ID: 1117659120

View in Genome Browser
Species Human (GRCh38)
Location 14:57985936-57985958
Sequence TTTTCCACACAGAACTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117659116_1117659120 25 Left 1117659116 14:57985888-57985910 CCTTGACTCTATCTTGGGGTGAG No data
Right 1117659120 14:57985936-57985958 TTTTCCACACAGAACTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117659120 Original CRISPR TTTTCCACACAGAACTTTGT GGG Intergenic
No off target data available for this crispr