ID: 1117664202

View in Genome Browser
Species Human (GRCh38)
Location 14:58039328-58039350
Sequence TCTGATAAACAGAGGCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 335}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117664202_1117664206 11 Left 1117664202 14:58039328-58039350 CCATCTTGCCTCTGTTTATCAGA 0: 1
1: 0
2: 1
3: 29
4: 335
Right 1117664206 14:58039362-58039384 AACACAATCCCTTTGAATTAAGG 0: 1
1: 0
2: 3
3: 10
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117664202 Original CRISPR TCTGATAAACAGAGGCAAGA TGG (reversed) Intronic
902704061 1:18192258-18192280 TCTGCTGACCACAGGCAAGAAGG - Intronic
903072835 1:20735992-20736014 ACTGAAAACCAGAGCCAAGATGG + Intergenic
903888510 1:26554987-26555009 TCTGGTTGGCAGAGGCAAGAGGG + Intronic
905258552 1:36701321-36701343 TCTTAAAAACAGTAGCAAGAGGG + Intergenic
906784882 1:48606548-48606570 ACTGAGGAACAGAGGCAAGAAGG - Intronic
907405707 1:54252253-54252275 TCTGTGAGACAAAGGCAAGATGG - Intronic
907628852 1:56060119-56060141 TCTGAGATACAGAGTCAAGAGGG + Intergenic
908187714 1:61668605-61668627 TCTGATAAAGAAAAACAAGAAGG + Intergenic
909040212 1:70640463-70640485 TGAGATAAAAAGATGCAAGAAGG + Intergenic
909227953 1:73049513-73049535 TCTGATAAACAAAATCAATAAGG + Intergenic
909375777 1:74940060-74940082 TTTGAAGAACAGAGGCAAGAAGG + Intergenic
910882249 1:91932424-91932446 TCTGAAAAAGAAAAGCAAGAAGG - Intergenic
911395973 1:97310621-97310643 TCAGAAAAACAGATGCAAGAAGG - Intronic
913117037 1:115706770-115706792 TTTGCTAAACAGAGGCCATAGGG - Intronic
913124607 1:115773356-115773378 CTTGTGAAACAGAGGCAAGAGGG + Intergenic
913409328 1:118533597-118533619 TGTGATAAAGAGAGTGAAGAAGG - Intergenic
913419630 1:118650779-118650801 TATGATAAGCAAGGGCAAGAAGG + Intergenic
913520950 1:119645904-119645926 GATGATAAACTAAGGCAAGAAGG - Intronic
914357999 1:146904511-146904533 TCTGATAGACAGGCCCAAGATGG - Intergenic
914504549 1:148277566-148277588 TGGGATAAACAGAGAAAAGAAGG - Intergenic
914509747 1:148320711-148320733 TGGGATAAACAGAGAAAAGAAGG + Intergenic
915264816 1:154709236-154709258 TCTGATGTACACAGCCAAGATGG - Intronic
915911599 1:159918891-159918913 TCGGATAACCAGCTGCAAGAGGG - Exonic
916015796 1:160748919-160748941 ATTGATAAATAGATGCAAGAAGG + Intronic
916693486 1:167213725-167213747 TCTGACAATCAGAGGAGAGATGG + Intergenic
916869109 1:168893280-168893302 TCAGATAAACAGAGAGATGAAGG + Intergenic
917187071 1:172369955-172369977 TCTTATAACAAGAGGCAATATGG - Intronic
917739327 1:177947538-177947560 TGTGAAACAGAGAGGCAAGAAGG + Intronic
917790946 1:178498347-178498369 TTTGAGAAACCGAGGCAGGAGGG + Intergenic
918702057 1:187617497-187617519 TTTGTTAAACAGAGGCTTGAAGG + Intergenic
919162386 1:193847527-193847549 TCTGAGAAATAAAGCCAAGATGG + Intergenic
919925713 1:202191040-202191062 TTTGTTAAACAGAGGCTTGAAGG - Intergenic
920447336 1:206028647-206028669 TTTAGTAAACAGGGGCAAGAGGG - Intergenic
921460634 1:215421956-215421978 TCTAATAAACTGAGGGCAGAGGG - Intergenic
923030740 1:230247364-230247386 GCTGAGAAGCAGAGGCAAAATGG - Intronic
923251663 1:232184153-232184175 ACAGATAGACAGAGGGAAGAGGG + Intergenic
923981657 1:239330871-239330893 GCTGAAAAGCAGTGGCAAGAGGG - Intergenic
923998039 1:239518749-239518771 TCTGAAAGACAGAGGCATGGTGG + Intronic
924443997 1:244111530-244111552 GCTGATTAAGAGATGCAAGAAGG - Intergenic
1063781384 10:9329253-9329275 GCTTATAAACAGAAGCAATAAGG - Intergenic
1064268375 10:13843463-13843485 TATGATAAAAAGAGTCACGATGG + Intronic
1065861848 10:29878479-29878501 TCTCCTAACCACAGGCAAGAAGG + Intergenic
1066325450 10:34353492-34353514 TTTGTTAAACAGAGGCTTGAAGG + Intronic
1066629033 10:37440475-37440497 TCTGAGAACCAGAGGGATGATGG + Intergenic
1068334542 10:55615623-55615645 TCTGATAGGCTGAGGCAATAAGG + Intronic
1068829637 10:61478732-61478754 TCTAATATACAGAGGTAAAAAGG - Intergenic
1069631478 10:69899707-69899729 TCTGAAGAGCAGAGGCCAGATGG - Intronic
1070523328 10:77274095-77274117 CATGGTAAACAGTGGCAAGAGGG - Intronic
1071044786 10:81360818-81360840 TCTGATAGACAGATGCAAAAGGG + Intergenic
1072096387 10:92185351-92185373 TCTGATAAATAGGGGTGAGAGGG + Intronic
1072316355 10:94207113-94207135 GCTGAGAAACAAAGGGAAGAGGG - Intronic
1072946904 10:99818579-99818601 TCTGATAAAAAGTGGTAAGTTGG + Intronic
1074947717 10:118297303-118297325 TCTGGTAATGAGAGGAAAGAAGG - Intergenic
1076092197 10:127696701-127696723 TCCAATAAACAGGGGAAAGAAGG - Intergenic
1076454441 10:130580006-130580028 GCTGATTAACAGAGGTACGATGG - Intergenic
1077754235 11:5008115-5008137 TCTGAAGAATAAAGGCAAGATGG + Intergenic
1078848223 11:15140825-15140847 TTTGAGAGACCGAGGCAAGAGGG - Intronic
1079118012 11:17652924-17652946 TCAGTGGAACAGAGGCAAGATGG - Intergenic
1081222199 11:40475760-40475782 TCTGATAAGAAGAGGAAAGTTGG - Intronic
1081530592 11:43956355-43956377 CTTGATTAACAAAGGCAAGAGGG + Intergenic
1082211282 11:49505442-49505464 TTTGAAAAACAAAGGAAAGAAGG + Intergenic
1083958138 11:65998216-65998238 GCTGTTAAACACATGCAAGAAGG + Exonic
1085730199 11:78991396-78991418 TCTGAGAAAGAAAGGCAGGATGG + Intronic
1085945726 11:81269986-81270008 TGTGATAAACAAACCCAAGACGG + Intergenic
1086439140 11:86811105-86811127 TCTGATAAAGAGAGGGAAAATGG - Exonic
1086638360 11:89119613-89119635 TTTGAAAAACAAAGGAAAGAAGG - Intergenic
1088549965 11:111002844-111002866 AATGATAAACTGAGGCAAAAAGG - Intergenic
1090395031 11:126413483-126413505 TCTGAGGAACAGGGGCAGGAGGG - Exonic
1090704709 11:129325814-129325836 TCTGACCAACAGGGGAAAGAAGG - Intergenic
1091049561 11:132355167-132355189 TATGAGAGGCAGAGGCAAGAGGG - Intergenic
1091974781 12:4815574-4815596 TCAAATAAACAGAGAAAAGAGGG + Intronic
1092071591 12:5635942-5635964 CTTGATAAGTAGAGGCAAGAAGG + Intronic
1092609282 12:10154400-10154422 TTTGGTCAACAGAGACAAGATGG - Intergenic
1092722833 12:11458779-11458801 TTTGTTAAACAGATGCTAGAAGG + Intronic
1094699578 12:32855820-32855842 ACTCATAAACACAGGCAAAAAGG + Intronic
1095473106 12:42557325-42557347 TCTGTTAAATAGATGAAAGAAGG + Intronic
1095667833 12:44823050-44823072 ACTGAAAAACAGAGTCAAGTTGG + Intronic
1096278405 12:50230492-50230514 GGGGAAAAACAGAGGCAAGAGGG + Intronic
1097628605 12:62032000-62032022 TCTGATAATAGGAGGCAAGCAGG - Intronic
1098073883 12:66705782-66705804 TCTGATAAAAACAAGCAAAAGGG + Intronic
1099602583 12:84760476-84760498 TCTGATACATAGAGGAATGAGGG - Intergenic
1100215799 12:92447107-92447129 TCTGATATACCTAGACAAGAGGG - Intergenic
1106090540 13:26589034-26589056 TTTGAGAGACTGAGGCAAGAGGG - Intronic
1106761516 13:32873114-32873136 CCTGAATAACAGAGGCCAGATGG + Intergenic
1107493499 13:40901672-40901694 TTTGTTAAACAGAGGCTTGAAGG + Intergenic
1107822387 13:44297435-44297457 TTTGATTAACAGAGGCAAGCAGG + Intergenic
1110574458 13:77039865-77039887 TATGGGAAAGAGAGGCAAGAGGG - Intergenic
1113272675 13:108691832-108691854 TTTGATGAACAGAGGTAAGCCGG + Intronic
1113401368 13:109997006-109997028 TCTGATACACAGAAGTGAGATGG + Intergenic
1113497751 13:110745573-110745595 TCTGATAAACATAATCAACAAGG + Intergenic
1113827019 13:113263516-113263538 TCTGATAGACAGAGACTATATGG + Exonic
1114232225 14:20793474-20793496 CCTGATAAAAAGAGACATGAGGG - Intergenic
1116548174 14:46197867-46197889 TCAGCTTAAGAGAGGCAAGAAGG + Intergenic
1116733560 14:48658293-48658315 TCTGAAAAACAGAGAAAAAAGGG + Intergenic
1116977187 14:51129408-51129430 TCAGATCTACAGATGCAAGAAGG + Intergenic
1117131122 14:52687801-52687823 TCTAATAAGCAGAGATAAGAAGG + Intronic
1117664202 14:58039328-58039350 TCTGATAAACAGAGGCAAGATGG - Intronic
1117880726 14:60310788-60310810 AGAGAGAAACAGAGGCAAGAAGG - Intergenic
1118006042 14:61564829-61564851 TCTGATAAACCCAGGAATGAAGG + Intronic
1119867432 14:77985583-77985605 TGTGATTCACAGAGGCAGGAGGG + Intergenic
1120803688 14:88721879-88721901 TCTGATATCCAGAGTCAACAAGG + Intronic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1126450841 15:48807127-48807149 TCTGAGAAGCAGAGGCTGGAGGG - Intronic
1126839218 15:52699877-52699899 TCTAAGAAACAAAGGCAAGAAGG - Intronic
1127337314 15:58001163-58001185 TCTTATAAACAGAGAAAATATGG + Intronic
1127900434 15:63337149-63337171 ACTGAGAAACTGAGGAAAGAGGG + Intronic
1128001507 15:64196848-64196870 GCTGCCAAACAGAGGCAAAATGG + Intronic
1129047638 15:72750807-72750829 TCTAATAAAAATAGGCTAGAAGG + Intergenic
1129053809 15:72805734-72805756 ACTCTTAGACAGAGGCAAGAGGG - Intergenic
1129439381 15:75569130-75569152 TCTGATATACCAAGGCAGGATGG + Intronic
1129980930 15:79869946-79869968 TTTCAAAAACAGAGGAAAGAAGG + Intronic
1130119589 15:81036104-81036126 TCAGATGCACAAAGGCAAGAAGG - Intronic
1130201041 15:81826971-81826993 CCTGATAAAAATAGGCAGGAAGG - Intergenic
1131236774 15:90703598-90703620 TCTGAAAAACAGAGAGAAAAAGG - Intergenic
1133580720 16:7142021-7142043 TCAGATAAAAAGAAGAAAGAAGG - Intronic
1137065554 16:35838438-35838460 TCTGAAAGGCAGAGGCAGGATGG + Intergenic
1137467276 16:48721389-48721411 TCAGCTAAACAGAGAGAAGATGG - Intergenic
1137467674 16:48725693-48725715 TCAGCTAAACAGAGAGAAGATGG - Intergenic
1137803476 16:51282819-51282841 GCTGAAAAACAAAGGCAACAAGG + Intergenic
1138724165 16:59117658-59117680 TCTTATACACAAAGGCAAGTTGG + Intergenic
1139976186 16:70812781-70812803 TCTGATAGACAGGCCCAAGATGG + Intronic
1142700489 17:1657086-1657108 TGTGATTAACAGAGCAAAGAGGG + Intronic
1143671099 17:8396721-8396743 ACTGAGAAAGGGAGGCAAGAAGG - Intronic
1144524509 17:15979206-15979228 TTTGATAAACAGATGCTTGAAGG - Intronic
1144691421 17:17267790-17267812 TTTGATAAACACAGGCAAGTTGG - Intronic
1146004814 17:29154585-29154607 CAAGATCAACAGAGGCAAGAGGG - Intronic
1146967572 17:37045929-37045951 TCTGATTTGCAGAGGCAGGAAGG + Intronic
1147690917 17:42313964-42313986 TCTGATCAGCTGAGGCAAGGTGG + Exonic
1149139986 17:53420672-53420694 TCTTATACACAGAAGTAAGATGG + Intergenic
1149950104 17:60976657-60976679 TCTGTTAAACAGATGCTTGAAGG - Intronic
1149954738 17:61036101-61036123 TCTTCTAAACAGAAGCAATAAGG - Intronic
1150672924 17:67217748-67217770 GGTGATAACCAGAGGCAAGGGGG - Intronic
1153646814 18:7203402-7203424 TTTGTTAAACAGAGGCTTGAAGG - Intergenic
1156114049 18:33765434-33765456 TCTGAGAAACCCAGGCAGGATGG - Intergenic
1157012856 18:43672280-43672302 TCTGATAAACAGAAAACAGAGGG - Intergenic
1157018447 18:43748189-43748211 TCTGATATAAATAGTCAAGAAGG + Intergenic
1157563498 18:48664408-48664430 GGTGAGAAACGGAGGCAAGAGGG - Intronic
1158898541 18:61939221-61939243 TCTGAGAAAGAGAGGCCAGGCGG - Intergenic
1159340330 18:67126404-67126426 TTTGTTAAACAGATGCTAGAAGG - Intergenic
1161386863 19:3999222-3999244 TTTGTTAAACAGATGCTAGAAGG + Intergenic
1163220336 19:15914101-15914123 TCAGATAAACAGATGAAGGAGGG + Intronic
1164889759 19:31813117-31813139 GATTATAAACAGAGGCAGGAAGG + Intergenic
1165844217 19:38807895-38807917 TTTGTTAAACAGAGGCTTGAAGG + Intronic
1166391454 19:42411016-42411038 TCTGATTCCCAGAGACAAGAGGG - Intronic
1168705300 19:58467257-58467279 TCTGAGAAACAGAGGCTTGGGGG - Exonic
925879110 2:8336109-8336131 TCTGATAAACGGAGGTAGTATGG - Intergenic
926364054 2:12116664-12116686 GCTGAGAAACAGATGGAAGAAGG + Intergenic
928148893 2:28808759-28808781 TCAAATGAAAAGAGGCAAGAAGG + Intronic
928492143 2:31795323-31795345 TCTCAAAAAAAGAAGCAAGATGG + Intergenic
929019002 2:37531683-37531705 ACACACAAACAGAGGCAAGAAGG + Intergenic
930553606 2:52867752-52867774 TGTTGTAAACAGAGGCGAGATGG + Intergenic
930912014 2:56640535-56640557 ACTGATCAACAGAGGAAATAAGG - Intergenic
932134039 2:69213047-69213069 TCTGAGAAGCTGAGGCAGGAGGG - Intronic
932848287 2:75157078-75157100 TTTCAGAAACAGAGGCTAGAAGG + Intronic
933029973 2:77316104-77316126 TCTCTTTAACAGAGGCAAAATGG + Intronic
933242390 2:79936683-79936705 TCTAATATAATGAGGCAAGATGG - Intronic
935440280 2:103085901-103085923 TCACATTAACAGATGCAAGAGGG + Intergenic
937656877 2:124386936-124386958 TCTTATAATCAGAAGCCAGAGGG + Intronic
938867734 2:135441290-135441312 TCAGACCAACAGAGGCAAGAGGG + Intronic
939009571 2:136829914-136829936 AAAGATAAAAAGAGGCAAGAGGG - Intronic
939152476 2:138489329-138489351 TCTGATAAACAGATAAAATATGG - Intergenic
940448813 2:153812698-153812720 TGAGATAAACAAAGGAAAGAGGG - Intergenic
941848008 2:170150681-170150703 TTTGTTAAACAGAGGCTTGAAGG + Intergenic
942355846 2:175108948-175108970 TTTGTTAAACAGATGCATGAAGG + Intronic
942396837 2:175558599-175558621 TCTGAGAAACATAGCTAAGATGG + Intergenic
943513376 2:188854263-188854285 TCAGATAAAAAGGGGCAAGATGG - Intergenic
943931496 2:193859505-193859527 CCTGAAATATAGAGGCAAGATGG - Intergenic
944322618 2:198365829-198365851 TATGAGGAACAGATGCAAGATGG + Intronic
945444414 2:209918936-209918958 TGTAATAAATAGAGGCAAAAGGG - Intronic
946117493 2:217476066-217476088 TCTGATAAGCAGATGAAACAGGG - Intronic
947778360 2:232733525-232733547 TCATTTAAACAGAGGCAACAGGG + Intronic
947843878 2:233228191-233228213 TCTGATAATCATTTGCAAGAAGG + Intronic
1168835319 20:873782-873804 TCTGAGACACAGAGGACAGATGG - Intronic
1169420373 20:5453934-5453956 TTTGTTAAACAGACGCTAGAAGG + Intergenic
1169469651 20:5872898-5872920 TTTGATCAACAGAGAGAAGACGG + Intergenic
1169788365 20:9385026-9385048 TTTGTTAAACAGATGCTAGAAGG - Intronic
1170913482 20:20599081-20599103 TCTGATACACAGCAGAAAGAAGG - Intronic
1171265640 20:23769855-23769877 TGTGATTAGCAGAGGAAAGAAGG + Intergenic
1171294858 20:24008577-24008599 TTTTATAAACAAAGCCAAGAAGG - Intergenic
1172305250 20:33876057-33876079 ACTAATACACAGAGGAAAGAAGG + Intergenic
1172764575 20:37344763-37344785 GGTGATAAACTGAGGCTAGAGGG - Intronic
1174138319 20:48395717-48395739 TCTAACAAACAAAGGCAAAAAGG - Intergenic
1174733895 20:52945647-52945669 TCAGAGAAACAGAGCCAACAGGG + Intergenic
1175092474 20:56515946-56515968 TTTGAAAAGCACAGGCAAGAAGG - Intronic
1176431385 21:6578441-6578463 TCTGAACACCAAAGGCAAGATGG + Intergenic
1177107629 21:16979572-16979594 TTTTATAAGCAGAAGCAAGAGGG + Intergenic
1179706779 21:43185903-43185925 TCTGAACACCAAAGGCAAGATGG + Intergenic
1180854266 22:19036466-19036488 TCTGAGAAACCGTGGCAAGCTGG + Exonic
1182251586 22:29005007-29005029 TCTGAAAAGCGGAGACAAGAGGG - Intronic
1184206045 22:43004030-43004052 TCTGAGAAACATAGACATGAGGG - Intronic
1184477455 22:44729337-44729359 TCGGATAAAGAAAGGAAAGACGG + Intronic
1184794961 22:46726816-46726838 TCTGATACACAGATGGAAGGTGG + Intronic
949963434 3:9334612-9334634 TCTCATAAACAAAGACAAGATGG + Intronic
950010702 3:9721665-9721687 TATGAAAAACAGAGGCATGAAGG + Intronic
950380610 3:12611459-12611481 ACTGGGAAACTGAGGCAAGAGGG - Intronic
950444464 3:13028337-13028359 GCTGACAAACAGAGGCCAGACGG - Intronic
954332382 3:49897954-49897976 TCTGCTTATCAGAGGCAAGGGGG - Intronic
955616343 3:60811432-60811454 TCTGACAAGCAGAGCAAAGAGGG - Intronic
955825266 3:62939512-62939534 TCTGACAATCATAGGCTAGAGGG - Intergenic
955929412 3:64041336-64041358 TCTTATAAACAGAGAAAACATGG + Intergenic
956612506 3:71138472-71138494 TCTGAAAAAGAAAGGCGAGAAGG + Intronic
957234015 3:77561032-77561054 TCTATTACACAGAGGGAAGATGG - Intronic
957499838 3:81040384-81040406 TCTGATCAACATAGGTAAGTGGG - Intergenic
957872241 3:86104274-86104296 ACTAATAAAAAGAGGGAAGAGGG - Intergenic
958443704 3:94188794-94188816 TTTGACAAACAGAGCAAAGATGG - Intergenic
958950601 3:100411669-100411691 TGTGAGAAACAGAGGGAAGGTGG - Intronic
958958680 3:100488630-100488652 TGTGATATACAGAGGAAAGAGGG - Intergenic
958990136 3:100833914-100833936 TCATATAAACAGAGGCAGGAAGG - Intronic
959395937 3:105838423-105838445 TCAGAAAATCAGAGCCAAGATGG + Intronic
959821866 3:110744918-110744940 TTTGATAAATGGAGGCAATAAGG - Intergenic
960549455 3:118958109-118958131 TCTGAGAAACAGAAGAAAAAAGG - Intronic
960666529 3:120114493-120114515 TCAGAGAAACATAGGCAACAGGG - Intergenic
960747472 3:120906469-120906491 TTTTAAAAACAGAGGCAAGGAGG - Intergenic
961542547 3:127609807-127609829 ACTGAGAAACAGAGGAAGGAAGG - Intronic
962092162 3:132255775-132255797 TCTTATAAGGAGAGGAAAGATGG + Intronic
964936992 3:162102009-162102031 TGTGATAAATAGATGCACGAAGG - Intergenic
967367708 3:188706556-188706578 TCTTCTAAACATAGTCAAGAAGG - Intronic
967676321 3:192302857-192302879 TATGATAAGTAAAGGCAAGAAGG + Intronic
967867670 3:194203874-194203896 CCTGATGAACAAAGGCAAGGGGG + Intergenic
969384660 4:6836766-6836788 TTTGTTAAACAGAGGCTTGAAGG - Intronic
969498757 4:7540674-7540696 TCTGATGAAGAGAGTCATGAGGG + Intronic
971130199 4:23799914-23799936 GCTGATAAAAACAGTCAAGACGG - Intronic
971384534 4:26131096-26131118 TCTGATAAGCTGAGGCCAGTTGG - Intergenic
971472960 4:27046864-27046886 TCTGATAAACAGATTAAGGAAGG - Intergenic
971749096 4:30623721-30623743 TCTTACAGATAGAGGCAAGATGG + Intergenic
973545816 4:51980811-51980833 TCTGATAAAGAAATGCAAGGGGG + Intergenic
975127841 4:70802116-70802138 CATGATAAACAGAGGCAACTTGG - Intronic
975468367 4:74735257-74735279 TGTGATAGACAGAGGCCGGATGG + Intergenic
975848584 4:78548828-78548850 TTTGTTAAACAGAGGCTTGAAGG + Intergenic
976180295 4:82392468-82392490 TCTTATACACAGAGGTGAGATGG + Intergenic
976266185 4:83187047-83187069 TCTGATAAAAAAAGGTATGAAGG - Intergenic
977188936 4:93976118-93976140 ACAGATACACAGAGGGAAGATGG - Intergenic
977444361 4:97110390-97110412 TCTCATAAAAAAAAGCAAGATGG - Intergenic
977790285 4:101092278-101092300 CCTGATAAACAAATGTAAGAAGG + Intronic
978052614 4:104220917-104220939 TCAGATAAACAGAACCAATAGGG - Intergenic
978363187 4:107952560-107952582 TCTGGAAAACAGAGCAAAGAAGG - Exonic
979749663 4:124263152-124263174 TCTGATATACAGAGGAAGAAAGG - Intergenic
980214071 4:129828534-129828556 CCTTATAAACAGAGGCAATTAGG - Intergenic
980681947 4:136174301-136174323 TCTGATATACAAATGGAAGAAGG + Intergenic
980966836 4:139529925-139529947 TCTGCTAAAAGGAGGCAAGAGGG - Intronic
982210447 4:153030574-153030596 TCTGAAAAACAGAGAGAAAATGG + Intergenic
982489861 4:156016441-156016463 TGAGAAAAACAGAGGAAAGACGG - Intergenic
982635986 4:157897328-157897350 TCTGATATACGGAGGAAAAATGG + Intergenic
985787060 5:1901992-1902014 ACTGATAAAAAGAGACAGGAAGG + Intergenic
986129614 5:4915279-4915301 TCTTATAAAGCAAGGCAAGAGGG + Intergenic
986316057 5:6587099-6587121 TGTTATAAACTCAGGCAAGAGGG - Intergenic
986399192 5:7363040-7363062 TCTGTAGAACAGGGGCAAGAAGG + Intergenic
986401346 5:7384593-7384615 CCTGATAGACCGAGGCAAGATGG - Intergenic
986645178 5:9910299-9910321 TGTGATAAACAGAAGTAGGAAGG + Intergenic
987359593 5:17094795-17094817 TCTGATAAACGTATGCAAGCTGG - Intronic
988230288 5:28468515-28468537 TCAGATAAACAGAAGCAACAAGG - Intergenic
989314512 5:40062110-40062132 TCTGATAACCGGAGGACAGACGG - Intergenic
989841399 5:46076614-46076636 TCTGATAAAAACTGGAAAGAAGG + Intergenic
990767866 5:59207267-59207289 TTTAATATACAGAGGGAAGAGGG + Intronic
991287739 5:64997887-64997909 TGTGATAAAATGAAGCAAGAAGG + Intronic
992150302 5:73895975-73895997 TCTGATAAACAGATGGATGAGGG - Intronic
992217551 5:74540841-74540863 TTTGAAAGACAGAGGCCAGAGGG + Intergenic
992558190 5:77923996-77924018 TCCCATAAACAGAAACAAGAAGG + Intergenic
995280957 5:110335214-110335236 TAGGATAAAGAGAGGCAAAATGG + Intronic
996034275 5:118740452-118740474 TCAGATGAACAGAGGAGAGAAGG - Intergenic
997372079 5:133368433-133368455 TAAGATCAACAGAGGGAAGAGGG - Intronic
997868632 5:137487414-137487436 TCTGAGACACAGGGGCTAGATGG - Intronic
998662843 5:144259764-144259786 TTTGACAAACAGATGCAAGTAGG + Intronic
1001147080 5:169194408-169194430 TCTGGTCCACAGAGCCAAGATGG - Intronic
1001251358 5:170149333-170149355 CCTGTAAAATAGAGGCAAGAAGG - Intergenic
1001780848 5:174367839-174367861 TAGGAGAAAAAGAGGCAAGATGG + Intergenic
1002414497 5:179112604-179112626 TCTGAGAGACAGAGGCGAGGTGG + Exonic
1003220813 6:4159449-4159471 TCTGACGAACTCAGGCAAGATGG - Intergenic
1003302235 6:4893956-4893978 TCTGAAAAACATTGGCAAGATGG - Intronic
1005089761 6:22043876-22043898 CTTGATAAACAGAGTCAAGGTGG + Intergenic
1005322210 6:24666611-24666633 TCTGAAAAACAAAGGCACAAGGG + Exonic
1006546861 6:34787316-34787338 TTTGTTAAACAGAGGCTTGAAGG + Intergenic
1007228801 6:40333859-40333881 TCAGACAAAGAGAGGGAAGAAGG - Intergenic
1007743806 6:44029938-44029960 TTGGATAGAAAGAGGCAAGATGG - Intergenic
1008875276 6:56319263-56319285 TCTGGTAGGCAGAGTCAAGAGGG + Intronic
1009682163 6:66909745-66909767 TCAGATAAACAGAAGAAATAAGG + Intergenic
1011425170 6:87220385-87220407 TCTGAAAAACAGGGACAATAAGG - Intronic
1012779245 6:103535886-103535908 TCAGAAAAACAGAGGGAAGAGGG - Intergenic
1013189659 6:107791458-107791480 TCTGAGAAACCTAGGAAAGAAGG + Intronic
1015193742 6:130502013-130502035 TAAGATAAACATAGGCAGGAAGG + Intergenic
1016442543 6:144098661-144098683 TCTTATACACAGAGGTGAGATGG - Intergenic
1016476280 6:144432903-144432925 TTTGTTAAACAGATGCTAGAAGG - Intronic
1016591457 6:145749619-145749641 TATGTGAAACAGAGACAAGAAGG + Intergenic
1018173499 6:161160551-161160573 CCTGGTAAACAGAGGGAAGTTGG - Intronic
1018432973 6:163737384-163737406 CCTGAAAAACAGCAGCAAGAGGG - Intergenic
1018584344 6:165339298-165339320 TATGATGGACAGAGACAAGAAGG - Exonic
1019120875 6:169802324-169802346 TCTGAGAAACTGAGGCAGGAGGG - Intergenic
1019636652 7:2079567-2079589 CCAGATAAACAGAGGCCACACGG + Intronic
1020831922 7:13103448-13103470 TTTGTTAAACAGAGGCTTGAAGG + Intergenic
1020879338 7:13739285-13739307 TCAGATAAGCAGAGACAAAAAGG + Intergenic
1021351964 7:19604876-19604898 TTAGATAAACAGAAGCAACAGGG - Intergenic
1022164338 7:27742391-27742413 TCTGTTAAACAGATGCTTGAAGG - Intronic
1022188014 7:27987964-27987986 TTTGTTAAACAGAGGCTTGAAGG + Intronic
1022845744 7:34207998-34208020 TTTAAGAAACAGAGGGAAGATGG + Intergenic
1022859625 7:34354224-34354246 TCTCATATGCAGAGGCCAGATGG - Intergenic
1023154126 7:37231040-37231062 ACTGATAAATACAGGCAAAAAGG + Intronic
1023237147 7:38101323-38101345 TCAAATACACAGAGGGAAGAAGG + Intergenic
1024406378 7:48986321-48986343 GCTGATAAAAACAAGCAAGAAGG - Intergenic
1025595269 7:62915633-62915655 TCTGATAAAAACTGGAAAGAAGG + Intergenic
1027056300 7:75052327-75052349 TCGGGGAAACAGAGGCACGATGG - Intronic
1027532341 7:79352521-79352543 TCTGCTAAGCAGAAGCATGAGGG + Intronic
1027552131 7:79612282-79612304 ACTGATCCACAGATGCAAGAGGG + Intergenic
1028242743 7:88440629-88440651 TTTGTAAAAGAGAGGCAAGAAGG - Intergenic
1028752008 7:94393317-94393339 TCTAAGAAACAGAAGCAAGTGGG - Intergenic
1029850658 7:103458026-103458048 TCTGATAAAAAGAAGCAACGGGG - Intergenic
1030159460 7:106492611-106492633 ACTGAAAAACAGAGGGAAGGAGG + Intergenic
1030163179 7:106529011-106529033 CCTGAGAAACTGAGGCAGGAAGG + Intergenic
1030929135 7:115500490-115500512 TGAGAGTAACAGAGGCAAGAAGG - Intergenic
1031351916 7:120743461-120743483 TTTTATAAACAGAGGCTAAATGG - Intronic
1032528730 7:132602409-132602431 GCTGGTAGACAGAGGCAACATGG - Intronic
1033769954 7:144538871-144538893 TCTAATATACAGAGGCTATAAGG + Intronic
1033923662 7:146428628-146428650 TCTAATATACAGAGGCTACAAGG - Intronic
1034583679 7:152069664-152069686 TCTGATAATCAGGGACAAAAAGG - Intronic
1034842306 7:154410359-154410381 GCTGATAAACAGATGCAAACTGG + Intronic
1038288665 8:26228648-26228670 GCTGATAAGCAGAGGCACAACGG - Intergenic
1038650852 8:29402009-29402031 TCTGATAAAGAGAGGGAAGAGGG - Intergenic
1039311883 8:36325224-36325246 TTGGATACACAGAGGCAGGATGG - Intergenic
1039418247 8:37414143-37414165 TGTGAGAGACAGAGGCAGGAAGG - Intergenic
1040114902 8:43605586-43605608 TCAGATAAAAACTGGCAAGAAGG + Intergenic
1041134229 8:54739067-54739089 TCTGATGAAAAGAAGCAAGCTGG + Intergenic
1041321526 8:56618740-56618762 TCTGAGAGACAGAAGGAAGAAGG - Intergenic
1041532853 8:58891115-58891137 GGTGATAAAGAGAGGAAAGATGG + Intronic
1041562909 8:59240714-59240736 TGTGATAAGCAAAGGCAAAAAGG - Intergenic
1042975324 8:74462698-74462720 TGTGTCAAACAGAAGCAAGAAGG - Intronic
1045592973 8:103618950-103618972 ACAGATAAAGAGAGGCAAAAAGG + Intronic
1045850969 8:106697504-106697526 TCGGATAACCAGCTGCAAGAGGG - Intronic
1046599336 8:116298156-116298178 TTTGTTAAACAGAGGCTTGAAGG + Intergenic
1046736126 8:117778170-117778192 TTTGTTAAACAGAGGCTTGAAGG + Intergenic
1048075221 8:131062497-131062519 TCTGAGAAACACTGTCAAGAAGG + Intergenic
1048535354 8:135289212-135289234 TCTGATAAAAAGAAGGAAGAAGG + Intergenic
1048708248 8:137178794-137178816 TCTGGTCAAAACAGGCAAGAAGG - Intergenic
1050696913 9:8289690-8289712 TCAGAGAAATAGAGCCAAGAAGG - Intergenic
1050709730 9:8447812-8447834 TGTGAAAAACAGAGGAAGGAGGG + Intronic
1050764533 9:9115670-9115692 TGTGATAAACATAGGCATGCAGG - Intronic
1051363393 9:16302381-16302403 ACTGATATACAGTGGTAAGAAGG + Intergenic
1051774149 9:20615913-20615935 TCTTAAAAACAGTGACAAGAGGG - Intronic
1052531262 9:29687226-29687248 TCTGAAAAACAGAGAGAAAACGG + Intergenic
1054972462 9:71104555-71104577 TCTGAAAACCAGAGATAAGAAGG + Intronic
1055157981 9:73087945-73087967 TCTGTTAAACAGATGCTTGAAGG - Intergenic
1055173772 9:73292490-73292512 TGTTATAACCAGAGGCAAGAGGG + Intergenic
1055902553 9:81257871-81257893 TCTAATACCCAGAGGCAAAAAGG + Intergenic
1057282708 9:93724416-93724438 TCTGAGAAAGAGAGTTAAGATGG - Intergenic
1057851444 9:98569710-98569732 GCTGAAAAACAGAGACCAGATGG - Intronic
1058169722 9:101665959-101665981 TCTGATAACCACTGACAAGAAGG + Intronic
1059102990 9:111487483-111487505 TGTCAAAAACAGAGGCAAGAAGG + Intergenic
1060561229 9:124545401-124545423 TCTGCTAAATGGAGGCAACAGGG + Intronic
1188862356 X:35272345-35272367 TCAGATAAACAGTGCCAAAAGGG - Intergenic
1189421889 X:40863430-40863452 TTTGTTAAACAGATGCTAGAAGG + Intergenic
1190962374 X:55265155-55265177 CCTCATAAATAGAGGGAAGAGGG + Intronic
1191166164 X:57394236-57394258 TCTGGTAAAGATGGGCAAGAAGG + Intronic
1191593552 X:62916426-62916448 TTTGGAAAACAGAGCCAAGAAGG + Intergenic
1192324929 X:70123660-70123682 TTTGTTAAACAGATGCTAGAAGG + Intergenic
1192702458 X:73489795-73489817 CCTGACAAAAATAGGCAAGAGGG - Intergenic
1192753517 X:74020163-74020185 AATGATAAAAAGAGGCAAGTTGG + Intergenic
1193847476 X:86492388-86492410 TCTGGGAAACTGAGGCAAGAAGG - Intronic
1194427866 X:93762221-93762243 TAAGATAAACAGAGACAAAATGG - Intergenic
1194455054 X:94093517-94093539 TCTGATAACCAGAGGTAAGCTGG - Intergenic
1195104264 X:101588167-101588189 TCTAATAAACAGAGACTACAAGG - Intergenic
1195574754 X:106437361-106437383 TCAGACAAACACAGGCAAAAAGG - Intergenic
1195864648 X:109416491-109416513 TCTGAAAAACAGAGGGAAAAAGG + Intronic
1196191270 X:112797222-112797244 TATGATAGACAAAGGAAAGAGGG - Intronic
1198503295 X:137275543-137275565 TCTAATAAACAGTTGCATGAAGG - Intergenic
1199565766 X:149214251-149214273 TTTTCTAACCAGAGGCAAGAAGG - Intergenic
1201282923 Y:12356759-12356781 TGAGATAAACAGAGGAAAAAGGG - Intergenic
1201756913 Y:17496328-17496350 TCTGACAAACACAAGCAACAGGG + Intergenic
1201844640 Y:18409656-18409678 TCTGACAAACACAAGCAACAGGG - Intergenic