ID: 1117656447

View in Genome Browser
Species Human (GRCh38)
Location 14:57961130-57961152
Sequence CAGGCTGCTGTCACTTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117656445_1117656447 5 Left 1117656445 14:57961102-57961124 CCATGCTGCGACGGAGAGACGTG 0: 1
1: 0
2: 0
3: 3
4: 28
Right 1117656447 14:57961130-57961152 CAGGCTGCTGTCACTTGAGCTGG 0: 1
1: 0
2: 0
3: 18
4: 212
1117656443_1117656447 9 Left 1117656443 14:57961098-57961120 CCTCCCATGCTGCGACGGAGAGA 0: 1
1: 0
2: 1
3: 2
4: 46
Right 1117656447 14:57961130-57961152 CAGGCTGCTGTCACTTGAGCTGG 0: 1
1: 0
2: 0
3: 18
4: 212
1117656444_1117656447 6 Left 1117656444 14:57961101-57961123 CCCATGCTGCGACGGAGAGACGT 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1117656447 14:57961130-57961152 CAGGCTGCTGTCACTTGAGCTGG 0: 1
1: 0
2: 0
3: 18
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117656447 Original CRISPR CAGGCTGCTGTCACTTGAGC TGG Intronic
900499183 1:2991836-2991858 CAGGCTGCTGTTTCTGGACCTGG - Intergenic
901171641 1:7262698-7262720 CAGGCTGGTGTCCCTTGAAGGGG - Intronic
905023411 1:34833629-34833651 TAAGGTGATGTCACTTGAGCTGG + Intronic
905042510 1:34972285-34972307 GAGGCTGCTGTCCCTGAAGCTGG + Intergenic
905593299 1:39183976-39183998 CAGGATGATGTCACAGGAGCAGG + Intronic
906561651 1:46762525-46762547 GAGGCTGCTGTCACCTGAAAGGG - Intronic
909464030 1:75952967-75952989 CAGGCTGCTGTCACCCAGGCTGG + Intergenic
909537744 1:76757248-76757270 CAAGATGCTGTCATTTCAGCTGG - Intergenic
912554855 1:110508513-110508535 CAGGCAGCTTTCTCCTGAGCTGG + Intergenic
916433795 1:164758345-164758367 CAGGCTGCAGTCACTCGAGTGGG - Intronic
919787777 1:201270818-201270840 CAGGCTGCTGTTCCTTGGCCAGG + Intergenic
922695215 1:227728080-227728102 CAGGCTGCTGTCTGTTCAGAAGG - Intergenic
924182806 1:241456022-241456044 GAGGCTGCTGTCAGTAGGGCTGG + Intergenic
924584533 1:245350507-245350529 TGGGCTGCTGTCCCCTGAGCAGG + Intronic
1064561680 10:16600124-16600146 CAGGCTTCTGTCACTGAAGATGG + Intronic
1064814075 10:19236317-19236339 GTGGCTGCTCTCACTTAAGCAGG + Intronic
1068100225 10:52543323-52543345 CAGGCGGCTCTGACATGAGCTGG - Intergenic
1070466559 10:76729893-76729915 CAGGCAACTATCACATGAGCTGG + Intergenic
1071263745 10:83945343-83945365 CAGGCTGCTGTCCCGGGAGATGG - Intergenic
1073767046 10:106694222-106694244 CAGGCTACTGTCTCTAGAGGAGG - Intronic
1076625477 10:131819108-131819130 TTGGGTGATGTCACTTGAGCCGG - Intergenic
1077911523 11:6575956-6575978 CAGGCTGCACTCACATGAGATGG - Intronic
1079114095 11:17629521-17629543 CAGCCAGTTGTCACTTCAGCCGG + Intronic
1079135950 11:17776049-17776071 CAGGCTGCTGACCCTGCAGCTGG - Intronic
1079162158 11:18005329-18005351 GAGGATGGTGACACTTGAGCAGG + Intronic
1079249767 11:18778960-18778982 CATGCTGCTGTCCCTTGCTCCGG + Intronic
1079454253 11:20623439-20623461 CAGGGTGTTGTCGCTGGAGCTGG - Intronic
1080612649 11:33918030-33918052 CAGGCTGCCTTCACTGCAGCAGG - Intergenic
1082071415 11:47942742-47942764 TAGGCTGAGGTCACTTGAGCTGG + Intergenic
1084175297 11:67419653-67419675 CAGGTGGCTCTCACCTGAGCAGG - Exonic
1084749479 11:71194759-71194781 CAGGCTTCCATAACTTGAGCAGG + Intronic
1085925574 11:81015977-81015999 GAGTCTGCTTCCACTTGAGCAGG - Intergenic
1087873427 11:103326779-103326801 CAGCCTGCTGTCTCTTGGCCTGG + Intronic
1088231451 11:107677347-107677369 CAGGCGCCTGTCACTAGACCCGG - Intergenic
1088923794 11:114280863-114280885 CAGGCTGCCGGCAAATGAGCAGG - Intronic
1089435131 11:118458753-118458775 CAGGTAGCTATCACTTCAGCTGG - Intronic
1090039184 11:123275326-123275348 CTGGCTGTTTTCATTTGAGCAGG + Intergenic
1090231833 11:125112388-125112410 CAGGCTGCTGGAACTGGAGCTGG + Intergenic
1091435811 12:472016-472038 CAGCCTGCTGTCGCTGGAGGAGG - Intronic
1092250282 12:6891230-6891252 CGGGCGGCGGTCACGTGAGCGGG + Intronic
1093290108 12:17309090-17309112 CAGGGTGCTGTCCCTTGGCCTGG + Intergenic
1098362343 12:69666949-69666971 CAGGCTGTTGTCATTTAAACAGG - Intronic
1098628621 12:72702505-72702527 CACACTGCTGTCACTTGGGGTGG + Intergenic
1102543719 12:113639889-113639911 CTGGCTGAGGTCACCTGAGCAGG - Intergenic
1102649016 12:114423708-114423730 CAGGATGCTGTCACCAGAGGAGG - Intergenic
1102990006 12:117308364-117308386 CAGGCTGGTGCCACTAGACCTGG - Intronic
1104609065 12:130213560-130213582 CAGGTTGCTTTCACGTGAGAGGG + Intergenic
1104690692 12:130823870-130823892 CAGGGTGCTGTCTATTAAGCTGG - Intronic
1104836933 12:131797708-131797730 CAGGCTGCCGTGGCTGGAGCAGG + Intronic
1104932384 12:132346653-132346675 CAGGCAGCTGTCCTCTGAGCCGG + Intergenic
1105063155 12:133172577-133172599 CCAGCTGCTGGCACTTGAACTGG + Intronic
1106123913 13:26884463-26884485 CAGGCTGCTTCCACTTGTGATGG - Intergenic
1110304263 13:73966698-73966720 AAGGTTGCTGTCTCTTGAACAGG - Intronic
1111303570 13:86376035-86376057 CTGGCTTCTGTCATTTGAACAGG + Intergenic
1112944644 13:104913119-104913141 CTGGCAGATGTCATTTGAGCAGG + Intergenic
1117656447 14:57961130-57961152 CAGGCTGCTGTCACTTGAGCTGG + Intronic
1118503015 14:66380908-66380930 CACACTGCTTTCACTTGGGCTGG - Intergenic
1118877234 14:69795979-69796001 CAGGCTGCTGGAGCTGGAGCAGG + Intronic
1119377188 14:74204219-74204241 CTGGCCCCTGTCACTTGAGCTGG + Intergenic
1122273904 14:100581417-100581439 CAGGCTGCTGGTAGGTGAGCAGG - Intronic
1123036027 14:105472302-105472324 CAGGCTGCTGTCTCATCAGCAGG - Intergenic
1125423843 15:39530570-39530592 CAGGCTGCTTCCACTTGTGGTGG + Intergenic
1125881144 15:43197087-43197109 CAGGCTGCTTCCACTTATGCAGG - Exonic
1127530786 15:59841492-59841514 CAGGATTCGGTCACATGAGCTGG + Intergenic
1128148899 15:65348946-65348968 GTGGCTGCTGTCAGTTGAGCAGG - Intronic
1128358229 15:66943298-66943320 CAGGCGCCTGTCTCTAGAGCAGG - Intergenic
1129700600 15:77765881-77765903 AAGGCTGGTGTCCCTTGTGCAGG - Intronic
1130444917 15:83991690-83991712 CAGGCTGCTGACACTTACCCAGG - Intronic
1132467815 16:85640-85662 CGGGCTGCTGCCACTACAGCCGG - Exonic
1132647027 16:1003846-1003868 CAGGCTGCTGTCCTTAGAGGAGG + Intergenic
1132880503 16:2159893-2159915 CAGGCTGCTGCCAAGTGGGCGGG + Intronic
1133008841 16:2899005-2899027 CAGGCTGGTGTCAATGGAGATGG - Intronic
1135574218 16:23572697-23572719 CAGGCTGGTGTCATTTCAGGAGG + Exonic
1136314327 16:29442169-29442191 CATGCTGTTGTCACCTGGGCTGG - Intergenic
1136327766 16:29543934-29543956 CATGCTGTTGTCACCTGGGCTGG - Intergenic
1136442454 16:30283936-30283958 CATGCTGTTGTCACCTGGGCTGG - Intergenic
1136611828 16:31371206-31371228 AAGGCTGCTCTCACCTGAGCAGG - Exonic
1137435847 16:48453685-48453707 CAGGCACCTGTCATCTGAGCTGG + Intergenic
1137958059 16:52852934-52852956 CAGGCTGCTGCCACCAGTGCTGG - Intergenic
1139354754 16:66360972-66360994 CAGGATGCAGCCACTGGAGCTGG - Intergenic
1139532714 16:67550723-67550745 CAGGCTCCTGTGACAAGAGCAGG - Intergenic
1139889254 16:70237656-70237678 CATGCTGTTGTCACCTGGGCTGG - Intergenic
1140124134 16:72106192-72106214 CAGGATGCTGGCTCTAGAGCTGG + Intronic
1140355430 16:74301700-74301722 CAGGATGCTCTTACTTGAGCTGG - Intronic
1142019548 16:87772732-87772754 CATGCTGCTGGCACTCCAGCCGG - Intergenic
1143662931 17:8338233-8338255 CAGGCTGCTTTCACTTATGGTGG + Intergenic
1146401068 17:32500450-32500472 CAGGCAACTGTCACTTAAGGCGG - Intronic
1146404995 17:32529219-32529241 CAGGGAGCTGTGAATTGAGCAGG + Intronic
1147559833 17:41501878-41501900 GATGCTGCTGTCCCTTGAGCTGG - Intronic
1148159567 17:45442199-45442221 CAGGCAGCTGCCACTAGTGCAGG + Intronic
1149641328 17:58204817-58204839 CAGGCTGCTGACGCTTCTGCTGG + Exonic
1149855613 17:60079765-60079787 CAGCCAGCTGTCACTTAAGTAGG - Intergenic
1150474601 17:65465348-65465370 TAAGCTGCTGTTACTTGGGCAGG + Intergenic
1151298150 17:73200919-73200941 CAGGCCTCTGTCACTTGATCGGG + Intronic
1152283957 17:79401801-79401823 CAAGCTGCTGTATCTGGAGCCGG - Intronic
1152346824 17:79757664-79757686 AAGGCTGCAGTGACTTGAGTTGG - Intergenic
1152463036 17:80451200-80451222 CAGGGAGCTGTCCCCTGAGCAGG + Intergenic
1152782584 17:82232778-82232800 CAGGCTGCTGGAAGCTGAGCGGG - Intronic
1152801938 17:82334566-82334588 CAGGCTGCAGTCACGTGAGTGGG + Intergenic
1152802287 17:82336640-82336662 CAGGCTGCAGTCACGTGGGTGGG - Intergenic
1152825916 17:82464670-82464692 CAGGCTCCTGTGGCTTAAGCGGG + Intronic
1155534642 18:26804629-26804651 CAGCCAGCTGTCACTTAGGCTGG + Intergenic
1156263729 18:35467692-35467714 CAGGCAGCTGCCACTTGCACAGG + Intronic
1160046965 18:75395361-75395383 GAGGCTGCTGCCACGTGACCTGG + Intergenic
1163608763 19:18290510-18290532 CAGGCAGCTGCCTCTTGGGCAGG + Intergenic
1163817980 19:19478743-19478765 GAGGCTGCAGTCAGTTGAGATGG + Intronic
1164810822 19:31154501-31154523 CAGGTTCCTGTCACATGACCAGG + Intergenic
1167299966 19:48672573-48672595 CAGGCGGCTGCCACCTGAGTGGG - Intronic
1167338775 19:48902837-48902859 GAGGCTGCTGTGGCTGGAGCAGG + Intronic
1167421557 19:49407024-49407046 CAGGCTGCAGTCACTAAAACCGG - Intronic
1202653118 1_KI270707v1_random:24479-24501 CAGGGAGCTGGCACTTGTGCCGG + Intergenic
926331302 2:11828234-11828256 CAGGCAGCTCTCACGTGTGCGGG + Intergenic
928214455 2:29349788-29349810 CAGGCTGCTCTTCCCTGAGCAGG - Intronic
931374867 2:61697835-61697857 CAATCTGGTGTCACCTGAGCTGG + Intergenic
932324749 2:70850804-70850826 CAAGCTGTTGTCACCTGATCTGG - Intergenic
932676795 2:73788515-73788537 CAGGCGCCTGCCACTTCAGCCGG - Intronic
932677380 2:73793412-73793434 CAGGCGCCTGCCACTTCAGCCGG - Intronic
932677966 2:73798310-73798332 CAGGCGCCTGCCACTTCAGCCGG - Intronic
932678552 2:73803210-73803232 CAGGCGCCTGCCACTTCAGCCGG - Intronic
932679131 2:73808109-73808131 CAGGCGCCTGCCACTTCAGCCGG - Intronic
933127469 2:78627389-78627411 TAGGCTGCAGTCTCTTAAGCTGG + Intergenic
933354217 2:81194491-81194513 CGTGCTGCTGCCACGTGAGCAGG + Intergenic
933546539 2:83720376-83720398 AAGACTGTTATCACTTGAGCAGG - Intergenic
935173894 2:100631162-100631184 CTGGCTGCTATCATTTGAGCAGG - Intergenic
935855051 2:107264500-107264522 GAGGCTGCTGTCCATTGAGTTGG - Intergenic
938731425 2:134150955-134150977 GAGGCTGTTGTGACTTGGGCTGG + Intronic
940781757 2:157940812-157940834 CAGGACACTGTCCCTTGAGCTGG + Intronic
941132996 2:161677253-161677275 CAGGCTGCTTTCACTTGTGGTGG - Intronic
941348365 2:164399496-164399518 CAGATTGATGTCACTTAAGCAGG + Intergenic
942210768 2:173667356-173667378 CATGCTGCTGTCACTGGGTCTGG - Intergenic
943514637 2:188869189-188869211 CAGTATGCTTTCAGTTGAGCTGG + Intergenic
948422129 2:237866114-237866136 CAGACTGCTGTTTCTCGAGCCGG - Intronic
948588139 2:239034141-239034163 CAGGCTGCTGTCAGTTTGGATGG + Intergenic
948748655 2:240114102-240114124 CAGGTTTCTGTCTCTTGACCTGG - Intergenic
948831117 2:240598698-240598720 CGGGCTCCAGTCACCTGAGCTGG - Exonic
1169548953 20:6681635-6681657 TAGGCTGCTTTTATTTGAGCTGG + Intergenic
1171419383 20:25007757-25007779 CAGGCTGCTGCTAAGTGAGCTGG - Exonic
1172274036 20:33670183-33670205 CAGGCTCCTGAGACTTGGGCTGG - Intronic
1173153008 20:40583935-40583957 CAGAGTGCTGTGACTCGAGCCGG + Intergenic
1174370425 20:50083320-50083342 CAGGCCCTTGTCACTGGAGCAGG - Intronic
1174532854 20:51227821-51227843 CAGGCTGCTGCCACTGGACTGGG + Intergenic
1178724946 21:35043042-35043064 CACACTGCTCTCACTTGCGCAGG - Intronic
1178771438 21:35508403-35508425 CTGCCTGTTGTCACTAGAGCAGG - Intronic
1179302348 21:40123933-40123955 CAGGCTGCTGGCAGTTTAGTGGG + Intronic
1180169201 21:46049139-46049161 CAGGGGGCTGCCCCTTGAGCTGG - Intergenic
1181465943 22:23110639-23110661 GAAGCTGCTGACCCTTGAGCTGG - Intronic
1181484218 22:23220285-23220307 CATGCAGCTGTCACTACAGCAGG - Intronic
1181527134 22:23496410-23496432 TAAGCTGCTGTCCCTTGGGCTGG - Intergenic
1181874062 22:25926060-25926082 CAGGCTCCTGTCACTGCATCTGG - Intronic
1182132178 22:27862905-27862927 CAGGCCCCTGGCACTTAAGCTGG + Intronic
1182522284 22:30891368-30891390 CAGGCTGCTGTCACTGGCTGGGG - Intronic
1182604361 22:31491681-31491703 CAGGCTCCTGCCACTACAGCAGG + Intronic
1184193493 22:42910706-42910728 CCGGCTGCTGAAATTTGAGCTGG + Intronic
1185297085 22:50059708-50059730 GAGGCTGCTGTCACTGGTACCGG - Exonic
950997934 3:17524719-17524741 CAGGCTCCTGTCACTATATCTGG - Intronic
951822446 3:26827580-26827602 CAGACTGCTCTCCCATGAGCTGG - Intergenic
952723284 3:36555709-36555731 CAATCTGCTGTTACTTCAGCTGG - Intergenic
953417116 3:42729014-42729036 CATGCAGCTGGCACTTCAGCAGG - Intronic
953531209 3:43741215-43741237 CAAGCTGCTGTGACTGGAGCAGG + Intergenic
954518004 3:51197515-51197537 CTGGCTGCTATCACTTCATCTGG - Intronic
955200648 3:56849128-56849150 AAGGCTGCTCTCACGTCAGCAGG - Intronic
956650600 3:71501140-71501162 CAGGCTGCAGAGACTTGATCTGG - Intronic
956962588 3:74420161-74420183 CAGACTGCTGTCATCTGAGAGGG - Intronic
957349786 3:79008968-79008990 CTCGCTGTTGTCACCTGAGCTGG + Intronic
959216534 3:103456932-103456954 CAGGCTGTTATCTCTTGGGCAGG + Intergenic
959293257 3:104501820-104501842 CAGGCTGCTCTCACTCATGCTGG + Intergenic
959663021 3:108890502-108890524 GAGGAAGCTGTCACTTGACCAGG - Intergenic
959948445 3:112151571-112151593 CTGGCTGCTCTCAATTTAGCAGG - Intronic
960824372 3:121767566-121767588 CAGGGTGCTTTCCCTTGACCTGG + Intergenic
961334241 3:126160684-126160706 CAGCCTGTTGGCACTGGAGCAGG + Intronic
961869398 3:129976877-129976899 CAGGATGCTGCCGCTTGTGCTGG - Exonic
962958370 3:140287024-140287046 CATGATGCTGACCCTTGAGCTGG - Intronic
968299762 3:197603611-197603633 CTCGCTGCTGTCCCTTCAGCCGG + Intergenic
968786552 4:2626264-2626286 CAGGCTGCTGTCAGTGCAGGGGG - Intronic
968787586 4:2634226-2634248 CAGCCAGCTGCCACATGAGCTGG + Intronic
976249855 4:83039314-83039336 CCTGCTGCTGTCACATGAACAGG - Intronic
977104417 4:92862900-92862922 CAGACTCCTGGCACTTGAGACGG + Intronic
977823461 4:101502803-101502825 CAGGCTCTTGTCACATGACCAGG - Intronic
981678441 4:147366166-147366188 CAGGTTGCAGGGACTTGAGCAGG + Intergenic
984719139 4:182953846-182953868 CAGACTGCAGTCACTTTAGATGG + Intergenic
986739916 5:10696908-10696930 CAGGCTGCTGGCAGTGGAGGTGG - Intronic
987448653 5:18054303-18054325 CAGGCTGCTGCCACTGCACCCGG - Intergenic
987474341 5:18372370-18372392 CTGGTTGCTGACATTTGAGCAGG + Intergenic
990518436 5:56553047-56553069 CAGGCTGCTGTGACTTGGGATGG + Intronic
990704794 5:58515772-58515794 CTGGCTGCTTTCAGTAGAGCAGG - Intergenic
992382344 5:76250615-76250637 TAGGCTGCTGTCAGTGGGGCAGG - Intronic
995784098 5:115809848-115809870 CAGGTTGATCTCACTGGAGCTGG + Intronic
997584187 5:135034817-135034839 CAGGCTGCTGTCACTCAGCCGGG - Intronic
1002542078 5:179913074-179913096 CAGTCTCCTGTCAGTTGAGGTGG - Intronic
1006638789 6:35478288-35478310 CAGGCTGCTGTCCCAGGAGAGGG + Exonic
1008030547 6:46688818-46688840 CAGGCTGCTTTTGCTTGAGCGGG - Exonic
1012434722 6:99203519-99203541 GAGGCTGCTGACACTTGAATGGG + Intergenic
1013616928 6:111851844-111851866 CAGGCTGCTATCATTAGAGAAGG + Intronic
1014480537 6:121930696-121930718 CAAGGTGCTGTCACTTGTTCTGG + Intergenic
1015778848 6:136842461-136842483 CAGGCTGGATTCTCTTGAGCCGG + Intronic
1017878689 6:158544718-158544740 CAGGGAGCTGTCCATTGAGCAGG - Intronic
1018099590 6:160425020-160425042 CAGGCTGCTCTCAAGTTAGCAGG + Intronic
1019204478 6:170348338-170348360 CAGGCTGCAGTGACTAGAACGGG - Intronic
1020715384 7:11668273-11668295 CAGGCTTCTGCCACTAGACCAGG - Intronic
1022042821 7:26596524-26596546 GAGGCGGCTGCCACTTGAGAGGG + Intergenic
1022206984 7:28174381-28174403 CAGGCTGGTGACACTTGATGAGG - Intronic
1024359798 7:48455784-48455806 CAGGCTGGGGTCAATTGAGCAGG + Intronic
1026003997 7:66586483-66586505 CAGGTTGCTGTTACTTTAGGTGG - Intergenic
1026807669 7:73438071-73438093 CAGGCTGGTGTCTGCTGAGCAGG - Intergenic
1032169819 7:129575513-129575535 CTTGCTGTTGTCACCTGAGCTGG + Intergenic
1034036461 7:147828713-147828735 TAGACTGCATTCACTTGAGCTGG - Intronic
1034692883 7:153028125-153028147 CAGGCTGCTGTGATTGGAACTGG + Intergenic
1035563765 8:627985-628007 CCTGCTGCTGCCCCTTGAGCTGG - Intronic
1035596433 8:861731-861753 AACGCTGCTGTCCCTTGAGTAGG - Intergenic
1038283988 8:26190523-26190545 CAGGCTGCTTTCCCTTGAAAAGG + Intergenic
1038455441 8:27669546-27669568 CAGGCTGCTGCCACTGCTGCTGG + Intronic
1039330144 8:36528796-36528818 CAGGAAGGTGGCACTTGAGCAGG - Intergenic
1044849062 8:96409923-96409945 AAGCCTGCTGGCTCTTGAGCTGG - Intergenic
1045474062 8:102538248-102538270 CAGGCTGCTGTCTCTTGTGAGGG + Intronic
1046733677 8:117752928-117752950 CTGGATGCTGTCAGTTCAGCCGG - Intergenic
1047499948 8:125432697-125432719 AAGGCTGCTTACACTTGAGTCGG + Intronic
1048568871 8:135633289-135633311 CAGCCTGGTCTCACTAGAGCAGG + Intronic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1049830457 8:144698277-144698299 CAGGCTGCTTTCACTTATGGTGG - Intergenic
1056038779 9:82637779-82637801 CTGGCTGCTATCACCTCAGCTGG + Intergenic
1058588034 9:106531442-106531464 CAGGGTGCTGACACAAGAGCAGG - Intergenic
1059391759 9:114003709-114003731 CAGGGTTCTGTTTCTTGAGCTGG + Intronic
1059640372 9:116211030-116211052 CTAGCTAATGTCACTTGAGCAGG - Intronic
1061901102 9:133672533-133672555 CAGGGTGGTGTCCCCTGAGCTGG - Intronic
1062461514 9:136664412-136664434 GAGGCTGCTGTGAGTGGAGCTGG - Intronic
1185846800 X:3445393-3445415 CATGCTGCTGGCACTGGGGCTGG - Intergenic
1186449741 X:9662082-9662104 CAGGGTGCTGTCAGTCGAGTGGG + Intronic
1190947438 X:55109498-55109520 GCGGCTGCTGCCAGTTGAGCAGG - Intronic
1192496950 X:71622570-71622592 CAGGCAGCTGTCCCCTAAGCTGG - Intergenic
1196737408 X:118992099-118992121 CAGGCTGCTGTTCGTTGTGCTGG + Intronic
1200131472 X:153850358-153850380 GAGGCTGCTGTGAGTTGAGATGG - Intergenic