ID: 1117649688

View in Genome Browser
Species Human (GRCh38)
Location 14:57890289-57890311
Sequence ACCTACACTTCAGCTAGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117649688_1117649689 -3 Left 1117649688 14:57890289-57890311 CCAAATCTAGCTGAAGTGTAGGT 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1117649689 14:57890309-57890331 GGTCAACCCGCAGACCCAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 57
1117649688_1117649690 -2 Left 1117649688 14:57890289-57890311 CCAAATCTAGCTGAAGTGTAGGT 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1117649690 14:57890310-57890332 GTCAACCCGCAGACCCAAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117649688 Original CRISPR ACCTACACTTCAGCTAGATT TGG (reversed) Intronic
904364028 1:29999251-29999273 ACCCACCCTTCAACCAGATTAGG + Intergenic
909101318 1:71352826-71352848 ACCTTCTCTTCACTTAGATTTGG + Intergenic
916934335 1:169612072-169612094 ACCTGCCATTCAGCTAGATTGGG - Intronic
923900876 1:238325176-238325198 AATTACACTTCAGGCAGATTAGG - Intergenic
924329788 1:242930089-242930111 AACTACAGTTCAGAGAGATTAGG + Intergenic
924542124 1:244991082-244991104 ACTCACACTTCAGTTAGATGTGG + Intronic
1064214700 10:13390636-13390658 AACTACTCTTCAGCTTGTTTAGG - Intergenic
1064864310 10:19861746-19861768 AGCTCCACCTCAGCTAGAGTTGG + Intronic
1069654689 10:70079156-70079178 AACAACACTTCTGTTAGATTAGG - Intronic
1086830350 11:91554526-91554548 ACCTACATTTCATCCAGATGAGG - Intergenic
1087817114 11:102671541-102671563 TCATCCACTTCAGCTCGATTTGG + Intergenic
1090539082 11:127680342-127680364 ACCTCCACTTCACCTGGATATGG + Intergenic
1094173078 12:27514744-27514766 ACCCACACAACAGGTAGATTTGG - Intergenic
1096365286 12:51024055-51024077 AACTGCACTTCAACTAAATTTGG + Intronic
1099528475 12:83744186-83744208 GCCTGTACTTCAGCTAGCTTTGG + Intergenic
1101728952 12:107410800-107410822 ACCTTCAATTCAGCTAGCCTAGG - Intronic
1102774366 12:115505913-115505935 ACCTACACTTCACAGGGATTGGG - Intergenic
1103051145 12:117780983-117781005 AGCTACAATTCAGTGAGATTTGG - Intronic
1106823772 13:33495044-33495066 GCCTACACTTCCGCTAGCTCTGG + Intergenic
1109696714 13:65970779-65970801 ACATGCATTTCAACTAGATTTGG + Intergenic
1109700373 13:66017265-66017287 ATCTACCCTTCAGAGAGATTTGG - Intergenic
1114383875 14:22236900-22236922 GACTACTCTTCAGCTCGATTAGG - Intergenic
1115078831 14:29425191-29425213 ACCTTCACTTCAACTTCATTAGG - Intergenic
1116142184 14:41011457-41011479 ACTTTCACTTTATCTAGATTAGG + Intergenic
1116232760 14:42238417-42238439 ACCTACAAGTCAGAGAGATTGGG - Intergenic
1117649688 14:57890289-57890311 ACCTACACTTCAGCTAGATTTGG - Intronic
1129638683 15:77351433-77351455 ATTTACACTTCAGCTATAATAGG + Intronic
1131790162 15:95955907-95955929 ACCTACACTACAGGTTTATTGGG - Intergenic
1140671016 16:77279313-77279335 ACCTACCCATCACCTACATTAGG + Intronic
1147773493 17:42883986-42884008 AACTACAATTCAGAGAGATTAGG + Intergenic
1149368150 17:55966116-55966138 ACCTACACAGCAGCAAGACTTGG - Intergenic
1156123743 18:33877904-33877926 ATCTATACTTCATCTAGACTTGG + Intronic
1159419415 18:68197337-68197359 AGCTACACTTCAGATTCATTTGG + Intergenic
1159680398 18:71343059-71343081 TCACACTCTTCAGCTAGATTTGG + Intergenic
1164218903 19:23175296-23175318 ATCTACACTGCAGCAAGACTTGG + Intergenic
929621383 2:43358415-43358437 ACCTGCTCTTCAGCCACATTGGG - Intronic
929827597 2:45321471-45321493 ACCTACATGGCAGCTACATTGGG - Intergenic
932522845 2:72431747-72431769 ATCAACACTTCATCTACATTAGG + Intronic
933629011 2:84635328-84635350 ACATATACTTCACGTAGATTTGG - Intronic
935402326 2:102673555-102673577 ACCCACTCTTCAGGTAGATTTGG - Intronic
937259912 2:120578667-120578689 ACCTGGCCTTCTGCTAGATTGGG - Intergenic
937777951 2:125803616-125803638 ACCTACAGTTCAGCATGGTTGGG + Intergenic
943691341 2:190872461-190872483 ACATACCCTTCAGCTAGATCTGG - Intergenic
944283144 2:197921941-197921963 ACCTAGAATTCTGCTAGATAGGG - Intronic
948546955 2:238739538-238739560 ACTTACACTTCAGCATGATTGGG + Intergenic
1169349231 20:4854778-4854800 ACCTTCTCTTCAGCTTGACTGGG - Exonic
1174859354 20:54076077-54076099 TCTCACACTTCAACTAGATTAGG - Intergenic
1178130315 21:29564635-29564657 TCCTTCACTTCAGATAGTTTAGG - Intronic
1180281885 22:10706787-10706809 AGCTTCACTGCAGCTAGACTTGG - Intergenic
1183106604 22:35619488-35619510 ACCTGCACCTCAGCAAGATTGGG - Intronic
1184001624 22:41678610-41678632 TCTTACACTTCAGGTAGATGAGG - Intronic
1184583466 22:45432068-45432090 AATTACACTGCAGTTAGATTAGG - Intronic
1203239126 22_KI270732v1_random:37948-37970 AGCTTCACTGCAGCTAGACTTGG - Intergenic
951244900 3:20329883-20329905 ACCTACATTTCACCTAGAGTAGG + Intergenic
956809103 3:72847323-72847345 AGCTACACTTCAGAAAGATTAGG + Intronic
959551134 3:107659204-107659226 ACATACTCTCCACCTAGATTTGG + Intronic
959752561 3:109855648-109855670 GCCTACACTTCAGCTCTTTTGGG + Intergenic
964464532 3:156976368-156976390 ACCTATGCTTCATCTAGTTTAGG + Intronic
965021300 3:163235409-163235431 ACCTACTCGTCATCTACATTAGG - Intergenic
967788708 3:193524245-193524267 ACCCACACTTCTGTCAGATTTGG - Intronic
979971505 4:127141419-127141441 ATCTACAAGTCAGATAGATTTGG - Intergenic
980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG + Intronic
981917641 4:150052064-150052086 GGCTATACTTCAGCTACATTGGG + Intergenic
983881129 4:172934542-172934564 ACTTACACTTCAGCTTCATCTGG + Intronic
987237674 5:15959378-15959400 ACCCAAAGTTCAGCAAGATTGGG - Intergenic
988417223 5:30960444-30960466 ACCTACAATGCAGCTATGTTGGG + Intergenic
990714202 5:58618315-58618337 ACCTACACTTTTCCTATATTTGG - Intronic
992333988 5:75746456-75746478 ACCTACAGTGCAGCTGGAGTTGG + Intergenic
992982723 5:82193230-82193252 TCCTACAGTTCATCTAGAATTGG + Intronic
1003452389 6:6247427-6247449 ATCTACTCTTCAGCCAGATTGGG + Intronic
1020025196 7:4894845-4894867 ACCTACCCTTCAACTTGTTTGGG - Intergenic
1022157304 7:27673413-27673435 GCCTACCTTGCAGCTAGATTTGG + Intergenic
1024885853 7:54141292-54141314 GCCTACACTTCTGCCTGATTTGG + Intergenic
1030287268 7:107839409-107839431 ACCCACACTTCAGCCTGATAAGG + Intergenic
1033470739 7:141646899-141646921 AGCCACACTTCAGCTAGAACAGG - Intronic
1037114233 8:15204458-15204480 ACCTATACTTCAGTCAAATTGGG + Intronic
1041712787 8:60909167-60909189 ACACACAATTCAGCTTGATTTGG + Intergenic
1042049530 8:64688570-64688592 ACTTGCACTTCAGCCAGAGTTGG - Intronic
1043686330 8:83091118-83091140 ATCTGCACTTCAGTTAGTTTTGG + Intergenic
1043686427 8:83092616-83092638 ATCTGCACTTCAGTTAGTTTTGG + Intergenic
1046466058 8:114604743-114604765 ATCAACCCTTCAGCTACATTAGG - Intergenic
1052330669 9:27264667-27264689 ACTTACATTTAAGCTATATTTGG - Intergenic
1052890201 9:33691987-33692009 AACTACAGTTCAAATAGATTAGG - Intergenic
1055982620 9:82019607-82019629 ACCTACCTTTCAGCTAGAAATGG - Intergenic
1059250710 9:112885609-112885631 ACTTACAGTACATCTAGATTTGG - Intronic
1059767181 9:117394733-117394755 GCCTACACTTCAGCCAAACTGGG - Intronic
1059971065 9:119668742-119668764 ACCAACACGTCATCTACATTAGG + Intergenic
1060017719 9:120101174-120101196 ACATACACCTGAGCTAAATTCGG + Intergenic
1191778670 X:64844919-64844941 ATCTACTCTTCAGCTTGATGAGG - Intergenic
1192162296 X:68797528-68797550 ACCCACACCTCAGCTAGAATGGG + Intergenic
1192733213 X:73822091-73822113 ACCTACACTTGAGCCACAATTGG - Intergenic
1192763081 X:74116943-74116965 ACACACACTTAAGCTAGATAAGG + Intergenic
1195742705 X:108081608-108081630 ACCCACACTTCTGTTAGACTTGG + Intergenic
1195777864 X:108427561-108427583 ACCTAAACATCAGCTACATGAGG + Intronic
1199710133 X:150463082-150463104 ATCTACATTTCACCTAAATTTGG - Intronic
1200299048 X:154953930-154953952 AGCTGCACTCCAGCTGGATTGGG + Exonic
1201227145 Y:11829214-11829236 AACTACAGTTCAGAGAGATTAGG + Intergenic