ID: 1117657620

View in Genome Browser
Species Human (GRCh38)
Location 14:57972757-57972779
Sequence GAGCATAGTAGCCACACTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 82}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117657619_1117657620 -7 Left 1117657619 14:57972741-57972763 CCAGGCAGGAGAGTGAGAGCATA 0: 1
1: 0
2: 1
3: 33
4: 325
Right 1117657620 14:57972757-57972779 GAGCATAGTAGCCACACTCATGG 0: 1
1: 0
2: 0
3: 4
4: 82
1117657611_1117657620 25 Left 1117657611 14:57972709-57972731 CCAGAGCAGCCAAATCATCTTCA 0: 1
1: 0
2: 2
3: 19
4: 170
Right 1117657620 14:57972757-57972779 GAGCATAGTAGCCACACTCATGG 0: 1
1: 0
2: 0
3: 4
4: 82
1117657618_1117657620 -3 Left 1117657618 14:57972737-57972759 CCAGCCAGGCAGGAGAGTGAGAG 0: 1
1: 0
2: 10
3: 170
4: 2440
Right 1117657620 14:57972757-57972779 GAGCATAGTAGCCACACTCATGG 0: 1
1: 0
2: 0
3: 4
4: 82
1117657613_1117657620 16 Left 1117657613 14:57972718-57972740 CCAAATCATCTTCATGGCCCCAG 0: 1
1: 0
2: 2
3: 18
4: 191
Right 1117657620 14:57972757-57972779 GAGCATAGTAGCCACACTCATGG 0: 1
1: 0
2: 0
3: 4
4: 82
1117657616_1117657620 -1 Left 1117657616 14:57972735-57972757 CCCCAGCCAGGCAGGAGAGTGAG 0: 1
1: 0
2: 11
3: 155
4: 1978
Right 1117657620 14:57972757-57972779 GAGCATAGTAGCCACACTCATGG 0: 1
1: 0
2: 0
3: 4
4: 82
1117657610_1117657620 26 Left 1117657610 14:57972708-57972730 CCCAGAGCAGCCAAATCATCTTC 0: 1
1: 0
2: 1
3: 20
4: 222
Right 1117657620 14:57972757-57972779 GAGCATAGTAGCCACACTCATGG 0: 1
1: 0
2: 0
3: 4
4: 82
1117657617_1117657620 -2 Left 1117657617 14:57972736-57972758 CCCAGCCAGGCAGGAGAGTGAGA 0: 1
1: 0
2: 5
3: 159
4: 2335
Right 1117657620 14:57972757-57972779 GAGCATAGTAGCCACACTCATGG 0: 1
1: 0
2: 0
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117657620 Original CRISPR GAGCATAGTAGCCACACTCA TGG Intronic
903966163 1:27091268-27091290 CTGCATTATAGCCACACTCAGGG + Intergenic
904985968 1:34549251-34549273 GTGCATAGTAGCCCCATGCAGGG - Intergenic
905343937 1:37298689-37298711 GAGGATAGCAGCCTCAATCATGG + Intergenic
908835183 1:68222801-68222823 GATTCAAGTAGCCACACTCATGG + Intronic
914716965 1:150261493-150261515 GGGCATTGTTTCCACACTCAGGG - Exonic
922116109 1:222616804-222616826 GAGCATTGTAGCCACTCTTCTGG + Intergenic
922821208 1:228487140-228487162 GAGCATAGTTGCCAAAATCAAGG + Exonic
1062946062 10:1463082-1463104 GAGCATAGTAACCAGGGTCATGG + Intronic
1067852666 10:49764086-49764108 GAGAATGGCAGCCACCCTCATGG - Intergenic
1069412887 10:68171185-68171207 GGGAATAGTAGCAACTCTCAGGG - Intronic
1071947506 10:90662536-90662558 GATCATATTATCCACACACAAGG - Intergenic
1079266468 11:18938050-18938072 GTGCATAGAAGCCACTCTCTTGG - Intronic
1080254702 11:30276894-30276916 GACCATGGTCGCCACCCTCATGG + Intergenic
1084894504 11:72255802-72255824 GAGGATAGAAACCACACTCTAGG - Intergenic
1089003346 11:115070187-115070209 GAGCAGAGAAGCCACAGACAGGG + Intergenic
1094076960 12:26487819-26487841 TACCATGGTAGCCTCACTCATGG + Intronic
1098922314 12:76313734-76313756 GAGCAGAGTAGTTACAGTCATGG + Intergenic
1101721342 12:107353084-107353106 TGGCTTAGTGGCCACACTCAAGG + Intronic
1116336509 14:43664647-43664669 TAGCATTGTAGCCATAATCAAGG + Intergenic
1117657620 14:57972757-57972779 GAGCATAGTAGCCACACTCATGG + Intronic
1118335708 14:64852132-64852154 GAGCAGAGTAGACACACAGAAGG + Intronic
1119680783 14:76590881-76590903 GAGCAGTGGAGCCACACTCCTGG - Intergenic
1119900092 14:78252105-78252127 GAACATTGTGGCCACAGTCAAGG - Intronic
1120257002 14:82133227-82133249 GAGCATAATATCCTCACTTAAGG + Intergenic
1126217642 15:46174750-46174772 GAGCACAGTAGAGGCACTCAAGG + Intergenic
1126569569 15:50135985-50136007 GAGGAAAGTATCCACGCTCAAGG - Intronic
1127098176 15:55534855-55534877 GTGCATAGTAGCCCCATGCAGGG - Intergenic
1127463144 15:59218189-59218211 GTGCATAGAAGGCACAATCACGG + Intronic
1134075435 16:11287803-11287825 GCTCATAGTAGCCACACTAATGG + Intronic
1134827243 16:17294590-17294612 GAGAATCGCAGCCACCCTCAAGG + Intronic
1135090275 16:19508822-19508844 GAGCACAGTGGCCAAAATCATGG - Intronic
1147749234 17:42718433-42718455 AAACAGAGTAGCCCCACTCACGG + Exonic
1150227668 17:63532598-63532620 GGACATGGTAGCCCCACTCAAGG + Intronic
1158866081 18:61638874-61638896 GACTATGGCAGCCACACTCAGGG + Intergenic
1159038174 18:63297461-63297483 GAGCCTGGTAGCCACAGCCACGG + Intronic
1159743127 18:72198598-72198620 GAGCATTGTATTCACACTTATGG + Intergenic
1165477450 19:36039554-36039576 GAGCATGGTGGCCACAGTCTTGG + Exonic
1166994533 19:46713977-46713999 GGCCGTAGAAGCCACACTCAGGG + Exonic
925826064 2:7849675-7849697 GAGCATGGGAGCCACTCTGAGGG + Intergenic
936279021 2:111122164-111122186 GAGAATAGTTGCCACAGCCAGGG + Intronic
938103339 2:128513009-128513031 GGGCAGTGGAGCCACACTCAGGG + Intergenic
941365957 2:164611768-164611790 GAGCACAGGAGTCACATTCATGG - Intronic
944437597 2:199706784-199706806 CTGCATTGTAGCCACATTCAGGG - Intergenic
1173153691 20:40589527-40589549 GATGGTAGTAGCAACACTCAAGG - Intergenic
1174058959 20:47819080-47819102 GAGCCTGGCAGCCACAGTCAAGG + Intergenic
1174905168 20:54542565-54542587 GAGCATTCTTGCCACACACAGGG - Intronic
1175138940 20:56845349-56845371 AGGCATAATACCCACACTCAAGG + Intergenic
1175478520 20:59294467-59294489 AAGCATAATGGCCTCACTCATGG - Intergenic
1177296328 21:19181083-19181105 GAGCATCGGAGCCTCGCTCATGG + Intergenic
1177923761 21:27187645-27187667 TAGCATAGTTCCCACACTCATGG - Intergenic
1178764129 21:35433290-35433312 GAGCATAGTACACCCCCTCATGG + Intronic
1183166834 22:36154650-36154672 CAGAATAGTAACCACACACAGGG + Intronic
1184006230 22:41711463-41711485 CAGGATTGTAGCCCCACTCAAGG - Intronic
950293769 3:11809919-11809941 AAGAATAGAAGCCACTCTCAAGG + Intronic
951103165 3:18712985-18713007 GAGCTTATAAGCCACACTTATGG - Intergenic
956068179 3:65418919-65418941 GACCATTGTAGCAGCACTCATGG - Intronic
963376471 3:144472294-144472316 CATCATATTAGCCACATTCAAGG + Intergenic
965152468 3:164996559-164996581 GAGCATTTTATCCATACTCAAGG - Exonic
966103283 3:176302568-176302590 TAGCATAGTAGTCAAAATCATGG - Intergenic
967199742 3:187062181-187062203 GATCATAGAAGCCACCCTAATGG - Intronic
968591637 4:1462606-1462628 GCCCAGAGGAGCCACACTCAGGG + Intergenic
969069885 4:4527973-4527995 CAGCATTGCAGCCTCACTCAGGG - Intronic
971566795 4:28154500-28154522 GTGCATAGAAGCCACATTTATGG - Intergenic
971567783 4:28167822-28167844 AGGCATAGGAGCCTCACTCATGG + Intergenic
973550976 4:52036004-52036026 GAACATAGTGTCCACCCTCAAGG + Intronic
981327013 4:143461417-143461439 GAGCATATGTGCCACACCCAAGG - Intronic
984334581 4:178373855-178373877 GAGCATAGTAGCTACTGACATGG + Intergenic
992278175 5:75143113-75143135 GAGCAATGTAGCCACAGCCAAGG - Intronic
995623256 5:114051372-114051394 GAGGACAATAGCCACACTCCAGG - Intergenic
996254298 5:121379126-121379148 GAGCATAGAAGCCACTCTGCTGG - Intergenic
1001691175 5:173633671-173633693 GAGCATAGTAACCAAACCCGGGG + Intergenic
1014640923 6:123909416-123909438 GAGCCTTGTAGCCTCTCTCAAGG - Intronic
1016578647 6:145601700-145601722 GTGCATATTAGCCACACAGAAGG - Intronic
1018589846 6:165407405-165407427 GATAATAATAACCACACTCATGG + Intronic
1023488436 7:40711827-40711849 GAGCACAGTATCCAGTCTCATGG + Intronic
1024318825 7:48045400-48045422 GAGCAGCTCAGCCACACTCATGG + Intronic
1026328125 7:69328669-69328691 GAGATTAGTAGCCACACCTAAGG + Intergenic
1026519552 7:71104667-71104689 GATCATAGCAGGCGCACTCATGG - Intergenic
1029104812 7:98166186-98166208 GAGCAGTGTGGCCACACACATGG - Intronic
1034671803 7:152864746-152864768 GGGCTTAGTAACCACACCCAGGG + Intergenic
1044313656 8:90725980-90726002 GTGCACAGTAGCCCCACGCAGGG - Intronic
1049122103 8:140748034-140748056 TACCATAGTCTCCACACTCAGGG - Intronic
1058687662 9:107491871-107491893 GAGGATGGAAGTCACACTCAAGG - Intergenic
1061894778 9:133641515-133641537 GAGCAAATTAGCCACCCACACGG + Intronic
1187282599 X:17870010-17870032 TAAAATAGTAGCCACACTCACGG - Intergenic
1198000601 X:132431466-132431488 CAGCATAGTAGCCAGTCTGAAGG - Intronic
1199677204 X:150198739-150198761 GACCATGAGAGCCACACTCATGG + Intergenic