ID: 1117657618

View in Genome Browser
Species Human (GRCh38)
Location 14:57972737-57972759
Sequence CTCTCACTCTCCTGCCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2621
Summary {0: 1, 1: 0, 2: 10, 3: 170, 4: 2440}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117657618_1117657620 -3 Left 1117657618 14:57972737-57972759 CCAGCCAGGCAGGAGAGTGAGAG 0: 1
1: 0
2: 10
3: 170
4: 2440
Right 1117657620 14:57972757-57972779 GAGCATAGTAGCCACACTCATGG 0: 1
1: 0
2: 0
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117657618 Original CRISPR CTCTCACTCTCCTGCCTGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr