ID: 1117648028

View in Genome Browser
Species Human (GRCh38)
Location 14:57872948-57872970
Sequence ATGCTGTGATTGGTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 205}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117648028_1117648038 21 Left 1117648028 14:57872948-57872970 CCCTGCTCCACCAATCACAGCAT 0: 1
1: 0
2: 0
3: 23
4: 205
Right 1117648038 14:57872992-57873014 AAGCCAAGTGGAGAAATCCTGGG 0: 1
1: 0
2: 1
3: 12
4: 217
1117648028_1117648032 -3 Left 1117648028 14:57872948-57872970 CCCTGCTCCACCAATCACAGCAT 0: 1
1: 0
2: 0
3: 23
4: 205
Right 1117648032 14:57872968-57872990 CATCCATTCCAAATTTTGAATGG 0: 1
1: 0
2: 1
3: 24
4: 226
1117648028_1117648033 -2 Left 1117648028 14:57872948-57872970 CCCTGCTCCACCAATCACAGCAT 0: 1
1: 0
2: 0
3: 23
4: 205
Right 1117648033 14:57872969-57872991 ATCCATTCCAAATTTTGAATGGG 0: 1
1: 0
2: 1
3: 19
4: 262
1117648028_1117648037 20 Left 1117648028 14:57872948-57872970 CCCTGCTCCACCAATCACAGCAT 0: 1
1: 0
2: 0
3: 23
4: 205
Right 1117648037 14:57872991-57873013 GAAGCCAAGTGGAGAAATCCTGG 0: 1
1: 0
2: 0
3: 24
4: 247
1117648028_1117648036 9 Left 1117648028 14:57872948-57872970 CCCTGCTCCACCAATCACAGCAT 0: 1
1: 0
2: 0
3: 23
4: 205
Right 1117648036 14:57872980-57873002 ATTTTGAATGGGAAGCCAAGTGG 0: 1
1: 0
2: 0
3: 18
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117648028 Original CRISPR ATGCTGTGATTGGTGGAGCA GGG (reversed) Intronic
901600738 1:10421599-10421621 AAGCTGTGAGTGGTGGAGTTTGG + Intergenic
902952274 1:19894860-19894882 AAGCGGTGAGTGGTGGAGCAGGG - Intronic
903250336 1:22048789-22048811 ATGCTGTGATTGGCCAAGCCTGG + Intergenic
903372413 1:22845159-22845181 ATGCAGTGAGTGGTAGAGGAGGG - Intronic
903884235 1:26531649-26531671 TTCCTGGGATTGGTGGGGCAGGG + Intronic
904730517 1:32587488-32587510 ATGCTGTGATTGGCTGGGCGTGG + Intronic
904752574 1:32750079-32750101 ATGGTGGGGTTGGAGGAGCAGGG + Intronic
906859153 1:49340543-49340565 ATGCTCTGATTCTTGGAGTAAGG - Intronic
908074629 1:60502625-60502647 ATGATGTGATGGGTGGAGATGGG - Intergenic
908468704 1:64420820-64420842 ATATTGTCATTGGTGGGGCAGGG - Intergenic
909753675 1:79195810-79195832 ATGCTGGGATTGGCGGTTCATGG + Intergenic
911064939 1:93779843-93779865 ATCCTGGGATTGGGGGAGGAGGG - Intronic
912320623 1:108709358-108709380 ATCCAGTGATTGGTGGATAAAGG - Intergenic
913295187 1:117312375-117312397 ATGCTGTGGTGGGTGGAGTGGGG - Intergenic
913461140 1:119087048-119087070 GTGGTGTGTGTGGTGGAGCATGG - Intronic
913522303 1:119656389-119656411 ATGCTGTGAAAGGTGGGACAGGG + Intergenic
914342992 1:146776192-146776214 ATGATGTGATAGTAGGAGCAGGG - Intergenic
914417379 1:147496384-147496406 ATGGTGTGTTTGGTGGATGAAGG + Intergenic
916454205 1:164953778-164953800 TTGCTGTGAGTTGTGGAGCCTGG + Intergenic
920060322 1:203222777-203222799 ATGCTGTACTTTGAGGAGCAAGG + Intronic
920288707 1:204901093-204901115 AGGCTGTGTGTGGTGGGGCAGGG + Intronic
920497242 1:206463946-206463968 ATGCCATGAGGGGTGGAGCAGGG - Exonic
921247652 1:213261586-213261608 AGCCTGTGATTGGTGGAGTTTGG + Exonic
922665885 1:227468542-227468564 ATGCTCTGTTTGGTGGTGTAAGG + Intergenic
924909574 1:248496517-248496539 ATGCTGTGGTGGAGGGAGCAGGG + Intergenic
924914528 1:248551543-248551565 ATGCTGTGGTGGAGGGAGCAGGG - Intergenic
1063657610 10:8007969-8007991 ATGCTGTTAGTGGAGGAGCAGGG + Intronic
1065909183 10:30286739-30286761 CTCCTGTGAGGGGTGGAGCATGG - Intergenic
1068614029 10:59091884-59091906 GTGCTGTTATTGTTGGAGCAAGG + Intergenic
1068804519 10:61180230-61180252 ATGCTCTGATTTGATGAGCAAGG - Intergenic
1070285987 10:75084115-75084137 CTGGTGTGATTGGGGGAGGAAGG - Intergenic
1070965248 10:80526407-80526429 AAGCTGTGGTTGGTGGGGGATGG + Exonic
1076162139 10:128253105-128253127 ATGCTTTGACTGCTGGCGCAAGG + Intergenic
1077441592 11:2571546-2571568 GTGCTGGGATGGGTGGAGCAGGG + Intronic
1079131987 11:17752152-17752174 ATGTTGAGCTTGGTGGAGCCTGG + Intronic
1079441969 11:20524081-20524103 AAGCTGAGAGTGGTGGATCACGG - Intergenic
1081796893 11:45826658-45826680 ATTCTGTGGGTGGTGGTGCATGG - Intergenic
1083161346 11:60856101-60856123 AAGCGGGGATGGGTGGAGCAGGG - Intergenic
1083751301 11:64762273-64762295 AAGCTGTGCTTAGTGGAGGATGG - Intergenic
1084044457 11:66560693-66560715 ATGTAGGGATTGGTGGAGCAGGG - Exonic
1084181470 11:67448732-67448754 AGCCTGTGAGTGGTGGAGCCAGG + Intergenic
1089875700 11:121719706-121719728 ATGCTGTCATTGGAGAACCAGGG - Intergenic
1091760542 12:3084437-3084459 ATGGTGTAGTCGGTGGAGCAGGG + Intronic
1101167757 12:102055631-102055653 AAGCTTTGATGGGTGGGGCACGG - Intronic
1101725023 12:107381707-107381729 ATGGTGTGGTGTGTGGAGCATGG + Intronic
1102362942 12:112304062-112304084 ATGCTGGGATTGGAGGAGTGGGG + Intronic
1104573671 12:129947042-129947064 ATGTTGTGATTGGCTGGGCATGG - Intergenic
1108586416 13:51874001-51874023 TGCCTGTGATTGGTGGAGCCTGG - Intergenic
1108890399 13:55251183-55251205 ATTCTGGGATGGGTGGAGGAGGG + Intergenic
1109024092 13:57138838-57138860 ATTGTGGGATGGGTGGAGCAGGG + Intergenic
1109791708 13:67257405-67257427 ATGCAGTCATTGATGGAGTAAGG - Intergenic
1111638890 13:90942266-90942288 ATGTTGAGACTGGTGGACCAGGG - Intergenic
1111785628 13:92783265-92783287 ATGGTGTGATTGGTTGATAATGG - Intronic
1112900705 13:104353879-104353901 ATGCTGAGAGTGGTGGGGAAGGG + Intergenic
1112931236 13:104740898-104740920 ATGCTGTGCTTGCTGGGACAGGG + Intergenic
1113640433 13:111953345-111953367 GTCCTGTGATTGGTGGCTCAGGG - Intergenic
1115161435 14:30400103-30400125 ATGCTGTCAATGATGTAGCATGG - Intergenic
1117648028 14:57872948-57872970 ATGCTGTGATTGGTGGAGCAGGG - Intronic
1117850286 14:59960665-59960687 AAGCTGTAAGTGGTAGAGCAAGG + Intronic
1117858338 14:60060366-60060388 ATGCTGTGGCTGATGGATCAAGG + Intronic
1117999562 14:61510461-61510483 ATGATGTGGTTGGGGGACCAAGG + Intronic
1120531470 14:85637578-85637600 TTGCTGTCATTGCAGGAGCATGG - Exonic
1121529451 14:94641967-94641989 ATGCTGTGATGGGTGGGGCTAGG - Intergenic
1122609295 14:102970302-102970324 CTGCTGTAACTGGTGAAGCAGGG - Intronic
1123151302 14:106184412-106184434 AGGCTGTGCATGGTGAAGCAGGG + Intergenic
1123399708 15:19972298-19972320 AGGCTGTGCATGGTGAAGCAGGG + Intergenic
1126665829 15:51075706-51075728 ATGCTGTAATTTTTGGAGGATGG + Intronic
1126705474 15:51401539-51401561 AAGCTGTGATTGCTGGAGGTAGG + Intronic
1127708813 15:61574808-61574830 ATGCACTGATAGGTTGAGCAAGG + Intergenic
1129113951 15:73354523-73354545 ATGCTGAGACTGCTGGTGCAGGG + Intronic
1129119856 15:73389682-73389704 ATGCGGGGGTTGGGGGAGCAGGG - Intergenic
1129207370 15:74045067-74045089 ATGCTGTGATGGGTGGGGCCTGG - Exonic
1129501774 15:76045772-76045794 AGGCTGGGAAGGGTGGAGCAGGG + Intronic
1129964103 15:79718449-79718471 ATGTGGTTAATGGTGGAGCAAGG + Intergenic
1130871736 15:87977483-87977505 ATGCTGGGATGGATGGAGCCTGG + Intronic
1131955447 15:97730468-97730490 GGGCTGTGAATGGGGGAGCAAGG - Intergenic
1132884581 16:2177012-2177034 CTGCTGTGAGTGGGGGGGCATGG + Exonic
1133963363 16:10513477-10513499 ATGCTGTGATCACTGGGGCAAGG + Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1138297885 16:55902239-55902261 AGGCTGTGATCCATGGAGCATGG + Intronic
1138371605 16:56531304-56531326 AGGCTGGGATTGATAGAGCAGGG - Intergenic
1139990994 16:70939136-70939158 ATGATGTGATAGTAGGAGCAGGG + Intronic
1141622443 16:85243626-85243648 ATGTTGTGAGTGGAGGAGCACGG + Intergenic
1142044587 16:87917260-87917282 AGGCTCTGATTGGTCCAGCATGG - Intronic
1142971940 17:3618067-3618089 ATGCAGTGATTTGTGAATCATGG - Intronic
1143019895 17:3911859-3911881 ATGCCCTGATTGGAGGAGCCTGG - Intronic
1143865569 17:9920527-9920549 AGACTGTGATTTGTGTAGCAAGG - Intronic
1146788155 17:35735729-35735751 GTTCTATGATTGGAGGAGCAGGG + Intronic
1146790949 17:35750240-35750262 GTGCTGTGTTTGCTGGAGCTGGG - Exonic
1148165645 17:45482462-45482484 ATGCTTTCAGTGGTGGAGAATGG - Exonic
1148469573 17:47884881-47884903 CAGCTGGGTTTGGTGGAGCAAGG - Intergenic
1150053372 17:61988130-61988152 ATACTGTTAGTGGTGGAGCTGGG - Intronic
1150396871 17:64829186-64829208 ATGCTTTCAGTGGTGGAGAATGG - Intergenic
1150613628 17:66752612-66752634 ATGCTGCGATTCTTGGAGCCAGG + Intronic
1151036302 17:70804556-70804578 ATTCTGAGACTGCTGGAGCAGGG - Intergenic
1151538467 17:74751736-74751758 ATCCTGTGACTGGTGGTGAATGG - Intronic
1153747920 18:8199294-8199316 ATGCAGTGATCAGAGGAGCAGGG + Intronic
1154387762 18:13911116-13911138 CTGCGGTGATTGCTAGAGCAAGG + Intronic
1155855216 18:30825679-30825701 ACCTTGTAATTGGTGGAGCAGGG + Intergenic
1156506604 18:37599796-37599818 AGGCTGTGATGGCTGGAGCTGGG - Intergenic
1158513992 18:58115953-58115975 TTGATGTTATTGGAGGAGCAAGG + Intronic
1158887513 18:61842415-61842437 CTGCTGTCATTGCTGGAACAAGG + Intronic
1159920741 18:74225339-74225361 TAGCTGTGACTGGTGGAACAGGG + Intergenic
1160759599 19:776557-776579 GTCCTGTGATTGCTGGAGCCCGG - Intergenic
1163461635 19:17441530-17441552 ATGCTCTGATTGGCTGAGCTTGG - Intronic
1166712525 19:44946353-44946375 ATTCTGTGATTTGTGGAGTGTGG - Intronic
1166949563 19:46417445-46417467 ATTCTGTGATGGCTGGAGAAGGG - Intergenic
1167198656 19:48048751-48048773 AAGCTGTTATTGCTGGATCAGGG - Intronic
1168247313 19:55118906-55118928 ATGCTGGGATTGGTGGTCCCGGG + Intergenic
1168463278 19:56580254-56580276 ATGCTTTGAGTGTTGGAGGAAGG + Exonic
927617084 2:24609472-24609494 AGGCTGGGTGTGGTGGAGCAGGG + Intronic
927981377 2:27377150-27377172 ATGCTGTGATGGGGGAAGCAGGG - Intronic
928367033 2:30710698-30710720 AGGCTTTGATGGGTGGAGGAGGG - Intergenic
929072766 2:38050296-38050318 CTGGTGAGATTGGTGCAGCAGGG - Intronic
931323074 2:61191535-61191557 AGGCTGTGACTGGTAGACCAAGG - Intronic
932518316 2:72378286-72378308 CAGCTGGGATTGGTGGAGCAAGG - Intronic
937350627 2:121158587-121158609 ATGAGGTGAGTGGGGGAGCAGGG - Intergenic
937500717 2:122475731-122475753 AAATGGTGATTGGTGGAGCATGG - Intergenic
940088909 2:149894675-149894697 AGCCAGTCATTGGTGGAGCAGGG + Intergenic
940776911 2:157894315-157894337 ATGCTATCATTGGTCTAGCAGGG - Intronic
940904160 2:159153769-159153791 GTTCTGTGATTGCTGGAGTAGGG + Intronic
941087959 2:161140909-161140931 ATGCTGTGAGTGGTGGGGGTAGG - Intronic
1169804530 20:9545712-9545734 AGGCTTTGAATGGAGGAGCAAGG - Intronic
1170113304 20:12828689-12828711 ATGCTGTGTTTGGGGCAGGATGG + Intergenic
1170719057 20:18859455-18859477 CTACTGTGACTGGTAGAGCAGGG - Intergenic
1170777503 20:19390603-19390625 ATGCTGAGTTTGCTGGACCATGG + Intronic
1171517022 20:25746128-25746150 ATTTTGGGAATGGTGGAGCAGGG + Intergenic
1172145575 20:32755571-32755593 TTTCTGTCATTGGTGGAGGAGGG - Intergenic
1173035414 20:39404457-39404479 ATGCTGCAACTGGTGGAGGAAGG + Intergenic
1173579049 20:44133074-44133096 ATGGTGTGATGACTGGAGCAGGG - Intronic
1176253448 20:64138138-64138160 ATGCTGGGATAGATGGGGCAGGG + Intergenic
1178073439 21:28993762-28993784 ATTCTGTGATTGTTGGAAAAAGG - Intergenic
1178151423 21:29798895-29798917 ATGCTGTGTTTGGTGGAGGTAGG + Intronic
1178974912 21:37213230-37213252 ATGCTGAGGTGGGTGGATCATGG - Intergenic
1182335227 22:29579716-29579738 ATGCTGTGGTTGGTCGGGTATGG - Intronic
1182436427 22:30333472-30333494 ATGCTGTGGGTGTTGGAGGAAGG - Exonic
1183594165 22:38799929-38799951 ATGCGGAGGATGGTGGAGCAGGG + Intergenic
1184108532 22:42382420-42382442 AGGCTGTGGGAGGTGGAGCAGGG + Exonic
950106954 3:10394460-10394482 CAGCTGTGAGTGGTGGAGCCGGG + Intronic
950175599 3:10871843-10871865 ATGCAGAAATTGGTGGTGCAGGG + Intronic
950234349 3:11305644-11305666 ATTCTTTTATTGGAGGAGCATGG + Intronic
950843045 3:15986605-15986627 AGGCTGTGTATGGAGGAGCATGG - Intergenic
951727325 3:25774636-25774658 ATGGTGCTATTGGTGGAGCATGG - Intronic
952207830 3:31198198-31198220 ATACAGTGATAGGTGGGGCATGG - Intergenic
953280285 3:41548144-41548166 AGGCTATGGTGGGTGGAGCAAGG - Intronic
954073453 3:48159671-48159693 ATGCTAGGATTGTTGGAGAAAGG - Intronic
955882296 3:63560357-63560379 AAGCTGTGATTGGGGAAGTAAGG + Intronic
956604983 3:71064990-71065012 GGGTTGTGATTGGTGGAGCAGGG - Intronic
956852703 3:73245452-73245474 AGGCTGGAATTGGAGGAGCAAGG - Intergenic
958947943 3:100385163-100385185 TTGACTTGATTGGTGGAGCAAGG - Intronic
959620837 3:108397232-108397254 ATGCTGAGATAGGTGGGGCCAGG - Intronic
960693238 3:120369395-120369417 ATGCTGTGATTGGTAGATGATGG - Intergenic
962737867 3:138341787-138341809 ATGTTGTGATTGGTAGACAAAGG - Intergenic
963247776 3:143078422-143078444 ATGCTGTGATTGGTGGTTGCAGG + Intergenic
966328016 3:178778872-178778894 ATGCTGTGATTGGTTATGAATGG + Intronic
969038263 4:4273552-4273574 CTGCTGTCATTTGAGGAGCACGG - Intronic
969849984 4:9948447-9948469 CTGCAGTGAATGGTGGTGCATGG + Intronic
972733125 4:41814540-41814562 AAGCAGTAATTGGTGGAGCCAGG - Intergenic
973330578 4:48907001-48907023 CGGCTGTGATTGCTGGAGGAAGG - Intergenic
973734863 4:53861593-53861615 ATGCTGTGTTGGGTGGTTCAAGG - Intronic
975550096 4:75603895-75603917 ATCCTGTGTTTGCTGGAGTAAGG - Exonic
976146655 4:82047981-82048003 TTCCTGTCATTGGTAGAGCAAGG + Intergenic
980097695 4:128510299-128510321 ATGCTGGGAAGGTTGGAGCAAGG + Intergenic
980459972 4:133096911-133096933 ATGCTGTCAGTGGTAGAGCAGGG + Intergenic
984580212 4:181502346-181502368 ATGCTGTGGGTGGTGGAGAGGGG + Intergenic
984961100 4:185099540-185099562 ATGCTGAGGATGGTGGAGCACGG + Intergenic
989870771 5:46593323-46593345 TTGCAGCGATTGGTGGAGTATGG + Intergenic
990701429 5:58478957-58478979 ATGCTCTGATGGGTTGAGCCAGG - Intergenic
992296289 5:75330177-75330199 ATGCTGAGCATGGTGGAGCAGGG + Intergenic
994923156 5:106078581-106078603 ATACTGTGATTTGTGTTGCAAGG - Intergenic
996208444 5:120773844-120773866 ATGCATTGTTTTGTGGAGCAAGG + Intergenic
996275038 5:121655293-121655315 ATGTTGTATGTGGTGGAGCATGG - Intergenic
999192840 5:149761660-149761682 ATTCTGTCATTTGTGTAGCATGG + Intronic
1001867085 5:175115091-175115113 ATTCTGTGGGTGGTGGTGCATGG - Intergenic
1002020713 5:176362500-176362522 GAGCTATGATTGGTGGTGCAGGG + Intergenic
1003350298 6:5310962-5310984 ATGGTGGGATTGCTGGAGAAAGG - Intronic
1005202807 6:23365789-23365811 AGGCTGTTAGTGGTTGAGCAAGG - Intergenic
1006591663 6:35162485-35162507 TAGCTGTGAATGGTGGAGCTTGG - Intergenic
1007374918 6:41449982-41450004 CTGCTGAGTTTGGTTGAGCAAGG + Intergenic
1009774394 6:68186921-68186943 AAGATGTGATTGATGGAGCAAGG + Intergenic
1015924954 6:138299256-138299278 AATCAGTGATTGGTGGAGCTGGG + Intronic
1015924960 6:138299340-138299362 AATCAGTGATTGGTGGAGCTGGG + Intronic
1017141186 6:151191459-151191481 ATGCTGGGATGGGTGGTGGAGGG + Intergenic
1021653336 7:22852602-22852624 GTGCTGTGATTGGTGTTGGAGGG - Intergenic
1021783271 7:24127639-24127661 AGGCTGTGATTTTTGTAGCATGG + Intergenic
1022393727 7:29966256-29966278 TTGCTCTGACCGGTGGAGCATGG - Intronic
1022743806 7:33149164-33149186 AGGCTTTCATTGATGGAGCAGGG + Intronic
1022814193 7:33898414-33898436 AGGCTGTGATTGGCCCAGCATGG + Intergenic
1024248739 7:47490528-47490550 CTGCTGTGAGTGGTGGAATATGG + Intronic
1024342426 7:48280952-48280974 AACCTGAGATTGGTGGAGAATGG - Intronic
1024616929 7:51123606-51123628 AGGCTGTGAATGATGGAGCAGGG + Intronic
1025641212 7:63371663-63371685 ATGTTGAGATTGGTGGAAAAAGG - Intergenic
1028397289 7:90384804-90384826 ATGGTTTGATTTGTGAAGCAGGG - Intronic
1028717675 7:93991691-93991713 ATAGTGTGAATGGTGGAGCCAGG + Intronic
1028907745 7:96173944-96173966 AAGATGTCATGGGTGGAGCAAGG + Intronic
1030084632 7:105805968-105805990 ATGCTGAGCTTGCTGGAACAAGG + Intronic
1030658962 7:112199138-112199160 ATACTGTAAATGGTGGAGCTAGG - Intronic
1033971956 7:147052450-147052472 ATTCTTTTATTGGTGGAACAGGG + Intronic
1034458053 7:151182208-151182230 ATGCTGGGACTGGAGGAGGAAGG + Intronic
1036682635 8:10886578-10886600 CTGCAGAGATTGGTGGTGCAGGG + Intergenic
1036946086 8:13096159-13096181 ATGGTGGGATCTGTGGAGCAGGG - Intronic
1037594431 8:20343136-20343158 CTCCTGTGAATGGTTGAGCATGG - Intergenic
1037600340 8:20388623-20388645 ATACTGTTCTTTGTGGAGCAGGG + Intergenic
1039001674 8:32988114-32988136 ATGCTGTGATTTGGGGATCCAGG + Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1042409210 8:68443069-68443091 AGCCTGTGGTTGGTGGAACATGG + Intronic
1045555439 8:103210183-103210205 AGGCTGTAATTGGTGGAGGAAGG + Intronic
1047107030 8:121743958-121743980 ATGCTGAGATTGGCCGGGCACGG + Intergenic
1047768509 8:128010888-128010910 CTGCTGTGATTTCTGCAGCATGG + Intergenic
1048541347 8:135344772-135344794 GTTTTGTGATTGGTGGGGCAAGG - Intergenic
1051585502 9:18722696-18722718 ATGATCTGAATGGTGGACCAGGG + Intronic
1055205615 9:73726961-73726983 ATGCTGTGGTTGGTGCCTCACGG + Intergenic
1056076625 9:83048149-83048171 GGGCTGTGATTGATGGAGGAGGG - Intronic
1057247335 9:93467808-93467830 ATTCTGTTATGGGTGGAGGAAGG + Intronic
1058629521 9:106972315-106972337 CTGCAGTGAGGGGTGGAGCAGGG - Intronic
1059605371 9:115829057-115829079 ATACTGTGATTGGTGGATTAGGG - Intergenic
1062378432 9:136275348-136275370 ATCCTGTGATGCGGGGAGCAGGG + Intergenic
1187566501 X:20454718-20454740 ATGCTGTTGTTGCTGGACCATGG + Intergenic
1188040968 X:25369545-25369567 ATGGGGAGATGGGTGGAGCAAGG + Intergenic
1190246683 X:48695564-48695586 ATGCTGTGATTCGAGCAGCGTGG - Exonic
1191222353 X:58003041-58003063 ATGCTGAGCTTGGTGGGGCAAGG + Intergenic
1191979328 X:66908683-66908705 ATGCAGTAAGTGGTGGAGCAGGG - Intergenic
1192194967 X:69021854-69021876 AACATGTGATTGGGGGAGCAGGG + Intergenic
1193685009 X:84567451-84567473 ATTATTTGATTGGTGGAGGAGGG - Intergenic
1199269283 X:145864138-145864160 ATGCTTTCAGTGGTGGGGCAGGG - Intergenic
1199601944 X:149546301-149546323 GTGCTGTGAGTGGTGGGGCTGGG - Intronic
1199648442 X:149933183-149933205 GTGCTGTGAGTGGTGGGGCTGGG + Intronic
1199946448 X:152672376-152672398 GAGCTGGGATTGGTGGATCATGG - Intergenic
1201270056 Y:12245783-12245805 GGGCTGTGATTGATTGAGCAAGG - Intergenic