ID: 1117645545

View in Genome Browser
Species Human (GRCh38)
Location 14:57848239-57848261
Sequence AGTCAAATGCTGAATGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 191}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117645545_1117645554 9 Left 1117645545 14:57848239-57848261 CCACCCTCATTCAGCATTTGACT 0: 1
1: 0
2: 1
3: 17
4: 191
Right 1117645554 14:57848271-57848293 TTCACCCTGGCAAAGGGCAGAGG 0: 1
1: 0
2: 0
3: 25
4: 333
1117645545_1117645549 2 Left 1117645545 14:57848239-57848261 CCACCCTCATTCAGCATTTGACT 0: 1
1: 0
2: 1
3: 17
4: 191
Right 1117645549 14:57848264-57848286 ACCTCCCTTCACCCTGGCAAAGG 0: 1
1: 0
2: 1
3: 24
4: 222
1117645545_1117645548 -4 Left 1117645545 14:57848239-57848261 CCACCCTCATTCAGCATTTGACT 0: 1
1: 0
2: 1
3: 17
4: 191
Right 1117645548 14:57848258-57848280 GACTATACCTCCCTTCACCCTGG 0: 1
1: 0
2: 0
3: 8
4: 89
1117645545_1117645551 3 Left 1117645545 14:57848239-57848261 CCACCCTCATTCAGCATTTGACT 0: 1
1: 0
2: 1
3: 17
4: 191
Right 1117645551 14:57848265-57848287 CCTCCCTTCACCCTGGCAAAGGG 0: 1
1: 0
2: 0
3: 14
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117645545 Original CRISPR AGTCAAATGCTGAATGAGGG TGG (reversed) Intronic
901174324 1:7287732-7287754 AGGCAAATGCTGCATCAGAGTGG + Intronic
907898359 1:58714626-58714648 AGACAAATGCTGTGTGAGAGAGG + Intergenic
911773140 1:101773178-101773200 AGAGAAATGCTGAGTGAAGGGGG + Intergenic
913983578 1:143545293-143545315 ACACAATTGGTGAATGAGGGTGG - Intergenic
914339874 1:146750969-146750991 ATTCAAAGGCTGAGTGGGGGAGG - Intergenic
915951332 1:160191570-160191592 AGACAAATGGGGAATTAGGGAGG - Intronic
916249630 1:162724421-162724443 AGTCTCATGCTAAATGAGGAAGG + Intronic
916287543 1:163126911-163126933 TGTCAGATGCTGGAAGAGGGTGG + Intronic
916860586 1:168800372-168800394 AGAAAAATACAGAATGAGGGAGG + Intergenic
917189860 1:172403570-172403592 AGTCAAATGCTCATGCAGGGTGG - Intronic
918357569 1:183719977-183719999 AGAGAAAAGCTGAATGAAGGTGG + Intronic
918917259 1:190659299-190659321 AGTAAAATGTTGAATAATGGAGG - Intergenic
919337330 1:196253339-196253361 AGTTAAATACTGGATGGGGGTGG - Intronic
919572581 1:199267520-199267542 AGCCAACAGCTGAATGAGGCTGG + Intergenic
920421770 1:205839489-205839511 AGTTAAATGCAGATTTAGGGTGG + Intronic
921619632 1:217311491-217311513 ATTCATATGCTGAATGAATGTGG + Intergenic
922900645 1:229133975-229133997 AGTCAAGTGCAGAGTGAAGGGGG - Intergenic
923629002 1:235637321-235637343 AGTCAAACGCTGGAAGATGGGGG + Intronic
1063877150 10:10492127-10492149 AGTCAAGTGCTTAATGATGTTGG - Intergenic
1065148130 10:22793586-22793608 TGTCAAATGGTAAATGAGGAGGG - Intergenic
1065502693 10:26397786-26397808 AATCAGAATCTGAATGAGGGTGG - Intergenic
1069951664 10:72022968-72022990 ACTCAATTGCTGAATGACAGGGG + Intergenic
1071409751 10:85377496-85377518 TGTCAAATGAAAAATGAGGGCGG + Intergenic
1073524026 10:104162697-104162719 AGCCAAATTCTGAAGGATGGGGG + Intronic
1074364518 10:112847211-112847233 AGTCAAAAACTTACTGAGGGAGG - Intergenic
1074979272 10:118606618-118606640 ACTCAGATGCCAAATGAGGGTGG - Intergenic
1077225386 11:1437148-1437170 AGTCCCATGCTGAATTTGGGAGG + Intronic
1078693574 11:13606585-13606607 AGTCAGATGTGGAATGAGGGTGG - Intergenic
1079882018 11:25940501-25940523 AATCAAATTGTTAATGAGGGTGG - Intergenic
1080885341 11:36362839-36362861 AGGCAAATGCTGCATGGGTGGGG + Intronic
1081329175 11:41783264-41783286 ACTAAAATGCTGAAAGAGAGAGG - Intergenic
1081634279 11:44710615-44710637 AAACAAATGCTGAGGGAGGGAGG - Intergenic
1082933023 11:58628835-58628857 AGTCAAAGGCTTAATGGGGGGGG - Intergenic
1083332459 11:61905326-61905348 GGCCACATGCAGAATGAGGGAGG + Intronic
1083774161 11:64885076-64885098 TGTCAGATGCTGAAGGAAGGTGG - Intronic
1086145077 11:83542807-83542829 AGTCATATGCTGTATGTGTGGGG - Intronic
1086171329 11:83839889-83839911 AGTCAAAACCTGAATTAGAGGGG - Intronic
1090157155 11:124451703-124451725 AGTACAATGTTGAATGAGAGTGG - Intergenic
1092424833 12:8366493-8366515 AGTGAAATGATGAGTGAAGGTGG - Intergenic
1092526810 12:9314532-9314554 GGGCAAAGGCTGAGTGAGGGAGG + Intergenic
1092540461 12:9417247-9417269 GGGCAAAGGCTGAGTGAGGGAGG - Intergenic
1093301272 12:17460021-17460043 AGTTAAATGCTGAATAAAGAAGG + Intergenic
1094394201 12:29987879-29987901 AGTAAAATGATGGATAAGGGGGG + Intergenic
1095815208 12:46414192-46414214 GGTCAAATCATGAATCAGGGAGG - Intergenic
1101963061 12:109264492-109264514 GGTCAAATGCTGCAGGAGGTGGG + Intronic
1102326872 12:111993251-111993273 AGTGAAATGCTGTATGCAGGTGG + Intronic
1102948888 12:117014983-117015005 AGTCACATGCTGCATGGTGGCGG - Intronic
1103619697 12:122179399-122179421 TGTCAAAAGCTGAATCAGGCCGG - Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1104017436 12:124970522-124970544 AGTGGAAGGCTGAATGAGGGAGG - Intronic
1105282205 13:18972782-18972804 AATCAAATACACAATGAGGGTGG + Intergenic
1105477025 13:20737022-20737044 AGTCAAATGGTGACTGGGCGTGG - Intronic
1107566351 13:41609277-41609299 AGGCATATGCAGAATGAGGTCGG - Intronic
1110746888 13:79064519-79064541 AGGCAGATTCTGACTGAGGGAGG + Intergenic
1113692612 13:112322348-112322370 AGACAGATGCTGAGTGAGTGAGG + Intergenic
1114443479 14:22769938-22769960 AGTCAGTTGCAGAATGAGCGTGG + Intronic
1114459335 14:22876884-22876906 GGCCAAAGGCTGAATGAAGGAGG - Intronic
1114568310 14:23648289-23648311 ACTCATTTGCTCAATGAGGGAGG - Intergenic
1115888366 14:37999608-37999630 AGACAAATGCTGAGTGAGGCTGG + Intronic
1117645545 14:57848239-57848261 AGTCAAATGCTGAATGAGGGTGG - Intronic
1118677552 14:68204129-68204151 AGTCAAAAGCTGAATCAGGCAGG - Intronic
1119565468 14:75625273-75625295 AGTCAATTACAGGATGAGGGAGG - Intronic
1121069985 14:91009967-91009989 AGTCAAATGCAGCAAGAAGGTGG + Intronic
1122281100 14:100622895-100622917 GATCAAATGCAGAATGTGGGTGG + Intergenic
1126549145 15:49908235-49908257 AGTCAAGTTCTGAATGAGAGTGG + Intronic
1126640320 15:50818149-50818171 AGTGAAAGGCTGGAGGAGGGAGG + Intergenic
1126879174 15:53076176-53076198 AGTCAAACGCTGACTGTGGCTGG - Intergenic
1128228306 15:66018020-66018042 AGTCAAGTGGTGAATGTGAGAGG + Intronic
1129409367 15:75340371-75340393 TCTCAATTGCTGATTGAGGGAGG + Intronic
1131156155 15:90076998-90077020 AGACCAAGGCTGTATGAGGGAGG - Intronic
1131662762 15:94536328-94536350 AATCAAATGCTGAATTCAGGTGG - Intergenic
1132825065 16:1900610-1900632 AGTCAAATGTAGCATGCGGGTGG + Intergenic
1132978156 16:2720812-2720834 AATAAAATACTGAATGAGGCCGG - Intergenic
1134052947 16:11149846-11149868 AGGCAAATGATGACTGAGGAAGG - Intronic
1137740097 16:50761216-50761238 AGACAAATGACAAATGAGGGTGG - Intronic
1137863238 16:51867998-51868020 ATTCAAATTCTCATTGAGGGAGG + Intergenic
1139994417 16:70966441-70966463 ATTCAAAGGCTGAGTGGGGGAGG + Intronic
1141274259 16:82571140-82571162 AGTACAATGCTGAATAAGAGTGG - Intergenic
1143350129 17:6281957-6281979 AGTCACAAGCTGATAGAGGGTGG - Intergenic
1158952052 18:62503941-62503963 AGTCAAATGTTGCAAGAGGCCGG + Intergenic
1159100044 18:63948538-63948560 AGTCAGATACTGAATAAAGGGGG - Intergenic
1167802868 19:51756611-51756633 ACTCAAATGCTGAACTAGGCTGG - Intronic
1168190623 19:54735940-54735962 AGGGAAATGCTGAGTGAGGGAGG - Intronic
1168192845 19:54752336-54752358 AGGGAAATGCTGAGTGAGGGAGG - Intronic
1168194933 19:54767164-54767186 AGGGAAATCCTGAGTGAGGGAGG - Intronic
1168197182 19:54783606-54783628 AGGGAAATGCTGAGTGAGGGAGG - Intronic
1168200767 19:54813811-54813833 AGGGAAATCCTGAGTGAGGGAGG - Intronic
1168202980 19:54830048-54830070 AGGGAAATGCTGAGTGAGGGAGG - Intronic
1168202984 19:54830068-54830090 AGGGAAATGCTGAGTGAGGGAGG - Intronic
1168205540 19:54847871-54847893 AGGGAAATGCTGAGTGAGGGAGG - Intronic
1168208013 19:54866491-54866513 AGGGAAATGCTGAGTGAGGGAGG - Intronic
1168234034 19:55050710-55050732 AGTCACATGCTGAGGGATGGGGG + Intronic
925258536 2:2510020-2510042 GGTCAAATGCTGATAGAAGGAGG - Intergenic
925535880 2:4916103-4916125 AATAAAATGCTGAATGAGGAGGG + Intergenic
927619756 2:24641645-24641667 ATTAAAATGCTGAAGGGGGGTGG - Intronic
927662867 2:25007542-25007564 AGACAAATCCAGAATGTGGGAGG + Intergenic
927688596 2:25190941-25190963 AGAAAAATGCTGTATGAGGAAGG + Intergenic
930758686 2:55006951-55006973 AGTCAAATGCAGAGTGAGGCAGG - Intronic
936096891 2:109537075-109537097 AGTAAAATGCTGAATGTAAGGGG + Intergenic
936401944 2:112171316-112171338 AGTCAAATGGAGAAGGAGGAGGG + Intronic
937392481 2:121502446-121502468 AGTGAGATACTGTATGAGGGAGG + Intronic
938645465 2:133325819-133325841 ACTCAAATGCTGAAGTTGGGAGG - Intronic
938951551 2:136259242-136259264 AGTCAAATGCAGCCAGAGGGTGG - Intergenic
939799375 2:146689274-146689296 AATCAAATGATGAATGAGATGGG + Intergenic
940236294 2:151514313-151514335 ACTCAAATCCTCAATGAGGTAGG - Exonic
940311519 2:152284358-152284380 AGTCAAATGCAGTATGAGAAGGG + Intergenic
941191947 2:162395582-162395604 AGGCAAAGTCAGAATGAGGGTGG + Intronic
943425115 2:187721884-187721906 AGTCCTATGCTGAATGGGAGTGG + Intergenic
945496394 2:210511759-210511781 ATACAATTCCTGAATGAGGGAGG + Intronic
946963622 2:225012095-225012117 TTTCAAATTCTGAATGAGTGGGG - Intronic
947330482 2:229024600-229024622 AGTGCAATGCTGAGTGATGGGGG + Exonic
947576693 2:231280968-231280990 AGTCCAGTGCCGAAGGAGGGCGG + Intronic
948932965 2:241143926-241143948 ATTCAAATGCTGATACAGGGTGG + Intronic
1170105037 20:12745985-12746007 ATTGAAATGCTGAATCAGAGTGG - Intergenic
1170993899 20:21333002-21333024 AGTCATATGCTTTTTGAGGGGGG + Intronic
1171037988 20:21731849-21731871 AGTCAAATCCTGATTGAGGGAGG + Intergenic
1173167262 20:40694092-40694114 AGTGAAAAGGTGAATGATGGAGG - Intergenic
1173544669 20:43885873-43885895 AGGCAAAGGCAGAATCAGGGAGG - Intergenic
1174792779 20:53496016-53496038 AGTCAGCTGAGGAATGAGGGAGG + Intergenic
1175617750 20:60416367-60416389 AGTAAAATGTTGAATGGGAGTGG + Intergenic
1176909451 21:14546385-14546407 AGTCATATCCTGACTGAAGGAGG - Intronic
1177240370 21:18447689-18447711 AGACAAGTGCAGAATGAAGGAGG - Intronic
1178049339 21:28731074-28731096 AAATAAATCCTGAATGAGGGAGG + Intergenic
1178395064 21:32235751-32235773 AGTCCAATGATGGATGATGGTGG - Intergenic
951807528 3:26662906-26662928 AGTCAAATGGAGGATGAGGAAGG + Intronic
953231448 3:41068748-41068770 AGATAAAAGCTGAATCAGGGTGG - Intergenic
953385513 3:42503612-42503634 AGGCAGATGCTGATTGAGGCAGG + Intronic
955575673 3:60360206-60360228 AGTCAAAGGCTGAGTATGGGTGG + Intronic
964147554 3:153483649-153483671 AGTCAAATGCCTTATGGGGGTGG + Intergenic
965237899 3:166151017-166151039 AGTGAAATGAGGAATGTGGGAGG - Intergenic
965677430 3:171212610-171212632 AATCAAATGATAAATGTGGGTGG - Intronic
965724754 3:171703298-171703320 AGTAAAATGTTGAATGAAAGTGG - Intronic
966552206 3:181217527-181217549 AGTCTAATGCAGAATGAAGTTGG - Intergenic
967516620 3:190377007-190377029 AGTTAAGTGCTGAAGGAGTGAGG + Intronic
968178286 3:196569542-196569564 TGTCAAAAGTTGAATGAGTGAGG - Intronic
971568450 4:28177193-28177215 AGTCAAATGCAGTATGAAGGAGG - Intergenic
972070586 4:35014971-35014993 AGTCATATGCAGAATGAAGCTGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972370730 4:38420746-38420768 ACTCAAATGCTGAAAGTGGCTGG + Intergenic
973647883 4:52968321-52968343 AGTCAGAGGCTGCATCAGGGAGG + Intronic
975054875 4:69917820-69917842 TGTGAATTGCTGAATCAGGGAGG + Intergenic
976119782 4:81767207-81767229 AGTCACATTCTGAATGATGAAGG - Intronic
981844031 4:149145954-149145976 TGGCTAATGCTGAATGAGTGGGG + Intergenic
984523142 4:180824464-180824486 AGTCAAATGCTGAATATGACTGG - Intergenic
986234475 5:5894327-5894349 AGTCAATTGCTGATTGATGTGGG - Intergenic
986375063 5:7122593-7122615 AGATAAATCCTGAAAGAGGGTGG - Intergenic
989426267 5:41299634-41299656 AGTGAAATGGTGAATAAGAGAGG + Intergenic
993163062 5:84314424-84314446 AGTCAAATGCTAAATTAGAAAGG - Intronic
997014939 5:129921567-129921589 AGTGAAATGGTGGATTAGGGAGG + Intronic
997370970 5:133359740-133359762 TTTTAAAAGCTGAATGAGGGTGG - Intronic
997712475 5:136017411-136017433 AGTCAAATGATGAAAGAGAAAGG - Intergenic
998373927 5:141679382-141679404 AGTCACAAGCTGCCTGAGGGTGG + Intronic
998376039 5:141691489-141691511 GGTCAAATGCTAGATGAGGAAGG - Intergenic
998570100 5:143249391-143249413 ACTAAAATGCTGAGTCAGGGAGG - Intergenic
998737968 5:145164670-145164692 TGTCTAATGCTGAAAGTGGGAGG + Intergenic
1000623818 5:163516020-163516042 AGTCAAAGGCTGAGTGCGGTGGG - Intronic
1005579918 6:27224015-27224037 ACTAAAATGCTGATTGAGGCTGG + Intergenic
1008496333 6:52137730-52137752 ATTCAATTGCTGCATGAGGATGG + Intergenic
1008596336 6:53045722-53045744 AGTGAAATAATGAATGATGGAGG - Intronic
1009339843 6:62541019-62541041 AGTCAACTGATGATTGAGGAGGG + Intergenic
1010267638 6:73884981-73885003 AGCAACATGCTGAATGATGGAGG + Intergenic
1010945209 6:81966040-81966062 ATTCAACTGCTGAATAAGGTTGG + Intergenic
1013206337 6:107949195-107949217 AATCAAATACTGAAAGAGGTGGG + Intronic
1014699104 6:124661405-124661427 AAAGAAAGGCTGAATGAGGGTGG - Intronic
1015098174 6:129442169-129442191 ATTCAAATGCTGTTTGAGTGGGG + Intronic
1015241535 6:131029369-131029391 AAACAAATGCTGAAGTAGGGTGG - Intronic
1016979424 6:149840690-149840712 AGTCAAGTGCTGACTCTGGGAGG - Intronic
1017285994 6:152677110-152677132 AGTGAAAACCTGAGTGAGGGTGG + Intergenic
1019941975 7:4298934-4298956 AATAAAATGCTGATTTAGGGGGG - Intergenic
1020607891 7:10360771-10360793 AGAGAAGTGCTGAATGAAGGGGG - Intergenic
1021693718 7:23255305-23255327 AGACAAATGCTGACTGGGCGCGG - Intronic
1022913101 7:34919446-34919468 AGGCAAAGGCTGAAGCAGGGAGG + Intergenic
1023733602 7:43215813-43215835 TGTCAAATGCTGAAGGAGTTAGG + Intronic
1024822154 7:53344398-53344420 AGTCTAGTGCTGAAGGAGGCAGG - Intergenic
1033254990 7:139792755-139792777 CATCAAAGGATGAATGAGGGAGG + Intronic
1034854035 7:154523723-154523745 AGTCAAGTGCGGAATGCAGGAGG - Intronic
1037070878 8:14647232-14647254 AGGTAAATGCTGAAGGAGTGTGG - Intronic
1037474102 8:19239249-19239271 TGTCAAATCCTGAATGAAGAGGG + Intergenic
1038545312 8:28421671-28421693 GCACAAATGCTGAATGAAGGTGG + Intronic
1040298454 8:46175543-46175565 ACTCAAATGGTCAATGAGGAAGG + Intergenic
1041951814 8:63511413-63511435 AGTCAATTGATCAATTAGGGTGG - Intergenic
1042081942 8:65063388-65063410 AGTTATATTCTGAATGAGGAAGG + Intergenic
1044506045 8:93020733-93020755 AATCAGATGCTGACTGAGGAGGG + Intergenic
1044672222 8:94693930-94693952 AGTGAAAAGCTGAAGGAAGGTGG + Intronic
1046789082 8:118301386-118301408 ATTAAAATGCTCACTGAGGGTGG + Intronic
1048038488 8:130701226-130701248 AGTGAAATTGTGAATAAGGGGGG - Intergenic
1049234124 8:141502072-141502094 AGTCTAATGTTGAATGAGAGAGG - Intergenic
1050856670 9:10365978-10366000 AGTCAAATGCAGAATGGTGTAGG + Intronic
1051084005 9:13326402-13326424 TGTCAAATTCTAAATTAGGGGGG - Intergenic
1053227785 9:36376073-36376095 AATCAAAGACTGAATGAGAGAGG + Exonic
1054745740 9:68852468-68852490 AGTCAAACCCTTAAGGAGGGAGG + Intronic
1056286073 9:85089084-85089106 AGACAAATACAGAATGAGTGGGG - Intergenic
1056333098 9:85538024-85538046 ACTCAAAGGCTGAATGAGTCAGG + Intergenic
1056709197 9:88976993-88977015 AGGCAAACGCTTAAGGAGGGGGG + Intergenic
1057521822 9:95766342-95766364 AGTCAATTTCTGCAAGAGGGTGG + Intergenic
1057784101 9:98073761-98073783 AATCAATTAATGAATGAGGGTGG - Intronic
1059553789 9:115257719-115257741 TGCCAAAAGCTGAAGGAGGGTGG + Intronic
1059599152 9:115757427-115757449 AAACATATGCTGAATGAGTGAGG - Intergenic
1059820169 9:117963747-117963769 AGTCAACCTCTGAATGAGGCGGG + Intergenic
1060384891 9:123216084-123216106 AGTTGAATGCAGAATAAGGGTGG - Intronic
1060921693 9:127424782-127424804 ACTCAAATGCTGGAGGAAGGAGG + Exonic
1061629658 9:131864074-131864096 ACTCATATGCTGATTGACGGCGG - Intronic
1186213724 X:7277031-7277053 AATCTCATGCTGAATGAGGTAGG + Intronic
1189118774 X:38371062-38371084 AGTCAACTTCTGAAGGATGGGGG - Intronic
1189169864 X:38898505-38898527 AGTCAAAGGCAGAAAGAGGAAGG + Intergenic
1190431068 X:50378426-50378448 AGTAAAGTGCTGACTGAGGTTGG - Intronic
1197944229 X:131821442-131821464 GGTCAAATGCTAACTGAGTGAGG + Intergenic
1199602769 X:149552447-149552469 AAGCAAATGCTGAGTGAAGGAGG - Intergenic
1199647620 X:149927028-149927050 AAGCAAATGCTGAGTGAAGGAGG + Intergenic
1199807234 X:151312372-151312394 TGGTAAATGCTGAATGAGTGAGG + Intergenic