ID: 1117651359

View in Genome Browser
Species Human (GRCh38)
Location 14:57909232-57909254
Sequence CAAATATACCACTATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 5, 3: 72, 4: 396}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117651359 Original CRISPR CAAATATACCACTATGGGGT GGG (reversed) Intronic
903727731 1:25463954-25463976 CAAATGTACCACTCTGGTGGGGG - Intronic
904605035 1:31693358-31693380 CAAATATAGCATCTTGGGGTGGG - Intronic
904763896 1:32827049-32827071 CAAATGTACCACTGTGGTGTAGG - Intronic
905578777 1:39067482-39067504 CAAATGTACCACTGTAGTGTGGG - Intergenic
906585482 1:46973276-46973298 CTAATATATCACTATCGAGTAGG - Intergenic
906806372 1:48782718-48782740 CAGATATACCACTCTGGTGGGGG - Intronic
907547203 1:55272559-55272581 CAGATATACCACTCTGGTGCAGG - Intergenic
908585892 1:65567859-65567881 CAAATGTACCACTCTGAGGGGGG - Intronic
908793723 1:67810450-67810472 TAAATGTACCACTCTGGTGTGGG + Intronic
908962820 1:69721173-69721195 CAAATATAACACTCTTGTGTGGG - Intronic
909307896 1:74104861-74104883 TAAATTTACCACTGTGGTGTAGG + Intronic
909509164 1:76431781-76431803 CAAATGTACCACTCTGGGCGGGG - Intronic
909770182 1:79412340-79412362 CAAACATGCCAATATGGGGTTGG + Intergenic
910097428 1:83539347-83539369 CAAATGTACCACTCTGGTGGGGG + Intergenic
910224280 1:84920332-84920354 CTAATATACCACTCTGGTGTGGG + Intergenic
910232531 1:85001002-85001024 CAAATGTACTACTCTGGTGTAGG - Intronic
912600003 1:110920725-110920747 CAAATACACCACTATGATGGGGG + Intergenic
912677329 1:111695964-111695986 CAAATGTACCACTCTGGTGCAGG + Intronic
912823631 1:112886514-112886536 AAAAAAGACCACTATGGGCTGGG + Intergenic
913092691 1:115490283-115490305 CAAATGTACCACTCTGATGTGGG + Intergenic
913132826 1:115857620-115857642 CACATATACCACTGTGGAGGAGG - Intergenic
913462834 1:119106264-119106286 CAAATGTACCACTATGGTGTGGG - Intronic
914993990 1:152524305-152524327 CAAATGTACCACTCTGGTGGGGG - Intronic
915982785 1:160431919-160431941 CAAATGTACCACTCTGGTGGGGG + Intergenic
916305784 1:163330232-163330254 CAAATATACCACTCAGGTGAAGG + Intronic
916602744 1:166308809-166308831 AAAATGTACCACTGTGGTGTGGG - Intergenic
917616360 1:176749395-176749417 CAAATGTACCACTCTGGTGGGGG - Intronic
918557614 1:185822248-185822270 CAAATGTACCACTCTGGTGGGGG + Intronic
918646539 1:186912259-186912281 CAAATGTACCACTCTGGTGTGGG - Intronic
918892921 1:190299176-190299198 CAAATATAACAATATAGGTTAGG - Intronic
918921768 1:190720989-190721011 CAAATGTGCCACTCTGGTGTAGG - Intergenic
919102596 1:193112658-193112680 CAAAAAAACCACTGTGGGTTGGG - Intergenic
919633473 1:199981633-199981655 CAAATGTACCACTCTGGTGGGGG - Intergenic
920507748 1:206528601-206528623 CAAATGTACCACTCTGGTGGGGG + Intronic
921093014 1:211860712-211860734 CAAATGTACTACTTTGGTGTGGG - Intergenic
921453442 1:215337877-215337899 CAAATATATCAAAATGGGGGTGG - Intergenic
921537197 1:216366347-216366369 CAAATATACCACTCTGGTGCAGG + Intronic
924378236 1:243435984-243436006 CAATTATACCACTCTGGTGGTGG - Intronic
924836744 1:247656471-247656493 AAAATGTACCACTGTGGTGTGGG - Intergenic
1063023205 10:2150405-2150427 CAAATATTCCTCTTTTGGGTTGG - Intergenic
1064286207 10:13993529-13993551 AAAATATACCTCTAGGTGGTAGG + Intronic
1069796540 10:71056278-71056300 CAAATGTACCACTCTGGAGTGGG + Intergenic
1070204299 10:74241325-74241347 CAAATGTACCACTCTGGTGGGGG - Intronic
1070245286 10:74725390-74725412 CAAATATACCACTTTTGTGCAGG + Intergenic
1071674919 10:87646575-87646597 CAAATATACCACTTTGGCATAGG - Intergenic
1072169400 10:92845599-92845621 CAAATATGTCAATGTGGGGTGGG - Intronic
1072262114 10:93688545-93688567 CAAATGTACCCCTCTGGTGTGGG + Intronic
1072528122 10:96292757-96292779 CAAATGTACCACTCTGGTGGGGG - Intergenic
1072942264 10:99776731-99776753 CAAATGTACCACTCTGGTGGGGG - Intergenic
1073092865 10:100957785-100957807 CAAATATATGAGTATGGAGTAGG + Intronic
1075770662 10:124931781-124931803 CAAATATACCACTCTGTGGAAGG - Intergenic
1076098899 10:127757947-127757969 CAAATATACGCCTATGTTGTAGG + Intergenic
1078282288 11:9914874-9914896 CAAATATACCACTATGTTACAGG + Intronic
1078947644 11:16088242-16088264 CAAATATACCACTCAGGTGGGGG - Intronic
1079170319 11:18087949-18087971 CTAATGTAGCACTATGGGCTAGG + Intronic
1079949159 11:26780236-26780258 CAAAGATACCACTAGAGGCTGGG - Intergenic
1080594001 11:33752125-33752147 CAACTAGACCACTTTGGGATTGG - Intronic
1081704716 11:45175087-45175109 CAAATGTTCCACTTTGGTGTGGG - Intronic
1081839950 11:46192863-46192885 TAAATGTACCACTCTGGTGTGGG + Intergenic
1084924200 11:72498854-72498876 CAAATGTACCACTCTGGTGGGGG - Intergenic
1085753403 11:79183590-79183612 CAAATGTACCACTCTGGTTTGGG + Intronic
1085809288 11:79666063-79666085 AAAAAATCCCACTATGGGGTAGG + Intergenic
1087289587 11:96305393-96305415 CAAACATACCACTCTGGTGGAGG + Intronic
1087390586 11:97527244-97527266 TAAATGTACCACTCTGGGGCAGG - Intergenic
1088523329 11:110723728-110723750 CAAATATACCACTCTGGTGACGG - Intergenic
1088704121 11:112446244-112446266 CAAATGTACCACTCTGGTGAGGG - Intergenic
1089293505 11:117453229-117453251 AAAATAAACGACAATGGGGTTGG - Intronic
1090683474 11:129087778-129087800 CAAATGTACCACTGTGGTGTGGG + Intronic
1091464613 12:673099-673121 CAAATGTACCACTCTGGTGTGGG - Intergenic
1092499174 12:9028889-9028911 CACATATGCCACTATGGAGGAGG - Intergenic
1094321890 12:29193195-29193217 CAAATATACCACTCTTGTGTAGG - Intronic
1094581976 12:31741677-31741699 GAAATATAACACTGTAGGGTAGG + Intergenic
1094737609 12:33252859-33252881 CAAATATGCCTCTTTGGTGTAGG + Intergenic
1095522000 12:43077663-43077685 CAAATGTACCACTCTGGTGGGGG + Intergenic
1096564344 12:52464947-52464969 CAAATGTACCACTCTGGTGGGGG + Intergenic
1098069362 12:66655429-66655451 CAAATGTACCACACTGGTGTGGG - Intronic
1098137650 12:67419672-67419694 AAAATATGCCACTTTGGGATAGG - Intergenic
1098285284 12:68900995-68901017 CAAATGTACCACTCTGGTGGGGG + Intronic
1098488203 12:71046149-71046171 CAAATACACAACTCTGGGCTGGG + Intergenic
1100082819 12:90873983-90874005 CAAATGTACCACTCTGGTGGGGG + Intergenic
1100707266 12:97214904-97214926 CAAATATAACACAATAGAGTTGG + Intergenic
1102896935 12:116605750-116605772 CAAATGTACCACTCTGGGGCAGG - Intergenic
1103364808 12:120374093-120374115 CAAATGTACCACTCTGGTGGGGG - Intergenic
1106970156 13:35130105-35130127 CAAATGTACCACTCTGGTGAGGG + Intronic
1107179661 13:37444112-37444134 CAAATTTACCACTATGGACCAGG - Intergenic
1107961153 13:45560412-45560434 CAAATGTACCACTCTCAGGTGGG - Intronic
1108552798 13:51563437-51563459 CAAATGTACCACTGTGGTGGGGG + Intergenic
1109501519 13:63241937-63241959 CAAATATACTACTCTGGTGGGGG + Intergenic
1109563558 13:64080672-64080694 TAAATATACCACTCTGGTGGAGG - Intergenic
1110441146 13:75526814-75526836 CAAAAATACTACTGTGGGGTTGG + Intronic
1111454465 13:88462234-88462256 CAAATGTAGCACTTTGGTGTGGG - Intergenic
1111729740 13:92058457-92058479 AAAATGTACCACTCTGGTGTGGG - Intronic
1112911997 13:104497586-104497608 CAAATAAACCAAAATGGGATAGG - Intergenic
1112959741 13:105108841-105108863 CAAATGTACCACTTTGGTGGAGG - Intergenic
1114358604 14:21943513-21943535 CAAATGTACCACTCTGGTGGTGG - Intergenic
1114763761 14:25347620-25347642 CAAATTTGCCACTATGGTGGGGG + Intergenic
1114764833 14:25359106-25359128 CAAATGTACCACTCTGGTGGAGG - Intergenic
1114920557 14:27322560-27322582 CAAATCTACCACTCTGGTGGTGG - Intergenic
1115004167 14:28461088-28461110 TAAATGTACCACTATAGCGTAGG + Intergenic
1115064897 14:29246260-29246282 CAAATGTACTACTGTGGTGTGGG - Intergenic
1115093856 14:29611188-29611210 CAAATGTACCACTGTGGTGGGGG + Intronic
1115288070 14:31739611-31739633 CAAATAGACCACTCTGGTGGAGG - Intronic
1115536092 14:34374757-34374779 CAAAAATGCCATTATGGGGCAGG + Intronic
1115833944 14:37376136-37376158 CAAATGTACCACTCTGGTGCAGG - Intronic
1115888102 14:37996043-37996065 CAAATGTACCACTGTGGTGAAGG - Intronic
1116344121 14:43767916-43767938 CAAATATACCACCAAGGCTTTGG + Intergenic
1117226372 14:53664511-53664533 CAAATATACCACTCTGCTGGGGG + Intergenic
1117417484 14:55510562-55510584 CAAATGTACCACTCTGGTGATGG - Intergenic
1117651359 14:57909232-57909254 CAAATATACCACTATGGGGTGGG - Intronic
1117943727 14:60996070-60996092 CAAATGTACCACTCTGGTGCAGG + Intronic
1118115347 14:62770078-62770100 CTAATATACCATTGTGGGGAGGG + Intronic
1118131722 14:62973050-62973072 CAGATGTACCACTCTGGTGTGGG + Intronic
1118304320 14:64642031-64642053 CAAAAGTACCACTCTGGTGTGGG - Intergenic
1118608401 14:67520135-67520157 CAAATATACGACTCTGGTGGGGG - Intronic
1118717017 14:68567432-68567454 CAAATGTACCACTCTGGTGTGGG - Intronic
1119070822 14:71582049-71582071 CAATTATTCCACCATGGGTTGGG + Intronic
1120273452 14:82343524-82343546 TAAATATAATACTATGTGGTTGG - Intergenic
1120338140 14:83185507-83185529 CCAATGTACCACTATGGTGCAGG - Intergenic
1120837513 14:89054744-89054766 CAAATGTACCACTCTGGCGGGGG + Intergenic
1121150530 14:91629563-91629585 CAAATGTACCACTTTGGTGTGGG + Intronic
1123482900 15:20651042-20651064 CAAATATACTACTCTGGTGAGGG - Intergenic
1124530997 15:30506429-30506451 CAAATGTACCACTCTGGTGTGGG + Intergenic
1124701854 15:31920929-31920951 CAACTATACCACTAAGGTGCAGG - Intergenic
1124767658 15:32501266-32501288 CAAATGTACCACTCTGGTGTGGG - Intergenic
1125991161 15:44109592-44109614 CAAATGTACCACCGTAGGGTGGG - Intronic
1126408342 15:48345946-48345968 CAAATATACCACCCTGGTGGGGG - Intergenic
1126632734 15:50754223-50754245 CAAATGTACCACTCTGCTGTGGG - Intronic
1127888460 15:63225634-63225656 CAAAGACACCAGTATGGAGTAGG + Intronic
1128023177 15:64411351-64411373 CAAATGTACCACTCTGGTGAGGG + Intronic
1128546119 15:68569088-68569110 CAAATGTACCACTTTGGTGGGGG - Intergenic
1129047986 15:72753954-72753976 CAAATGTACCACTCTGGTGCAGG + Intronic
1129929421 15:79397935-79397957 CAAATATACCACTCTGGTGCAGG - Intronic
1132401763 15:101513497-101513519 CAAATGTACCACCATGGTGGGGG - Intronic
1135449573 16:22545573-22545595 CAAATGTACAACTTTGGGGGGGG - Intergenic
1135880721 16:26253226-26253248 CAAATGTACCAGTAAGGGATAGG - Intergenic
1137692621 16:50440145-50440167 CAAATGTACCACTCTGGTGGGGG + Intergenic
1138267332 16:55669053-55669075 CACATATACCCCTATGTGATAGG + Intronic
1138841492 16:60513869-60513891 CAAATATACTACTCTGGTATGGG - Intergenic
1138983742 16:62301531-62301553 TAAATGTACCACTCTGGTGTGGG - Intergenic
1139249156 16:65478172-65478194 TAAATGAAGCACTATGGGGTAGG - Intergenic
1139499959 16:67354706-67354728 CAAATGTACCACTCTGGGGCAGG - Intronic
1139837480 16:69850912-69850934 CAAATGTACCACTCTGGTGGGGG - Intronic
1140709274 16:77661374-77661396 CAAATATACCATTCTAGTGTGGG - Intergenic
1140835111 16:78786849-78786871 AAAATTTACCACTTTGGGGCTGG + Intronic
1141336489 16:83160229-83160251 CAAATGTACCACTCTGGTGGGGG + Intronic
1141466499 16:84209322-84209344 CAAATGTACCACCATGGTATGGG - Intergenic
1142785499 17:2218867-2218889 CAAATGTCCCACTCTGGTGTGGG + Intronic
1143711243 17:8736642-8736664 CAAATATGCCTCTTTGGGGAAGG + Intronic
1144162669 17:12577037-12577059 CAACTCTACCACTTTGGGGGTGG + Intergenic
1145290328 17:21539765-21539787 CAAATATAACACTGTGTTGTGGG + Intronic
1146085381 17:29823581-29823603 CCAATATTCCACACTGGGGTCGG + Intronic
1146412450 17:32598443-32598465 CAAAAATTCCACCATGGGGTGGG - Intronic
1148387791 17:47247394-47247416 CAAATGTACCACTCTGGTGGGGG + Intergenic
1149132545 17:53322395-53322417 CAAATATTCCACTGTTGTGTGGG + Intergenic
1149961789 17:61117809-61117831 CAAATATACTACTCTGGTGGGGG - Intronic
1152932796 17:83118822-83118844 CAAATATACTGCAATGGGGGGGG - Intergenic
1153152386 18:2110114-2110136 CAAATGTACCACTCTTGGCTGGG + Intergenic
1154319287 18:13332359-13332381 CAAATGTACCACTGTGGTGTGGG - Intronic
1155630199 18:27884105-27884127 CAAATATACCACTCTAGTGTGGG + Intergenic
1155880676 18:31144839-31144861 CAAATATAACACCGTGGGGCAGG + Intronic
1155995360 18:32325413-32325435 CAAATATACCACTCTGGTGCAGG + Intronic
1156187635 18:34681758-34681780 CAAATATACCATTCTGGTGGAGG - Intronic
1156248555 18:35328227-35328249 CAAATATACCACTCTGGTGGGGG - Intergenic
1156950286 18:42888196-42888218 CGAATATACCACTGTGGCGGGGG + Intronic
1157072685 18:44427512-44427534 CAAACATACAACTATCGTGTAGG - Intergenic
1157341828 18:46785509-46785531 CAAATCTACCACTCAGGTGTGGG - Intergenic
1157973077 18:52293202-52293224 CAAATGTACCACTGTGGTTTGGG + Intergenic
1158500741 18:57998670-57998692 CAAATGTACTACTCTGGGGCAGG + Intergenic
1158534446 18:58295063-58295085 CAAACATACCACTCTGGTGGGGG - Intronic
1159373102 18:67554916-67554938 CAAATATACCACTCTGATGTGGG - Intergenic
1159403806 18:67973983-67974005 CAAATCCACCACTATGAAGTAGG - Intergenic
1159534413 18:69697372-69697394 CAGATATACCTCTGTGGGTTAGG - Intronic
1160461944 18:79046216-79046238 CAAATATCTCACAATGAGGTGGG + Intergenic
1162234891 19:9300986-9301008 CAAATTTACCACTCTGGTGGGGG + Intronic
1163610985 19:18301446-18301468 CATCTTTACAACTATGGGGTTGG - Intergenic
1167317198 19:48771336-48771358 CAAATAGACCTCTAGGGAGTGGG - Intergenic
925901083 2:8509975-8509997 CCAATGTACCACTTTGGGGTGGG - Intergenic
926255243 2:11188403-11188425 AAAATATACCAGTCTGGGCTGGG - Intronic
929021665 2:37559570-37559592 TAAATGTACCACTCTGGTGTAGG + Intergenic
929067009 2:37987733-37987755 CAAATGTACCACTGTGAAGTGGG + Intronic
929405157 2:41633360-41633382 CAAAGATACCACTCTGAGGCAGG + Intergenic
929503331 2:42508684-42508706 CAAATATACAACTCTGGTGAGGG + Intronic
929651472 2:43683989-43684011 TAAATGTACCACTCTGGTGTTGG - Intronic
930256799 2:49102423-49102445 CAACTAAGACACTATGGGGTTGG + Intronic
931362267 2:61587762-61587784 CAAATATACCACTATGCTGGGGG - Intergenic
931900790 2:66785656-66785678 CAAATGTACCACTCTGGTGGTGG + Intergenic
933125760 2:78603243-78603265 CTAATAAACCATTATGGGTTGGG + Intergenic
933213430 2:79597733-79597755 CAAATATACCACTATAGTACTGG - Intronic
933853130 2:86386769-86386791 CAAATGTACCACTCTGGGGCAGG - Intergenic
933864561 2:86504292-86504314 CAAATGTACCACTCTGGTGTGGG + Exonic
933865562 2:86513542-86513564 CAAATGTACCACTCTTGTGTGGG + Intronic
934100634 2:88649951-88649973 CAAATATACCACTCTGGTGTGGG - Intergenic
935051315 2:99527350-99527372 CAAATGGACCACTCTGGGGAGGG + Intergenic
935454454 2:103251057-103251079 CAAACGTACCACTCTGGGGAGGG - Intergenic
935501788 2:103849966-103849988 CAAATACACCACTCTGGTGGAGG + Intergenic
936085438 2:109464766-109464788 CACATGTACCACTTTGGTGTAGG - Intronic
936238238 2:110764689-110764711 CAAATATACCACTCTGGTGGGGG + Intronic
936829730 2:116629031-116629053 CAAATGTACCACTGTGGTATAGG + Intergenic
936919408 2:117672193-117672215 CAAATGTACCACTCTGGTGGGGG + Intergenic
939664375 2:144932671-144932693 CAAATGTACCACTCTGGTGGGGG - Intergenic
939857845 2:147382014-147382036 CAAATGTACCACTCTGGTGTGGG + Intergenic
940313017 2:152298356-152298378 CAAATGTACCGCTGTGGTGTGGG - Intergenic
940714290 2:157201912-157201934 CAAATGTACCCCTCTGGTGTGGG + Intergenic
940980369 2:159994922-159994944 CAAATGTACGACTGTGGTGTGGG + Intronic
940980423 2:159995859-159995881 TAAATGTACCACTGTGGTGTAGG - Intronic
941339173 2:164284842-164284864 CAAATGTACCACTTTGGTGCAGG + Intergenic
941956221 2:171207560-171207582 CAGATGTACCACTGTGGTGTGGG + Intronic
942895868 2:181053644-181053666 CAACTATACCACTGTAGTGTGGG - Intronic
942919022 2:181348281-181348303 CAAACATACCACTCTGGTGGGGG + Intergenic
943031999 2:182696660-182696682 CAAATCTACCACTCTGGGAGGGG + Intergenic
943287915 2:186028275-186028297 CAAATGTACCACTCTGGCGCAGG + Intergenic
944207460 2:197171736-197171758 CAAATGTGCCACTCTTGGGTGGG + Intronic
945462787 2:210130197-210130219 CAAATACACCACTCTGTTGTGGG + Intronic
945490022 2:210443730-210443752 CAAATACATCACTTTGGGGCGGG - Intronic
947093290 2:226537738-226537760 CAAATGTACCACTCTGGAGTAGG - Intergenic
947254436 2:228146206-228146228 CAAATGTACCACTATGGCTGGGG - Intronic
947273109 2:228361497-228361519 AGAATCTACCACTATGGAGTTGG - Intergenic
948512511 2:238478304-238478326 CTAATATACCACAGTGGGATAGG + Intergenic
1168867369 20:1099173-1099195 CAAATGTACCACTCTGGTGTGGG + Intergenic
1169833957 20:9856804-9856826 CAAATGTACCACTCTGGTGAGGG + Intergenic
1170008203 20:11692138-11692160 CAAAAGTACCACTGTGGTGTAGG + Intergenic
1170433645 20:16300786-16300808 CAAATATGCCACTCTGGTGTGGG - Intronic
1170670633 20:18429543-18429565 CAAATGTACCACTTGGGTGTGGG - Intronic
1170710384 20:18785521-18785543 CAAATGTATCACTCTGGTGTTGG - Intergenic
1174010910 20:47448938-47448960 CAAATATACCACTCTGGTGCAGG + Intergenic
1174690749 20:52502096-52502118 CAAAGATATCTCCATGGGGTTGG + Intergenic
1175070988 20:56333562-56333584 CAATTTAACCACTATGGGCTGGG - Intergenic
1177172035 21:17665793-17665815 CAAATGTACCACTGTGGGGCAGG + Intergenic
1177484458 21:21738919-21738941 CAAATATACCACTCTAGTGGGGG + Intergenic
1178861054 21:36290090-36290112 CAAATGTACCACTCTGGTGCAGG + Intronic
1179926150 21:44534913-44534935 CTAATATTCCACTGTGTGGTTGG - Intronic
1180935047 22:19619900-19619922 CAAATACAGCCATATGGGGTTGG - Intergenic
1182472745 22:30558568-30558590 CACCTGTACCACTGTGGGGTGGG - Intronic
1183798379 22:40140155-40140177 CAATTATACAACTATAGGATGGG + Intronic
1183798655 22:40142749-40142771 CAATTATACAACTATAGGATGGG - Intronic
949384467 3:3484956-3484978 CAGATATGCCACTAGGTGGTGGG - Intergenic
950845683 3:16013577-16013599 CAATTGTACCACTCTGGTGTGGG - Intergenic
950959246 3:17087691-17087713 CAAGTATACCACTGTGGTGCGGG + Intronic
951071706 3:18337026-18337048 CAAACATACCACTGTGGTGGGGG - Intronic
951361615 3:21731451-21731473 CAAATGTACCACTGTGGTGGAGG - Intronic
951722851 3:25720183-25720205 CAAATATACCTATAAGGAGTAGG + Exonic
951829685 3:26912231-26912253 CAAATGTACCACTGTGGTGCAGG + Intergenic
951905149 3:27698924-27698946 CAAATGTACCACTGTGGTGGGGG + Intergenic
952672765 3:35990834-35990856 CAAAAATACCAATATTGGCTGGG - Intergenic
952859915 3:37804409-37804431 CAAATGAACCACCATGAGGTTGG - Intronic
953192661 3:40702109-40702131 CAAATGTACCACTGTGGTGCAGG - Intergenic
953262970 3:41358147-41358169 CAAACACACCACAATGGAGTGGG + Intronic
954555236 3:51512489-51512511 CAAATGTACCACTCTGTTGTAGG + Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955479350 3:59373798-59373820 CAAATGTACCACTCTGGTGGGGG + Intergenic
956089167 3:65646166-65646188 CAAATATAACACTATAGGCATGG + Intronic
956327918 3:68073505-68073527 TAAATATAGCACTATGAGGGTGG + Intronic
956439356 3:69264957-69264979 CAAATATACAGATATGAGGTCGG + Intronic
956738491 3:72257077-72257099 CACATATGCCACTGTGAGGTAGG + Intergenic
957005423 3:74940209-74940231 CAAATGTACCACTCTGATGTGGG + Intergenic
959112388 3:102137245-102137267 CATATGTACCACTCTGGTGTGGG - Intronic
959219768 3:103501783-103501805 CAAATATACCATGATGGGATTGG + Intergenic
959485124 3:106919847-106919869 CAAATGTACCACTTTGGTGGGGG + Intergenic
959529953 3:107423964-107423986 CAAATGTACCAGTTTGGTGTGGG + Intergenic
960834112 3:121886734-121886756 CAAATGTGCCACTCTGGTGTGGG - Intergenic
960904555 3:122586751-122586773 CAAATGTACCACTCTGGCGCTGG - Intronic
962323606 3:134412976-134412998 CAAATGTAGCACTTTGGTGTGGG + Intergenic
963015183 3:140817217-140817239 CAAATATACCACTCTGGTGGGGG + Intergenic
963056732 3:141192414-141192436 CAAATCTACCACCAGGGGGCAGG - Intergenic
963587962 3:147217472-147217494 CAAATATACCACTCTGGTGTGGG + Intergenic
964361297 3:155899558-155899580 CAAATGTATCACTCTGGTGTGGG - Intronic
964637156 3:158870526-158870548 CAAACAGATCAGTATGGGGTTGG + Intergenic
964662876 3:159140102-159140124 CAAATGTACCACTCAGGTGTGGG - Intronic
965029494 3:163346497-163346519 CAAATGTACCACTCTGGTGTAGG + Intergenic
965114587 3:164471887-164471909 CAAATATACCACTCTGGAGAGGG - Intergenic
965181689 3:165412147-165412169 CAAATGTACCACTCTGATGTGGG + Intergenic
965641524 3:170833760-170833782 CAAATGTACCACTCTGGTGGGGG - Intronic
965848827 3:172996603-172996625 CAAATATACCACTCTGGTGAGGG - Intronic
966399367 3:179532682-179532704 CAAATATACCACTCTGGTGTGGG - Intergenic
967110910 3:186293074-186293096 CAAATGTACCACTCTGGTGGGGG - Intronic
967765721 3:193277472-193277494 TAAATATTCCACTCTTGGGTGGG - Intronic
968227351 3:196981873-196981895 CAAATGTACCACTCTGGTGCAGG + Intergenic
970140995 4:12981906-12981928 CAGATATAACACTGTGGGGGAGG - Intergenic
970496108 4:16627850-16627872 CACATATTCCACTGAGGGGTGGG + Intronic
970633776 4:17984117-17984139 CTAATACACCACTATCAGGTAGG - Intronic
971425883 4:26515021-26515043 CAAACATACCACTTTGGTGGGGG - Intergenic
971597564 4:28550960-28550982 CAAATGTACCCCTTTGGGGCTGG - Intergenic
971639701 4:29116656-29116678 CAAATTTACCACTCTGGTGGGGG - Intergenic
971752779 4:30672567-30672589 CAAATGTACCACTGTGGTGAGGG + Intergenic
972460933 4:39301475-39301497 CAGATATACCACTGTGGTGGGGG + Intronic
972807263 4:42542067-42542089 CAAATGTACCACTCTGGTGGGGG + Intronic
972911915 4:43827674-43827696 CAAATATACCATTCTAGTGTAGG + Intergenic
973134885 4:46695068-46695090 CAAATATACCACTCTGCTGCAGG - Intergenic
974068835 4:57105811-57105833 CAAATACATCATTTTGGGGTGGG + Intronic
974670936 4:65029081-65029103 CAAATATGCCACTCTGGTGGGGG - Intergenic
974843565 4:67324448-67324470 CAAATATACCACTCTGGTGAGGG + Intergenic
975400979 4:73939363-73939385 CACATATGCCACTATGGAGGAGG - Intergenic
975795809 4:78006334-78006356 CAAATACACCACTCTGGAGTGGG + Intergenic
975977110 4:80112112-80112134 CAAATATACTACTCTGGTGGGGG + Intronic
976133406 4:81908994-81909016 CAAATGTACCACTCTGGTGCAGG + Intronic
976231095 4:82843870-82843892 CAAATACACCACTGTGGCGTAGG + Intronic
976818701 4:89180254-89180276 CAAATGTACCACTCTGGTGTGGG - Intergenic
977003835 4:91540183-91540205 CAAATGTACCACTGTGATGTGGG - Intronic
977473597 4:97474128-97474150 CAAATGTACTACTATGGTCTAGG + Intronic
977763358 4:100767130-100767152 CAAATGTACCACTCTGGTGAAGG + Intronic
977822196 4:101486068-101486090 CAAATGTACCACTGTGGTGCAGG - Intronic
978033012 4:103958987-103959009 CAAATGTACCACTGTGGTGGGGG + Intergenic
978129547 4:105178610-105178632 CAAATATACCACTCTGGTATGGG + Intronic
978525932 4:109665057-109665079 TAAATATACCAGTCTGGTGTGGG - Intronic
979706674 4:123727884-123727906 CAAATGTACCACTCTGGTGCAGG - Intergenic
979830373 4:125293209-125293231 CAAATTTACCACTCTGGTGGAGG + Intergenic
979991243 4:127378337-127378359 CAAATGTACCACTCTGGTGGGGG - Intergenic
980600029 4:135010943-135010965 CAAATGTACCACTCTGGTGGGGG - Intergenic
980668129 4:135966966-135966988 CAAATGCACCAATCTGGGGTGGG - Intergenic
981486397 4:145291121-145291143 CAAATGTACCACTCTGGTGTGGG - Intergenic
981523063 4:145684643-145684665 CAAATGTACCACTGTGGTGGGGG + Intronic
982330309 4:154174999-154175021 CAAATGTACAACACTGGGGTAGG - Intergenic
982716359 4:158812690-158812712 CAAATATATCACTGTGGTGTGGG - Intronic
982807310 4:159782463-159782485 CAAATGTACCATTGTGGTGTGGG - Intergenic
983074793 4:163312780-163312802 CAAATGTTCCACTCTGGTGTGGG - Intergenic
983110709 4:163745966-163745988 CAAATGTACCACTCTGGTGGGGG - Intronic
984100126 4:175474313-175474335 CAAATGTACCACTCTGGTGGGGG + Intergenic
984114640 4:175664380-175664402 CAAATGTACCACTCTGGTGAGGG + Intronic
984404587 4:179311537-179311559 CAAATGTACCACTGTGGTGCGGG - Intergenic
984636492 4:182115989-182116011 CAAATGTACCACTGTGTTGTGGG - Intergenic
985225204 4:187752612-187752634 CAAATGTACCACTTTGGAGAGGG - Intergenic
985929877 5:3048818-3048840 GAAAAATACCAGTGTGGGGTGGG + Intergenic
986531734 5:8744128-8744150 CAAATGCACCACTGTGGTGTGGG - Intergenic
986581919 5:9274372-9274394 AAAATATCCCACTATCGTGTAGG - Intronic
987196705 5:15534124-15534146 CAAACATACCACTCTGGTGGGGG - Intronic
987915898 5:24213964-24213986 CAAATATACCACCATGGAGGTGG - Intergenic
987934697 5:24449188-24449210 CAAATGTACCACTCTGGTGTGGG - Intergenic
988845216 5:35120505-35120527 AGGATATACCATTATGGGGTGGG + Intronic
988845226 5:35120539-35120561 AGGATATACCATTATGGGGTGGG + Intronic
989277342 5:39604693-39604715 CAAATCTACCACTCTGGTGCAGG - Intergenic
989776886 5:45219649-45219671 CAAATACACCACTCTGTGGGGGG + Intergenic
990173601 5:53082622-53082644 CAAATATACCACTCTTGTGCGGG - Intronic
990301403 5:54452730-54452752 CAAATGTACCACTTTGAGGCTGG + Intergenic
991688301 5:69201960-69201982 CAAATGTGCCACTTTGGTGTAGG + Intronic
992226269 5:74622079-74622101 CAAATGTACCACTCTGGGCTGGG - Intergenic
992495009 5:77283291-77283313 CAAATGTACCACTCTGGTGGGGG - Intronic
992723056 5:79579451-79579473 CAAATATACCTGTATGAGTTGGG - Intergenic
995466488 5:112454565-112454587 CAAATGTACCACTCTGGTGGGGG - Intergenic
995638055 5:114218771-114218793 CTAATATACCACTCTTGTGTGGG + Intergenic
996114074 5:119599189-119599211 AAAATATACCACTTTGATGTAGG - Intronic
996752166 5:126899870-126899892 CACATGTACCACTGTGGTGTGGG - Intronic
997058356 5:130471251-130471273 CAAATATACCACTCAGGTGGGGG - Intergenic
999077476 5:148810322-148810344 CAAATATACCTCTTTGGTGTGGG - Intergenic
999305585 5:150517433-150517455 CAAATTTACCACTCTGGGTTGGG - Intronic
999713091 5:154335774-154335796 CAAATGTACCACTATGGTATGGG - Intronic
1002973412 6:2048902-2048924 CCAAAATACCAATATGGGGATGG + Intronic
1005453520 6:25997003-25997025 TAAAAATAACACTATGGGCTGGG - Intergenic
1005728811 6:28675866-28675888 CAAATGTACCACTTTGGTGCAGG + Intergenic
1005823168 6:29614868-29614890 CAAATGTACCACTCTGGCGGAGG + Intronic
1006873144 6:37271465-37271487 CAAATGTACCACTGTGGTGGCGG + Intronic
1006992629 6:38228451-38228473 CAAATGTACCACTCTGGTGGAGG + Intronic
1007954035 6:45900357-45900379 CAACTATACAGCTATAGGGTAGG - Exonic
1009293770 6:61917682-61917704 CAACTATACCACTGTGGTGCAGG + Intronic
1010375534 6:75164686-75164708 CAAATGTACCACTTTGGTGAAGG - Intronic
1010476078 6:76289074-76289096 CAAAAATAGCTCTTTGGGGTGGG - Intergenic
1010828676 6:80503960-80503982 CAAATATACCACTCTGGTGCAGG + Intergenic
1011350508 6:86417915-86417937 CAAATGTACCACTTTGGTGGAGG - Intergenic
1011798099 6:90979857-90979879 AAAATATCCCCCTATGGGTTTGG + Intergenic
1012090228 6:94883477-94883499 CAAATATACCACTCTAGTCTGGG - Intergenic
1012320911 6:97844409-97844431 CAAATACACCACTCTGGTGAGGG - Intergenic
1012418311 6:99034060-99034082 CAAATGTACCACTCTGGTGGGGG + Intergenic
1012822448 6:104103194-104103216 CAAATGCACCACTCTGGGGCAGG + Intergenic
1013532737 6:111034974-111034996 TAAAAATAAAACTATGGGGTTGG + Intergenic
1013799932 6:113931175-113931197 CAAGAAAATCACTATGGGGTTGG + Intergenic
1014121743 6:117733920-117733942 TAAATGTACCACTTTGGTGTGGG - Intergenic
1014819947 6:125977013-125977035 CAAATATACCACCGTGGTGTAGG - Intronic
1015199351 6:130561778-130561800 CAAATATTCCACTTTGGTGGGGG - Intergenic
1016079808 6:139842264-139842286 AACACATACTACTATGGGGTAGG - Intergenic
1016101401 6:140105644-140105666 CAAATGTACCACTCTGGTGGGGG - Intergenic
1016221337 6:141673993-141674015 CAAATGTACCTCTCTGGTGTGGG + Intergenic
1016222644 6:141693783-141693805 CAAATGTACCACTCTGGTGGGGG + Intergenic
1020544735 7:9512770-9512792 CAAATGTATCACTCTGGTGTGGG - Intergenic
1021087890 7:16445185-16445207 CAAATGTACCACTTTGGTGCAGG + Intergenic
1021481514 7:21122688-21122710 CATATAAACCACTGTGAGGTGGG - Intergenic
1021643685 7:22766126-22766148 CAAATTTACCACTGTGGTGGGGG - Intergenic
1022420813 7:30221709-30221731 CGAATGTACCACTCTGGTGTGGG + Intergenic
1022480059 7:30737179-30737201 CAAATGTACCACTCTGGTGGGGG - Intronic
1022689097 7:32628402-32628424 CAAATGTACCACTCTGGTGCGGG + Intergenic
1022916675 7:34962803-34962825 CAAATGTACCACTCTGGTGCGGG + Intronic
1022987497 7:35672134-35672156 CAAATGTACTACTTTGGTGTGGG + Intronic
1023473251 7:40548626-40548648 CAAATGTACAACTCTGGGGGTGG - Intronic
1023524579 7:41086326-41086348 CAAATGTACCACTCTGGATTGGG - Intergenic
1026944958 7:74309901-74309923 TAAATATACCACTTTGGGCCAGG + Intronic
1027714150 7:81648239-81648261 CAAATGTACCACTCTGTGGGAGG + Intergenic
1027982049 7:85237240-85237262 CAAATTTATCACTATGGTTTGGG - Intergenic
1028194652 7:87892045-87892067 CAAATGTACCACTCTGGTGTGGG - Intronic
1028264191 7:88703096-88703118 CCAAGATATCACTTTGGGGTAGG + Intergenic
1028599587 7:92587855-92587877 CAAATGTACCACTCTGGTGAAGG + Intronic
1028770182 7:94610399-94610421 CAAATATACCACTCTGGTGGGGG + Intronic
1029178384 7:98681856-98681878 CAAATGTGCCACTTTGGGGACGG - Intergenic
1030049548 7:105525510-105525532 CAAATGTACCACTTTGGTGAGGG + Intergenic
1031045582 7:116883590-116883612 CAAAAGTACCACTAAGGGTTGGG - Intronic
1031447069 7:121867928-121867950 CAAATGTACCACTTTGATGTGGG + Intergenic
1032178452 7:129653398-129653420 CAAATGTACCACTCTGGTGCAGG - Intronic
1033095466 7:138426675-138426697 CAAATGTACCATGATGGTGTGGG - Intergenic
1035963380 8:4162697-4162719 CAAATGCACCACTCTGGCGTGGG - Intronic
1036641745 8:10589076-10589098 CAAATGCACCACTCTGGGGTGGG + Intergenic
1036667662 8:10758097-10758119 CAAATGTACCACTCTGGTGGGGG - Intronic
1037231044 8:16659340-16659362 CAAAAGTACCACTCTGGGGCAGG + Intergenic
1037708630 8:21337549-21337571 CAAATATCCCACTATGGTTGTGG + Intergenic
1038604514 8:28985887-28985909 CAAAGGTACCACTCTGGGGCTGG - Intronic
1039095789 8:33883550-33883572 TAAATGTACCACTCTGGTGTGGG + Intergenic
1039163109 8:34644722-34644744 CAGATATACCACTCTGGTGGGGG - Intergenic
1039586125 8:38708568-38708590 CAAATATACCCCTGTGGTGAGGG + Intergenic
1039862938 8:41474806-41474828 CAAATGTACCATTCTGGTGTGGG - Intergenic
1039925132 8:41923171-41923193 CAAATGTACCACTGTGGAGGAGG + Intergenic
1040004842 8:42611208-42611230 CAAATGCACCACTGTGGTGTGGG + Intergenic
1040040566 8:42912705-42912727 CAAATATACCATTGTGGTGGGGG - Intronic
1040430005 8:47330310-47330332 CAAATATACCATTCTGGTGGGGG - Intronic
1041804775 8:61837973-61837995 CAAATATACCACTTTGGACCAGG - Intergenic
1041941582 8:63393897-63393919 CAAATGTCCCACTCTGGTGTGGG - Intergenic
1042208877 8:66357566-66357588 CAAATATACCACTCTAGTGTGGG - Intergenic
1042780769 8:72488919-72488941 TAAATGTACCACTCTGGTGTGGG + Intergenic
1043103799 8:76082717-76082739 CAAAAATACAACTATGGGACAGG + Intergenic
1043589166 8:81807951-81807973 CACATATGCCACTGTGGGGGAGG + Intronic
1043642906 8:82479294-82479316 CAAATGTACCACTCAGGTGTAGG + Intergenic
1044074962 8:87809280-87809302 CAAAAATACCACTCTGGTGAAGG + Intergenic
1045037614 8:98188158-98188180 CAAATGTACCACTCTGGTGGGGG + Intergenic
1045350920 8:101338886-101338908 AAAATGTACCACTCTGGTGTGGG - Intergenic
1046054746 8:109065929-109065951 CAAATGTTCCACTCTGGGGAGGG - Intergenic
1046227457 8:111302716-111302738 CAAATGTACCACTCTGGTGGAGG + Intergenic
1046534563 8:115492530-115492552 CAAAAATAACTCTATGGGGTGGG + Intronic
1047046530 8:121059280-121059302 CAAATATACTGCTGTGGTGTGGG + Intergenic
1048994211 8:139781664-139781686 CAAATGTACCACTCTAGTGTGGG + Intronic
1051442183 9:17097106-17097128 CAAGTATACTACTTTGGTGTGGG - Intergenic
1051570644 9:18554823-18554845 CAAATGTACCACTCTGGGACAGG - Intronic
1051797817 9:20893819-20893841 CAAATATACCACTCTGGTGGGGG - Intronic
1052166574 9:25337773-25337795 CAAATGTACCACTTTGGTGCGGG + Intergenic
1052500858 9:29287902-29287924 CAAATAAACCAATTTAGGGTTGG + Intergenic
1052582542 9:30377482-30377504 CAAATTTACCACTCTGGTGGAGG + Intergenic
1052783872 9:32810817-32810839 CAAATGTACCACTCTGGTGGGGG + Intergenic
1053142952 9:35692383-35692405 CAAATATACTAATACGGTGTGGG + Intergenic
1055049690 9:71965726-71965748 TAAAAATACTACTATTGGGTGGG - Intronic
1057462453 9:95275535-95275557 CAAATGTACCACTCTGGTGGGGG + Intronic
1058772720 9:108252619-108252641 CAAATGTACCACTCTGGTGAGGG + Intergenic
1060769058 9:126317687-126317709 CAAATGTACCACTCTGGTGGTGG + Intergenic
1061581810 9:131542180-131542202 CAAATGTACCACTCTGGTGTGGG - Intergenic
1186423728 X:9446981-9447003 AAAATATACAACTTTGGGCTGGG + Intergenic
1186631155 X:11350225-11350247 CAAATATGTAACTATGGGGCTGG + Intronic
1186699542 X:12075298-12075320 CAAATGTACCACTCTGGTGAAGG + Intergenic
1187061866 X:15794337-15794359 CAAATTTTCCACTGTGGGGAGGG - Intronic
1187128138 X:16473657-16473679 CAAATGAACCACTGTGGTGTGGG + Intergenic
1187717907 X:22121886-22121908 CAGATGTAGCAGTATGGGGTGGG - Intronic
1188088576 X:25934083-25934105 CAAATGTACCACTTTGGTGGGGG + Intergenic
1188359880 X:29240160-29240182 CCTATATACTACTATGTGGTAGG - Intronic
1188502189 X:30839631-30839653 CAAACGTACCACTCTGGTGTAGG + Intronic
1188622170 X:32239475-32239497 CAAATGTACCACTCTGGTGTGGG - Intronic
1188819420 X:34755549-34755571 CAAATATACCCTTATATGGTTGG + Intergenic
1188859603 X:35241886-35241908 CAAATGTACCACTCTGGTGTGGG - Intergenic
1189411662 X:40778247-40778269 CAAATATACCACTCTGGTGGGGG - Intergenic
1189464963 X:41271619-41271641 CAAATATACCACTCTGGTGGGGG + Intergenic
1189727234 X:43979818-43979840 CAAATGTACCACTCTGGTGCAGG + Intergenic
1190617666 X:52252832-52252854 CAAATGTACTACTCTGGGGGGGG - Intergenic
1192419167 X:71013671-71013693 CAAATATACCACTCTGGTGTGGG + Intergenic
1192540418 X:71964948-71964970 CAAATGTACCACTCTGGTGCAGG + Intergenic
1194184438 X:90756491-90756513 CAAATGTACCACTCTGGTGGGGG + Intergenic
1194280277 X:91943301-91943323 CAAATGTACCACTTTGGTGGGGG + Intronic
1194669516 X:96713445-96713467 CAAATGTATCACTGTGGTGTAGG - Intronic
1194890985 X:99378388-99378410 CAAATGTACCACTTTGGTGGGGG - Intergenic
1195704306 X:107727770-107727792 CACATATACTGCTATGGGGAGGG + Intronic
1195858639 X:109357541-109357563 TAAATATAACACTACTGGGTTGG + Intergenic
1195952697 X:110292883-110292905 CAAATGTACCACTCAGGTGTGGG + Intronic
1196155565 X:112424880-112424902 AAAATGTACCACTATGGTGCAGG - Intergenic
1196661032 X:118268953-118268975 CAAATATGCCACTATGATGCGGG + Intergenic
1198134724 X:133737398-133737420 CAAATGTACCACTCTGGTGAGGG + Intronic
1198199315 X:134399435-134399457 CAAATGTACCACTCTGGTGTAGG + Intronic
1198410839 X:136365986-136366008 CAAACATACCACTCTGGTGGGGG - Intronic
1198564788 X:137893376-137893398 CAAATAGACCACTATGGTGGGGG + Intergenic
1198738486 X:139813978-139814000 CAAATGTACCATTCTGGTGTGGG + Intronic
1199999478 X:153050627-153050649 CAAATGTACCACTCTGGTGCAGG + Intergenic
1200531027 Y:4338404-4338426 CAAATGTACCACTCTGGCGGGGG + Intergenic
1200597754 Y:5166795-5166817 CAAATGTACCACTTTGGTGGGGG + Intronic
1201419660 Y:13784558-13784580 CAAATATCCCACTCTGGTGGGGG - Intergenic
1201944708 Y:19499227-19499249 CAAAGAGACCACTATGGTGTGGG - Intergenic