Intergenic
1003741190 6:8942283-8942305 ATATATATGTATCAAAAGAAAGG - Intergenic
1003751201 6:9058748-9058770 ATAAATATCCATCAAATGAATGG - Intergenic
1003862053 6:10331279-10331301 ACATCTATGCATAATAGGAATGG + Intergenic
1003959656 6:11197272-11197294 AAATAAATGCACAGAATGAAAGG - Intronic
1004008218 6:11656479-11656501 ATAAATATTCATCAAATGAATGG - Intergenic
1004095672 6:12551469-12551491 ACATATAGGCTCAAAATAAAAGG + Intergenic
1004114692 6:12754735-12754757 ACATATTTTTAAAAAATGAATGG + Intronic
1004685268 6:17937189-17937211 ACATACATACATAAATGGAAAGG + Intronic
1004717370 6:18230501-18230523 ACACATAGGCTCAAAATGAAGGG + Intronic
1004809226 6:19240963-19240985 ACACATAGGCTTAAAATAAATGG + Intergenic
1005183447 6:23135199-23135221 ACATATAGACTGAAAATGAAGGG - Intergenic
1005479629 6:26243043-26243065 AAATATATACATTAAATAAATGG - Intergenic
1005483614 6:26278066-26278088 AAATATATGATGAAAATGAATGG - Intergenic
1006368042 6:33627398-33627420 ATATATATGCAAAAAAGGACAGG - Intronic
1006462477 6:34169994-34170016 ACATATAGGCTGAAAATAAAAGG - Intergenic
1007442129 6:41871206-41871228 ACATATTTGGAGAAAAAGAAGGG + Intronic
1007945394 6:45822188-45822210 ACATATAACAGTAAAATGAAAGG - Intergenic
1008020457 6:46571585-46571607 ACATATAGGCTGAAAGTGAAGGG - Intronic
1008027563 6:46655159-46655181 CCATATATGCTTTAATTGAAAGG + Intronic
1008297414 6:49795351-49795373 ACATATAGGCTCAAAATAAAAGG - Intergenic
1008342622 6:50385992-50386014 TAATAAATGAATAAAATGAATGG + Intergenic
1008350104 6:50479766-50479788 ACACATAGGCTCAAAATGAAGGG + Intergenic
1008362195 6:50633300-50633322 ACATATAGGCTCAAAATAAAGGG - Intergenic
1008409746 6:51162195-51162217 ACACATATGCACAAAATAATTGG - Intergenic
1008412031 6:51191532-51191554 ACATATAGGCTCAAAATAAAAGG - Intergenic
1008414759 6:51226607-51226629 ACATATAGGCTCAAAATAAAGGG + Intergenic
1008633388 6:53384994-53385016 ACATATAGGCTCAAAATAAAGGG + Intergenic
1008724389 6:54399127-54399149 AGATATTTGCCTAAAATGTAAGG + Intergenic
1008845543 6:55958647-55958669 ACATATAGGTAAAAAATGTATGG - Intergenic
1008978402 6:57455655-57455677 ACATATAGGCTCAAAATAAAGGG - Intronic
1008998079 6:57681757-57681779 ACACATAGGCTTAAAATAAAGGG + Intergenic
1009476221 6:64095623-64095645 ACATATAGGCTCAAAATAAAGGG - Intronic
1009520512 6:64676589-64676611 ACATATATATACAAAATGTATGG - Intronic
1009536908 6:64898726-64898748 ACATATAAGCTCAAAATAAAGGG + Intronic
1009706933 6:67264466-67264488 ACATATAGGCTCAAAATAAAGGG - Intergenic
1009724283 6:67516700-67516722 ACATATATTTATATAATCAAGGG - Intergenic
1009767189 6:68094332-68094354 AAAGATAAACATAAAATGAAAGG + Intergenic
1009779049 6:68245187-68245209 CCATTTATGCATAATATTAAAGG + Intergenic
1009848086 6:69159660-69159682 ACAAATATAGATAAAATCAATGG - Intronic
1009946237 6:70345047-70345069 ACCTATATGCTGAAAATAAAAGG - Intergenic
1009959262 6:70499350-70499372 ACATATAGGCTCAAAATAAAGGG - Intronic
1010006463 6:71000263-71000285 ACATATAGGCTCAAAATAAAGGG + Intergenic
1010048817 6:71479571-71479593 AGAAAAATGAATAAAATGAAGGG + Intergenic
1010093222 6:72008596-72008618 ACATATAGGCTCAAAATAAAAGG + Intronic
1010271413 6:73919776-73919798 ACATATAGGCTCAAAATAAAAGG + Intergenic
1010362828 6:75014575-75014597 ACACATAGGCTCAAAATGAAGGG + Intergenic
1010670278 6:78678251-78678273 ACATATAGGCTCAAAATAAAGGG + Intergenic
1010755467 6:79662014-79662036 ACATATAGGCTCAAAATAAAGGG - Intronic
1010926910 6:81754271-81754293 ATATATATGTATAAAATGCCTGG - Intergenic
1011213726 6:84982309-84982331 ACACATAGGCACAAAATAAAGGG + Intergenic
1011296952 6:85836326-85836348 ACATATAGGCTGAATATGAAGGG + Intergenic
1011395320 6:86899842-86899864 ACACATAGGCTCAAAATGAAAGG + Intergenic
1011513894 6:88131380-88131402 ACATATATGCAAAGAATTAAAGG - Intergenic
1011671563 6:89688460-89688482 ACATATATACATATAAACAAAGG - Intronic
1011992451 6:93539795-93539817 ACATATAGGCTCAAAATAAAGGG + Intergenic
1012040782 6:94201901-94201923 ACATATAGGCTCAAAATAAAAGG - Intergenic
1012347497 6:98208723-98208745 ACACATATGAATAAAAAGAATGG - Intergenic
1012508192 6:99973432-99973454 ACACATAGGCTCAAAATGAAGGG - Intronic
1012514297 6:100040678-100040700 ACATATAGGCTCAAAATAAAGGG + Intergenic
1012527812 6:100198597-100198619 ACATATAGGCTCAAAATAAAAGG + Intergenic
1012600312 6:101088637-101088659 ACATAAATGAAGAAAATGACAGG - Intergenic
1012721908 6:102756752-102756774 ACATATAGGCTCAAAATAAAAGG - Intergenic
1012933447 6:105340664-105340686 ACATATATGCTGAAAATAAAGGG + Intronic
1013383579 6:109601944-109601966 ACACATAAGCTTAAAATAAAGGG - Intronic
1013449097 6:110261240-110261262 ACATATAGGCTCAAAATAAAGGG + Intronic
1013494825 6:110688341-110688363 ATATATATATATAAAATGCAGGG + Intronic
1013659139 6:112276840-112276862 TCATAGATGCATAAACTGAGAGG + Intergenic
1013825367 6:114204797-114204819 AAATATAAGTACAAAATGAAAGG - Intronic
1013890792 6:115024465-115024487 ATATAAATACATAAAATTAAAGG + Intergenic
1013895493 6:115082843-115082865 ACACATAGGCTCAAAATGAAGGG + Intergenic
1013906362 6:115224330-115224352 ACACATAGGCTTAAAATAAATGG + Intergenic
1013939829 6:115647434-115647456 ACACATAGGCTCAAAATGAAGGG + Intergenic
1014965529 6:127743390-127743412 ACAGATGTGAATGAAATGAAGGG + Intronic
1015225133 6:130849071-130849093 ACATATATGCATAAGGAGACTGG + Intronic
1015623160 6:135154222-135154244 ACATATAGGCTCAAAATAAAGGG - Intergenic
1015765227 6:136709167-136709189 ACAAATATGAATAAAATACATGG - Intronic
1015932076 6:138371245-138371267 TTATATATGCAAAAAATAAAGGG - Intergenic
1016018697 6:139212751-139212773 ACATATAGGCTCAAAATAAAGGG + Intergenic
1016096030 6:140038428-140038450 ACACATATGCATAAAATATAAGG - Intergenic
1016190121 6:141254862-141254884 ATATATATGCATTAAATCAAGGG + Intergenic
1016195820 6:141338162-141338184 ACACATATACTGAAAATGAAAGG + Intergenic
1016329034 6:142936629-142936651 ACACATATATATAAAATAAATGG + Intronic
1016408283 6:143755010-143755032 ATATATATGCAAATAATGAACGG - Intronic
1016524341 6:144984515-144984537 ACATAAAAACATAAAATGGAGGG - Intergenic
1016556581 6:145345614-145345636 AGATAGGTGCATAAAATGGAAGG - Intergenic
1016930410 6:149401342-149401364 ACACATAGGCAGAAAGTGAAGGG + Intronic
1018758369 6:166869001-166869023 ATATATATATATAAAATAAAGGG - Intronic
1019063893 6:169279204-169279226 ACATATCTACAGAAAATGAACGG - Intergenic
1019203372 6:170338893-170338915 ACACATAGGCTTAAAATAAAGGG - Intronic
1020419050 7:7979635-7979657 ATATGTATGCATAGAAAGAAAGG - Intronic
1020513980 7:9092922-9092944 ACCCATAGGCTTAAAATGAAGGG + Intergenic
1020674083 7:11159174-11159196 ACAGATATTCAAAAAATGAAAGG - Intronic
1020694327 7:11395090-11395112 ACACATAGGCTTAAAATAAAGGG + Intronic
1020723886 7:11784706-11784728 ACCTCTATGCATAAAATTATTGG - Intronic
1020753176 7:12168731-12168753 ACATATAGGCTAAAAATAAAGGG - Intergenic
1020756121 7:12205473-12205495 AAAAAAATGCATAAAATAAAAGG - Intergenic
1020874043 7:13671935-13671957 ACATATAGGCTCAAAATAAAGGG - Intergenic
1021161698 7:17281216-17281238 AAATATATGAAAAACATGAATGG - Intergenic
1021661822 7:22926455-22926477 ACATATAGGCTCAAAATAAAGGG + Intergenic
1021797964 7:24276850-24276872 ACATATAGGCTCAAAATAAAGGG - Intergenic
1021803427 7:24331050-24331072 ACACATTTGCATAAAATGTCTGG - Intergenic
1021868557 7:24981153-24981175 ATATCTATGCAAAAAATAAAAGG + Intronic
1021869067 7:24985757-24985779 ACATAAATGCTTAAAACGCATGG - Intergenic
1022135799 7:27447414-27447436 ACATATAGGCTCAAAATGAAGGG - Intergenic
1022615860 7:31929057-31929079 ACATATAGGCTCAAAATAAAGGG + Intronic
1022835802 7:34113380-34113402 CCATATAAGCATAAATGGAAAGG - Intronic
1022845271 7:34204107-34204129 ACACATAGGCTTAAAATAAAAGG - Intergenic
1022869363 7:34459467-34459489 ACATATAGGCTAAAAATAAAGGG + Intergenic
1023146448 7:37155440-37155462 ACATATAGGCTCAAAATAAAGGG + Intronic
1023513077 7:40973797-40973819 ACATATATAAATAAAATACAAGG - Intergenic
1023645897 7:42314459-42314481 ATGTATTTGCTTAAAATGAAGGG - Intergenic
1023666758 7:42530743-42530765 ACATATAGGCACAAAATAAAGGG + Intergenic
1023757026 7:43429275-43429297 ATATATATGCATATAATATATGG - Intronic
1024149966 7:46561375-46561397 ACACATATGCTCAAAATAAAAGG - Intergenic
1024352886 7:48385122-48385144 AAATAAATACATAAAGTGAAGGG - Intronic
1024747240 7:52422198-52422220 TTATATATGCATATAATAAAGGG + Intergenic
1024796705 7:53030188-53030210 ACATATAGGCTCAAAATAAAAGG - Intergenic
1024998283 7:55292789-55292811 ACACATAGGCTTAAAATAAAGGG - Intergenic
1025547631 7:62197279-62197301 ACATATAGGCTCAAAATAAAGGG - Intergenic
1026322223 7:69277831-69277853 AAATATATGCATTAATTAAATGG - Intergenic
1026458085 7:70590168-70590190 ATATATATGTATAAAATAAGGGG + Intronic
1027496162 7:78890001-78890023 ACATATAGGCTCAAAATAAAGGG + Intronic
1027563366 7:79760392-79760414 ACATATAAGCTCAAAATAAAAGG + Intergenic
1027591561 7:80125468-80125490 ACACATATATATTAAATGAATGG - Intergenic
1027639467 7:80715243-80715265 ACATATAGGCTCAAAATAAAAGG + Intergenic
1027701996 7:81480707-81480729 ACACTTATGCTCAAAATGAAGGG + Intergenic
1028307456 7:89283954-89283976 TCATAAATGCATAAAATACAAGG + Intronic
1028321369 7:89464219-89464241 ACATATAAGCTCAAAATAAAGGG - Intergenic
1028476223 7:91256584-91256606 ACATATCGGCTTAAAATAAAGGG - Intergenic
1028497670 7:91480543-91480565 ACATATAGGCGCAAAATAAAAGG - Intergenic
1028945297 7:96573156-96573178 ACATATAGGCTCAAAATAAAGGG - Intronic
1029233440 7:99091149-99091171 GCATATATACATAAAATCAGTGG + Intronic
1029693739 7:102199785-102199807 ATATATATGGATTAAATGATCGG + Intronic
1030198321 7:106875728-106875750 ACATTTACTCAAAAAATGAATGG - Intronic
1030258163 7:107534437-107534459 ACATATAGGCTGAAAATAAAGGG + Intronic
1031169835 7:118279104-118279126 ATATATATACATAAAATTATAGG - Intergenic
1031408455 7:121413672-121413694 ATATATATATATAAAATGTAGGG - Intergenic
1031565382 7:123290392-123290414 ATATGTATCCCTAAAATGAAAGG - Intergenic
1031864270 7:127020670-127020692 ACACATTTGTATTAAATGAATGG - Intronic
1031902425 7:127426313-127426335 ACACATATGCTCAAAATAAAGGG - Intronic
1032295680 7:130636591-130636613 ACACATAGGCTTAAAATAAAGGG - Intronic
1032317444 7:130852526-130852548 ACAACTATGTATAAAATCAATGG - Intergenic
1032632184 7:133665490-133665512 ACATATATACATAAAATTTGGGG + Intronic
1032883226 7:136112725-136112747 ACATATAGGCTCAAAATAAAGGG - Intergenic
1032898734 7:136281973-136281995 AAACATATACATAAAATGGAAGG + Intergenic
1032972738 7:137183745-137183767 ACATATAGGCTCAAAATAAAAGG + Intergenic
1033626359 7:143113570-143113592 ACATATAGGCTCAAAATAAAGGG + Intergenic
1033633509 7:143185400-143185422 GCATAAAGGCATAAAATAAACGG - Intergenic
1033887744 7:145968813-145968835 ACACATATGCTCAAAATAAAGGG + Intergenic
1034314728 7:150119360-150119382 ACACATAGGCTTAAAATAAAGGG + Intergenic
1034480756 7:151318933-151318955 ACACGTATGCATAAAATATAAGG + Intergenic
1034792174 7:153981411-153981433 ACACATAGGCTTAAAATAAAGGG - Intronic
1035008584 7:155690338-155690360 ACATATAGGCTCAAAATAAAGGG - Intronic
1035558579 8:587637-587659 ACATATAGGCTCAAAATAAAGGG - Intergenic
1035639284 8:1171752-1171774 ACATATAGGCTCAAAATAAAAGG - Intergenic
1035884228 8:3274797-3274819 ACACATAGGCTCAAAATGAAAGG - Intronic
1035954253 8:4058564-4058586 ACATATAGGCTCAAAATAAAAGG + Intronic
1036076715 8:5510612-5510634 ACTTCTATGCATATAATAAAAGG + Intergenic
1036608188 8:10326620-10326642 ACAACTTTGCATAAAATGGAGGG + Intronic
1036955595 8:13185174-13185196 ACATATAGGCTCAAAATAAAGGG - Intronic
1036981241 8:13472293-13472315 ACATATGTACATTAAATGAAGGG + Intronic
1037076067 8:14720206-14720228 ACTTACATGCTTAAAATAAAAGG + Intronic
1037385847 8:18340360-18340382 ACACATAAGCTGAAAATGAAGGG + Intergenic
1037774956 8:21827849-21827871 ACATATAGGCTCAAAATAAAAGG + Intergenic
1037998635 8:23371443-23371465 ACATGTATGATTAAAATGCATGG + Intronic
1038222000 8:25618116-25618138 ACATATAGGTTGAAAATGAAAGG + Intergenic
1038268268 8:26052460-26052482 AGAAATATGCATAAAATAAAGGG - Intergenic
1038449733 8:27632491-27632513 ACATATATGCAGAAAATGGCAGG - Intergenic
1038846499 8:31235133-31235155 ACATATAGGCTCAAAATAAAGGG - Intergenic
1039051752 8:33501532-33501554 ACAAATATTCAAAGAATGAATGG - Intronic
1039134088 8:34299841-34299863 ACATATAGGCTCAAAATAAAGGG + Intergenic
1039237535 8:35518322-35518344 AGATATATAAATAAAATGGAAGG - Intronic
1039238748 8:35531915-35531937 ACATATAGGCTCAAAATAAAAGG - Intronic
1039283206 8:36008676-36008698 ACATATAGGCTCAAAATAAAGGG + Intergenic
1039609467 8:38907809-38907831 ACATACATACATAAAATAAGTGG - Intronic
1039632554 8:39128388-39128410 ACACATAGGCTCAAAATGAAGGG - Intronic
1039634420 8:39147769-39147791 AAATAAATGAATAAAATAAAGGG - Intronic
1039789022 8:40859309-40859331 ACACAAATTCACAAAATGAAAGG + Intronic
1039811763 8:41055238-41055260 CTATATTTGCAAAAAATGAAAGG - Intergenic
1040043209 8:42938265-42938287 ACATATAGGCTCAAAATAAAGGG - Intronic
1040099909 8:43489999-43490021 ACATATAGGCTCAAAATAAAAGG + Intergenic
1040273437 8:45983895-45983917 ACACATAGGCTTAAAATAAAAGG - Intergenic
1040374680 8:46813377-46813399 ACATATAGGCTCAAAATAAAAGG + Intergenic
1040437127 8:47401605-47401627 ACACATAGGCTCAAAATGAAGGG + Intronic
1040447363 8:47508931-47508953 ATATATATATATAAAATGGAAGG - Intronic
1040458491 8:47623510-47623532 ACATATAGGCCCAAAATGAAGGG + Intronic
1040612582 8:48999858-48999880 ACACATAGGCTTAAAATAAAGGG + Intergenic
1040613064 8:49005409-49005431 ACATATAGGCTCAAAATAAAGGG - Intergenic
1040716039 8:50253699-50253721 ACATATATGTATATATGGAATGG + Intronic
1040760383 8:50834528-50834550 ACATATAGGCTCAAAATAAAAGG + Intergenic
1040843124 8:51805463-51805485 TTATATATATATAAAATGAATGG + Intronic
1040863745 8:52026984-52027006 ACACATAAGCTCAAAATGAAGGG - Intergenic
1040942805 8:52850540-52850562 ACACATAGGCTCAAAATGAAGGG - Intergenic
1040992919 8:53371257-53371279 ACATATAGGCTCAAAATAAAGGG + Intergenic
1041234311 8:55783886-55783908 GAAAATATGCATACAATGAAAGG + Intronic
1041371160 8:57162500-57162522 ACACATATGCTCAAAATAAAAGG - Intergenic
1041416971 8:57621541-57621563 ATAAAGATGAATAAAATGAAAGG + Intergenic
1041859476 8:62496173-62496195 ATATCTAAGCATAAAAGGAAAGG + Intronic
1042010773 8:64242231-64242253 ACATATAGGCTCAAAATAAAAGG + Intergenic
1042016624 8:64320590-64320612 ACATATAGGCTCAAAATAAAGGG - Intergenic
1042626943 8:70768799-70768821 ACATATAGGCTCAAAATAAAGGG - Intronic
1042760494 8:72267084-72267106 ACCTATATGCCAAAGATGAAGGG - Intergenic
1043054311 8:75418428-75418450 AAATATATGCATAGACTGTAAGG - Intronic
1043319458 8:78964989-78965011 ATATATATGCATAATATTATTGG + Intergenic
1043535813 8:81203284-81203306 ACACATATGCTCAAAATAAAGGG - Intergenic
1043604926 8:81988950-81988972 ACACATAGGCTTAAAATAAAGGG - Intergenic
1043606912 8:82012094-82012116 CCATATCAGCATAAAATCAAAGG - Intergenic
1043706764 8:83359675-83359697 ACAGATAGGTAAAAAATGAAAGG - Intergenic
1044329049 8:90894919-90894941 ATGTATATCCTTAAAATGAAGGG - Intronic
1044812013 8:96072675-96072697 ACATATAGGCTCAAAATAAAGGG + Intergenic
1044956399 8:97485996-97486018 ACACATATGCTCAAAATAAAGGG - Intergenic
1045212342 8:100110882-100110904 ACATATAGGCTCAAAATAAAGGG + Intronic
1045240599 8:100397424-100397446 ATATATATGCAAACACTGAAAGG - Intronic
1045608989 8:103812741-103812763 ACATATAAGCAAAAAATAAAAGG - Intronic
1045619148 8:103953875-103953897 ACATATAGGCTCAAAATAAAGGG + Intronic
1045780535 8:105857666-105857688 ACACATAGGCAGAAAGTGAAGGG + Intergenic
1046153109 8:110254674-110254696 ACATATAGGCTCAAAATAAAGGG - Intergenic
1046292723 8:112183866-112183888 ACATATAGGCTCAAAATAAAGGG + Intergenic
1046445234 8:114310992-114311014 ACATATTAGGATGAAATGAATGG - Intergenic
1046602131 8:116328778-116328800 ACATATAGGCTCAAAATAAAGGG + Intergenic
1046700051 8:117390365-117390387 ACCTATTTGCATAAATTAAAAGG + Intergenic
1046812818 8:118550801-118550823 ACACATAGGCTTAAAATAAAAGG + Intronic
1046901000 8:119523279-119523301 ACATATAGGCTCAAAATAAAGGG + Intergenic
1046988937 8:120427433-120427455 ACATATATGAAAAAAATCAATGG + Intronic
1047042321 8:121009660-121009682 ACAGATCTGAATAAAATGCAGGG + Intergenic
1047149725 8:122246551-122246573 ACACATAGGCTCAAAATGAAAGG + Intergenic
1047156978 8:122330537-122330559 ACACATAGGCTCAAAATGAAAGG - Intergenic
1047157258 8:122333262-122333284 AATAATAAGCATAAAATGAATGG - Intergenic
1047549675 8:125856593-125856615 TCATCTATGAATATAATGAATGG - Intergenic
1047664847 8:127080304-127080326 ATAAATAAACATAAAATGAAAGG - Intergenic
1048338174 8:133518512-133518534 AGATTTAAGCATCAAATGAAGGG - Intronic
1048382394 8:133878365-133878387 ACATATAGGCTCAAAATAAAGGG - Intergenic
1048554969 8:135466818-135466840 GAATAAATGAATAAAATGAAAGG - Intronic
1048644216 8:136399997-136400019 ACATATGTATATAATATGAAAGG - Intergenic
1048771374 8:137898927-137898949 AAATAAATGAATAAAATAAAGGG + Intergenic
1048854052 8:138671382-138671404 TCATAACTGCATAAAATTAATGG + Intronic
1048920388 8:139224477-139224499 GCAGTTCTGCATAAAATGAAAGG + Intergenic
1049809283 8:144556355-144556377 ACAAATATCTATGAAATGAATGG + Intronic
1050011920 9:1193993-1194015 ACATATAGGCTCAAAATAAAGGG - Intergenic
1050322663 9:4468909-4468931 ACATATAGGCTCAAAATAAAGGG + Intergenic
1050373941 9:4951579-4951601 ACATATAGGCTCAAAATAAAAGG - Intergenic
1050478056 9:6061520-6061542 ACATATAGGCTCAAAATAAAGGG - Intergenic
1050490233 9:6181080-6181102 ACATATAGGCTCAAAATAAAGGG - Intergenic
1050597501 9:7218232-7218254 ACATATAGGCTCAAAATAAAGGG + Intergenic
1050603945 9:7281554-7281576 ACATATAGGCTCAAAATAAAGGG - Intergenic
1050756287 9:9008198-9008220 AAATAAATAAATAAAATGAAGGG - Intronic
1051292538 9:15559601-15559623 ACACATAGGCTTAAAATAAAGGG - Intronic
1051300632 9:15646524-15646546 ACACATAGCCTTAAAATGAAGGG + Intronic
1051962465 9:22784497-22784519 AGATATGTGAATAAAATGGAAGG - Intergenic
1052052477 9:23864477-23864499 ACACATAGGCTTAAAATAAAAGG - Intergenic
1052117466 9:24666703-24666725 ACATATAGGCTCAAAATAAAGGG - Intergenic
1052239286 9:26251906-26251928 ACACATAGGCTCAAAATGAAAGG + Intergenic
1052241614 9:26279689-26279711 ACATATAGGCTCAAAATAAAGGG + Intergenic
1052492226 9:29184597-29184619 ACATAAATGCATGAAGTGTAAGG - Intergenic
1052606075 9:30702910-30702932 AAATGTATGAATAAAATAAAAGG + Intergenic
1052640286 9:31158812-31158834 ACACATAGGCTTAAAATAAAGGG - Intergenic
1052710948 9:32054717-32054739 ACACATAGGCTTAAAATAAAGGG + Intergenic
1052717176 9:32130766-32130788 ACACATAGGCTTAAAATAAAGGG + Intergenic
1052770261 9:32681658-32681680 ACATATAGGCTAAAAATAAAGGG + Intergenic
1052814994 9:33095648-33095670 ATATATATATATAAAATAAAAGG + Intergenic
1053084009 9:35202718-35202740 ACATATAGGCTCAAAATAAAGGG - Intronic
1053714812 9:40876039-40876061 ACACATAGGCTTAAAATGAAAGG + Intergenic
1055008456 9:71536424-71536446 ATATATATGCATATAATAACAGG + Intergenic
1055387458 9:75777816-75777838 ACACATAGACAAAAAATGAAGGG + Intergenic
1055659183 9:78484871-78484893 AAAAAAATGCATAAATTGAAAGG - Intergenic
1055715188 9:79109776-79109798 CAGTATATGCATATAATGAAAGG + Intergenic
1055732318 9:79291054-79291076 AGATAAATTCATATAATGAATGG + Intergenic
1055754732 9:79545827-79545849 ACATATAGGCACAAAATAAAGGG + Intergenic
1055820779 9:80260213-80260235 ACATATAGGCTGAAATTGAAGGG + Intergenic
1055873518 9:80915297-80915319 ACATATAAGCTCAAAATAAAGGG - Intergenic
1056158587 9:83865044-83865066 ACATATAGGCTCAAAATAAAGGG - Intronic
1056416422 9:86381341-86381363 ACATATAGGCTCAAAATAAAGGG - Intergenic
1056907205 9:90663677-90663699 ACATATAGGCTCAAAATAAAGGG - Intergenic
1057238446 9:93386684-93386706 AAATAAATACATAAAATGTATGG - Intergenic
1057639076 9:96799267-96799289 ACATATAGGCTCAAAATAAAAGG + Intergenic
1057941212 9:99286440-99286462 GCATATATGAATAATATGAATGG - Intergenic
1057999985 9:99855316-99855338 ACAAATATTCATTGAATGAATGG + Intronic
1058027395 9:100156725-100156747 ACATATATGAAACATATGAAGGG - Intronic
1058093047 9:100827613-100827635 ACATATAGGCTGAAAATAAAGGG - Intergenic
1058192782 9:101939276-101939298 ACACATAGGCTTAAAATAAAGGG - Intergenic
1058232168 9:102440181-102440203 CCATAGAAGAATAAAATGAATGG - Intergenic
1058338239 9:103860667-103860689 ACACATAGGCTCAAAATGAAGGG + Intergenic
1058548759 9:106090157-106090179 ACACATAGGCTTAAAATAAAGGG + Intergenic
1058595153 9:106607241-106607263 ACACATAGGCTTAAAATAAAGGG + Intergenic
1058966665 9:110045282-110045304 GCATATTTGAATAAAATAAATGG - Intronic
1059228273 9:112693408-112693430 AAATATATGGAGAAAACGAATGG - Intronic
1059262475 9:112991949-112991971 ACATATAGGCTCAAAATAAAGGG - Intergenic
1059867889 9:118536819-118536841 ACATCTATGCATAGAAAGAGAGG - Intergenic
1059895361 9:118857863-118857885 ACACATAGGCTTAAAATAAAGGG + Intergenic
1059979704 9:119758096-119758118 ACATGTAGGCTGAAAATGAAAGG + Intergenic
1060095069 9:120781688-120781710 ACATATATACATACATGGAATGG + Intronic
1060166271 9:121418961-121418983 ACATATAGGCTCAAAATAAAAGG - Intergenic
1060339512 9:122761267-122761289 ACATATAGGCTCAAAATAAAGGG + Intergenic
1061374917 9:130218363-130218385 ACACATATGCACACAATGCATGG + Intronic
1061425440 9:130495499-130495521 ACATATATATATAAAATAATTGG + Intronic
1061699211 9:132402814-132402836 CCATATAGGAATAAAATGGAAGG - Exonic
1062293378 9:135808763-135808785 ACATACATGCGTAAAATAATGGG + Exonic
1203380289 Un_KI270435v1:30491-30513 ACACATAGGCTCAAAATGAAAGG + Intergenic
1203554672 Un_KI270743v1:195807-195829 ACATATAGGCTCAAAATAAAAGG + Intergenic
1203620242 Un_KI270749v1:119975-119997 ACACATAGGCTCAAAATGAAAGG + Intergenic
1186613180 X:11158774-11158796 ACATTTATGCAATGAATGAAAGG - Intronic
1186684065 X:11906108-11906130 AAATAAATAAATAAAATGAAGGG - Intergenic
1186686020 X:11925026-11925048 ACATATAGGCTCAAAATAAAGGG + Intergenic
1186773082 X:12837227-12837249 ACACATAGGCTCAAAATGAAGGG - Intergenic
1186810573 X:13183899-13183921 ACACATATGCTCAAAATAAAGGG + Intergenic
1186929367 X:14371447-14371469 ACACATAGGCTCAAAATGAAGGG + Intergenic
1186937009 X:14461717-14461739 ACATATACGCTCAAAATAAAAGG - Intergenic
1186979902 X:14947614-14947636 ATATATATTTATAAAATCAATGG - Intergenic
1186982532 X:14972868-14972890 ACACATATGCTCAAAATAAAGGG - Intergenic
1187042510 X:15611858-15611880 TCATAGATGAAGAAAATGAAAGG + Intergenic
1187271584 X:17785243-17785265 ACATATAGGCTCAAAATAAAAGG - Intergenic
1187514398 X:19953951-19953973 ACATATAAGCACAGAAAGAAGGG + Intronic
1187646347 X:21350856-21350878 ACATATAGGCTCAAAATAAAAGG + Intergenic
1188043012 X:25392243-25392265 ACATATATATACAAATTGAAAGG - Intergenic
1188208923 X:27394804-27394826 ATATATATGCAATATATGAATGG + Intergenic
1188319992 X:28724464-28724486 ACATATAGGCTCAAAATAAAGGG - Intronic
1188594576 X:31882997-31883019 ACATATATGCAGCAAAGGACAGG + Intronic
1188713871 X:33436541-33436563 ACATATAGGCTGAAAGTGAAGGG + Intergenic
1188855087 X:35184713-35184735 ACAGATATGCTAAAAATTAATGG + Intergenic
1189111173 X:38291135-38291157 ATATATATATATAAAATGAAGGG + Intronic
1189189047 X:39080953-39080975 ACACATAGGCTCAAAATGAAGGG - Intergenic
1189925429 X:45948470-45948492 AGAAATATGCATTAAATGCATGG - Intergenic
1189940435 X:46115763-46115785 ACATATAGGCTCAAAATAAAGGG - Intergenic
1189970491 X:46413760-46413782 ACACATAGGCTTAAAATAAAGGG - Intergenic
1190038122 X:47045203-47045225 ACATATAGGCTGAAAATAAAGGG + Intronic
1190458756 X:50650194-50650216 ACAGATATGCAAATATTGAAAGG + Intronic
1190550797 X:51577913-51577935 ACACATATGCTCAAAATAAAGGG + Intergenic
1191135151 X:57056610-57056632 ACATATAGGCTCAAAATAAAGGG - Intergenic
1191168326 X:57416095-57416117 ACATATAGGCCCAAAATAAAGGG - Intronic
1191589026 X:62860340-62860362 ACACATAGGCTCAAAATGAAGGG + Intergenic
1191697913 X:64008145-64008167 ACAGATAGGCATAAAAAGATTGG + Intergenic
1191705330 X:64087889-64087911 ACACATATGCTCAAAATAAAGGG + Intergenic
1191711553 X:64154436-64154458 ACATATAGGCTCAAAATAAAGGG + Intergenic
1191789163 X:64950716-64950738 ACACATAGGCTTAAAATAAAGGG - Intronic
1191886344 X:65892526-65892548 ACACATAGGCTCAAAATGAAGGG - Intergenic
1191908755 X:66125102-66125124 ACACATATGCTCAAAATGAAGGG - Intergenic
1191925935 X:66309930-66309952 ACACATAGGCTCAAAATGAAAGG + Intergenic
1191956555 X:66648700-66648722 ACACATAGGCATAAAATAAAGGG - Intergenic
1191978264 X:66897302-66897324 ATAAATATGAATATAATGAAAGG - Intergenic
1191987369 X:66996660-66996682 AAAAATATGCTTAAAATGAAAGG - Intergenic
1192004010 X:67190312-67190334 ACATAAAGGCACAAAATAAAGGG - Intergenic
1192023979 X:67427990-67428012 ACATATATGCACCAAATCATTGG - Intergenic
1192077218 X:68011431-68011453 ACACATAGGCACAAAATAAAGGG + Intergenic
1192085635 X:68094406-68094428 ACATATATGTAGAAATGGAAAGG - Intronic
1192128752 X:68528350-68528372 ACATATAAGCTCAAAATAAAGGG - Intronic
1192304748 X:69947204-69947226 ACATCTTTGAATAAAAGGAAGGG - Intronic
1192371634 X:70518981-70519003 ACACATAGGCACAAAATAAAAGG - Intergenic
1192660312 X:73035547-73035569 ACATATAGGCTCAAAATAAAAGG - Intergenic
1192688241 X:73330404-73330426 ACATATAGGCTCAAAATAAAGGG - Intergenic
1192720584 X:73692934-73692956 ACACATAGGCTTAAAATAAAGGG + Intergenic
1192760378 X:74089682-74089704 ACAAATAGGCACAAAATAAAGGG + Intergenic
1192883884 X:75317386-75317408 ACATATAGGCTCAAAATAAAGGG - Intergenic
1192900613 X:75492064-75492086 ACATATAGGCTCAAAATAAAGGG + Intronic
1192976363 X:76290129-76290151 ACATATAGGCTCAAAATAAAAGG + Intergenic
1192997281 X:76525698-76525720 ACATATAGGCTCAAAATAAAGGG - Intergenic
1193025609 X:76842752-76842774 ACATATAGGCTCAAAATAAAAGG + Intergenic
1193054483 X:77135847-77135869 ACACATAGGCTCAAAATGAAAGG - Intergenic
1193146351 X:78080233-78080255 ACACATATGCTCAAAATAAAAGG - Intronic
1193198511 X:78660938-78660960 GCATATAGGTATAACATGAAGGG - Intergenic
1193243228 X:79197485-79197507 ACATATAGGCTCAAAATAAAGGG + Intergenic
1193315851 X:80064414-80064436 ACATATAGGCTCAAAATAAAGGG - Intergenic
1193355755 X:80519063-80519085 ACACATAAGCTCAAAATGAAGGG - Intergenic
1193364953 X:80621291-80621313 ACACATATCCACAAAATAAAAGG - Intergenic
1193475086 X:81954207-81954229 ATATATATATATAAAATAAAAGG - Intergenic
1193515637 X:82459021-82459043 TCATATATGCATAAAACTATGGG + Intergenic
1193621769 X:83761615-83761637 ACATAAATGCATAAATTTCAGGG - Intergenic
1193671656 X:84394863-84394885 ACATATAGGCTGAAAATAAAGGG - Intronic
1193783503 X:85732399-85732421 ACATATAGGCTCAAAATAAAAGG - Intergenic
1193817035 X:86117190-86117212 ACATATAGGCTCAAAATAAAAGG - Intergenic
1193884845 X:86971761-86971783 ACATATAGGCTCAAAATAAAAGG + Intergenic
1193968080 X:88014448-88014470 AAATAAATAAATAAAATGAAAGG + Intergenic
1194007890 X:88519865-88519887 ACACATAGGCTCAAAATGAAAGG - Intergenic
1194193742 X:90867243-90867265 ACACATATGCTCAAAATAAAGGG + Intergenic
1194323756 X:92483842-92483864 ACATATTTACGTTAAATGAATGG - Intronic
1194446153 X:93989035-93989057 ACACATAGGCTCAAAATGAAAGG + Intergenic
1194480883 X:94422599-94422621 ACATATAGACTGAAAATGAAGGG - Intergenic
1194677619 X:96813392-96813414 ACACATAGGCTTAAAATAAAGGG - Intronic
1194898195 X:99471063-99471085 ACCCATATGCTTAAAATAAAGGG + Intergenic
1194963093 X:100257746-100257768 ACATATAGGCTCAAAATAAAAGG + Intergenic
1195053447 X:101120083-101120105 ACATACATGCAAATATTGAAAGG + Intronic
1195152156 X:102083173-102083195 ACATAAAGGCATTAAATTAATGG - Intergenic
1195261257 X:103133653-103133675 ACATATAGGCCCAAAATAAAGGG + Intergenic
1195580057 X:106491693-106491715 ACACATAGGCTTAAAATAAAAGG - Intergenic
1195586341 X:106569078-106569100 ACATATTGGCTCAAAATGAAGGG + Intergenic
1195621454 X:106959906-106959928 AAATATATACAGAAAATAAAAGG + Intronic
1195826527 X:109007086-109007108 ACACATATACATTAAACGAATGG + Intergenic
1195983522 X:110604742-110604764 ACACATAGGCTCAAAATGAAGGG + Intergenic
1196252790 X:113481528-113481550 ACACATAGGCTTAAAATAAAGGG + Intergenic
1196334870 X:114520577-114520599 ACATATATACTAAATATGAAGGG + Intergenic
1196440028 X:115710858-115710880 AAGTATACGCATATAATGAAAGG + Intergenic
1196538716 X:116880098-116880120 ACATATAGACTTAAAATAAAGGG - Intergenic
1196566567 X:117212345-117212367 ACACATATGCTGAAAGTGAAGGG + Intergenic
1196600458 X:117596226-117596248 ACATATAGGCTCAAAATAAAGGG - Intergenic
1196775940 X:119337602-119337624 ACATAAATGAATAAAATATATGG + Intergenic
1197022980 X:121714302-121714324 ACACATAGGCTCAAAATGAAGGG - Intergenic
1197064057 X:122217690-122217712 TCATAATTCCATAAAATGAATGG - Intergenic
1197303811 X:124815225-124815247 ACCAATGTGCATAAAATAAAAGG + Intronic
1197319339 X:125008154-125008176 ACATATAGGCTTAAAATAAAGGG + Intergenic
1197368536 X:125597880-125597902 CTATATATGCATAAAGGGAATGG + Intergenic
1197389341 X:125841122-125841144 ACATATAGGCTCAAAATAAAAGG + Intergenic
1197399460 X:125972649-125972671 ACATATAGGCTCAAAATAAAAGG - Intergenic
1197547359 X:127841647-127841669 ACACATAGGCATAAAATTGAAGG + Intergenic
1197649229 X:129046503-129046525 ACATATAGGCTCAAAATAAAAGG + Intergenic
1197678246 X:129354075-129354097 ACACATATGCTCAAAATAAAGGG + Intergenic
1197736916 X:129857516-129857538 ACATATAGGCTCAAAATAAAGGG - Intergenic
1198147736 X:133874402-133874424 ATATATGTGCATAAAATGGAAGG - Intronic
1198489520 X:137124681-137124703 ACATATAGGCTCAAAATAAAAGG + Intergenic
1198574709 X:137997535-137997557 ACATTGATGCAAAAAATGAATGG + Intergenic
1198786140 X:140290565-140290587 ACATATAGGCTCAAAATAAAGGG - Intergenic
1199094989 X:143727437-143727459 ACACATAGGCTGAAAATGAAGGG + Intergenic
1199149468 X:144413518-144413540 ACATATATACTAAAAATAAAGGG - Intergenic
1199209185 X:145186949-145186971 ATATATATGCATGAAGAGAAAGG + Intergenic
1199399442 X:147379942-147379964 ACATATACACACAAAATTAATGG - Intergenic
1199464369 X:148119278-148119300 ATATACATGCTGAAAATGAAGGG + Intergenic
1199829035 X:151530627-151530649 ACATATATGCATACATACAAAGG + Intergenic
1199937015 X:152584158-152584180 ACATATAGGCTCAAAATAAAGGG + Intergenic
1200571012 Y:4829311-4829333 ACACATAGGCTTAAAATAAAAGG + Intergenic
1200631858 Y:5597001-5597023 ACATATTTACGTTAAATGAATGG - Intronic
1200733840 Y:6772856-6772878 ACATATAGGCTCAAAATAAAGGG - Intergenic
1200734387 Y:6778283-6778305 ACATATATTCCTAAATTGTATGG - Intergenic
1200820068 Y:7573919-7573941 ACATATAGGCTCAAAATAAAAGG - Intergenic
1201230409 Y:11858940-11858962 ACATATAGGCTCAAAATAAAAGG - Intergenic
1201249471 Y:12041635-12041657 ACACATAGGCTTAAAATAAAGGG + Intergenic
1201346419 Y:12989773-12989795 ACATATAGGCTCAAAATAAAGGG - Intergenic
1201364482 Y:13188302-13188324 ACAAATAGGCACAAAATAAAGGG + Intergenic
1201418668 Y:13774579-13774601 ACATATAGGCTCAAAATGAAAGG - Intergenic
1201449692 Y:14098149-14098171 ACACATAGGCTTAAAATAAAAGG - Intergenic
1201450317 Y:14104400-14104422 ACAGATAGGCTTAAAATAAAAGG + Intergenic
1201462486 Y:14241583-14241605 ACATATAGGCTCAAAATAAAGGG + Intergenic
1201466284 Y:14284417-14284439 ACATATAGGCTCAAAATAAAGGG + Intergenic
1201570493 Y:15408375-15408397 ACACATAGGCTTAAAATAAAAGG + Intergenic
1201588552 Y:15588857-15588879 ACATATAGGCTCAAAATAAAAGG - Intergenic
1201595716 Y:15666610-15666632 ACATATAGGCTCAAAATAAAGGG - Intergenic
1201615039 Y:15887570-15887592 ACACATAGGCTTAAAATAAAAGG + Intergenic
1201682016 Y:16656482-16656504 AAATAAATAAATAAAATGAAAGG + Intergenic
1201684491 Y:16685456-16685478 ACATATAGGCTCAAAATAAAGGG + Intergenic
1201690988 Y:16764310-16764332 ACACATAGGCTTAAAATAAAGGG + Intergenic
1201919361 Y:19217822-19217844 ACATATAGGCTCAAAATAAAAGG - Intergenic
1202077457 Y:21051633-21051655 ACACATAGGCTTAAAATAAAAGG - Intergenic
1202079117 Y:21065878-21065900 ACACATAGGCTTAAAATAAAAGG + Intergenic
1202170982 Y:22043183-22043205 ACACATAGGCTTAAAATAAAGGG + Intergenic
1202220380 Y:22543190-22543212 ACACATAGGCTTAAAATAAAGGG - Intergenic
1202322733 Y:23652473-23652495 ACACATAGGCTTAAAATAAAGGG + Intergenic
1202328706 Y:23721933-23721955 GCACATTTGCATAAAAAGAAAGG + Intergenic
1202542065 Y:25948121-25948143 GCACATTTGCATAAAAAGAAAGG - Intergenic
1202548040 Y:26017583-26017605 ACACATAGGCTTAAAATAAAGGG - Intergenic