ID: 1117665617

View in Genome Browser
Species Human (GRCh38)
Location 14:58053049-58053071
Sequence GATGGATTCAAGAGTAATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 1, 2: 8, 3: 43, 4: 305}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117665617 Original CRISPR GATGGATTCAAGAGTAATTT AGG (reversed) Intronic
902973419 1:20071608-20071630 GATGGATTCACAAGACATTTTGG + Intronic
903188480 1:21642761-21642783 GCTGGATTCAAGACTGAGTTGGG - Intronic
904781673 1:32954306-32954328 TGTGGATTCATGAGTAATTTGGG - Intronic
905975392 1:42170574-42170596 GATGGACTCAATAGAACTTTAGG - Intergenic
906163039 1:43664883-43664905 GATGGATCCCAGAGTCCTTTAGG + Intronic
907114960 1:51960219-51960241 GATGCGTTCAAGAGAAATTGGGG + Intronic
907659512 1:56378909-56378931 GATGGCTTCAAGATAAATTAGGG - Intergenic
907703719 1:56814849-56814871 GTAGGCTTCAAGAGCAATTTTGG - Intronic
907851344 1:58258072-58258094 TATGCATTCAAGGATAATTTGGG + Intronic
907998691 1:59658846-59658868 GATGCATTCAAAAGAGATTTGGG + Intronic
910200572 1:84694130-84694152 CATGGATAAAGGAGTAATTTTGG + Intergenic
910980000 1:92950589-92950611 GATGCATTCAAAAGTTATTTGGG + Intronic
912166425 1:107046976-107046998 GATGGATTTAAGACTGATCTCGG - Intergenic
912167058 1:107054549-107054571 GATGGATTCAAGATATATTTTGG + Intergenic
913355475 1:117916647-117916669 AATAGATTTAAGATTAATTTAGG + Intronic
914833475 1:151188358-151188380 GAAAGATTCAAGAGAAATTAAGG - Intronic
914941752 1:152029253-152029275 GATGGATTCAAGGGATATTTGGG - Intergenic
916323541 1:163532740-163532762 GATTCATTCAAGCATAATTTGGG + Intergenic
918430907 1:184459867-184459889 GATGGATGCAAAAGTTTTTTGGG - Intronic
918577243 1:186077454-186077476 TATGGATTTATGAGTATTTTAGG + Intronic
918992161 1:191711137-191711159 GGTGGATTTAAGAGTTATTTAGG - Intergenic
919120517 1:193334533-193334555 AATGGATTTAAGAGTAATCAAGG - Intergenic
919312644 1:195930636-195930658 ACTGGATGAAAGAGTAATTTGGG - Intergenic
920137779 1:203784067-203784089 GATGGATTCAAATATAATTGTGG + Intergenic
920188118 1:204174877-204174899 GATGGATTTGAGAGAAATTTAGG + Intergenic
921488832 1:215748952-215748974 GATGGATTCAAAAGTGTTTGAGG - Intronic
921531705 1:216290924-216290946 AATGGATCCAAGAGATATTTAGG - Intronic
921658016 1:217763751-217763773 TATGGATTCAAGATGTATTTTGG + Intronic
921772220 1:219054245-219054267 GATTGATGCAAAAGTAATTGTGG + Intergenic
923484329 1:234414662-234414684 CATGGATTCAAGAGTGGGTTGGG + Intronic
1063723333 10:8608376-8608398 GTTTGACCCAAGAGTAATTTAGG - Intergenic
1063862139 10:10322521-10322543 TATGGATTTAAGACTAATTCTGG - Intergenic
1065154061 10:22851759-22851781 GATGGATTTGAGAGGTATTTAGG + Intergenic
1067253363 10:44608941-44608963 GATTGATTCAAGAATCATTTAGG + Intergenic
1067771474 10:49129704-49129726 GATGCCTTCAAGACTTATTTGGG - Intergenic
1067783032 10:49222928-49222950 TATGGAGTCAAGGGTTATTTTGG - Intergenic
1068787379 10:60991045-60991067 AATGGATTCAAGAGATATGTAGG - Intronic
1069381071 10:67843560-67843582 CATGGAGTCAAGAATTATTTTGG + Intergenic
1070230584 10:74562431-74562453 GATGGATTCAAGAGTATATTGGG + Intronic
1070636363 10:78131357-78131379 AGTGGATTCAAGTGTAACTTTGG + Intergenic
1072089572 10:92114198-92114220 GTTGTTTTCAAGAGTGATTTTGG - Intronic
1072778652 10:98227353-98227375 AATGGATTCAAGAGTTTTATTGG - Intronic
1072990379 10:100186778-100186800 GATGAATACAAGAGAAATTAAGG + Exonic
1074870388 10:117571364-117571386 TCTGGATTCATGAGTAATTAAGG - Intergenic
1074978392 10:118599480-118599502 GATGGAAGCAAGAGACATTTGGG - Intergenic
1075249708 10:120855743-120855765 GATCTATTTAATAGTAATTTTGG + Intronic
1075429296 10:122366941-122366963 GATGGATTCAAAAGATGTTTAGG + Intergenic
1075731740 10:124640447-124640469 CATGGATTTAAGAATGATTTAGG - Intronic
1077564505 11:3288666-3288688 GGTTGATGCAAAAGTAATTTTGG + Intergenic
1077570394 11:3334483-3334505 GGTTGATGCAAAAGTAATTTTGG + Intergenic
1077922590 11:6652863-6652885 GATGGTTTCAAGAGCTCTTTAGG - Intronic
1079890880 11:26051400-26051422 TATGGATCAAGGAGTAATTTTGG + Intergenic
1079906204 11:26250534-26250556 GATGAATCCAACAGAAATTTTGG - Intergenic
1081651817 11:44828859-44828881 GGTAGATTCAAGAGCTATTTAGG - Intronic
1084656280 11:70521111-70521133 GATAGCTTCAACAGAAATTTAGG + Intronic
1085529943 11:77185839-77185861 TATGGATCAAGGAGTAATTTTGG - Intronic
1085724801 11:78945040-78945062 GATGAAAGCAAGAGTAATTTTGG + Intronic
1088244596 11:107805225-107805247 GGTGGATGCAAGAGTAATTGTGG - Intronic
1088272010 11:108043563-108043585 GAGGGTTTCAAGAGTAGATTTGG + Intronic
1088837245 11:113588139-113588161 GATGGATCCAAGACTAGCTTAGG + Intergenic
1089209978 11:116793134-116793156 GATTGATTCAAGATGCATTTAGG - Intergenic
1090649778 11:128796143-128796165 AATGGATTCACGAGAAATTATGG + Intronic
1092067107 12:5599862-5599884 GAAGAATTCAAAAGTATTTTGGG - Intronic
1093371959 12:18376278-18376300 TATGGAGTCAAGGGTTATTTTGG + Intronic
1093623509 12:21320405-21320427 AATGGATTCAAGAGCAAGATTGG - Intronic
1095301217 12:40586145-40586167 CATGTATACAACAGTAATTTAGG - Intergenic
1095434602 12:42173690-42173712 AATGGAAGCAAGAGTAATCTTGG - Intronic
1095539386 12:43290866-43290888 GATGGCTTCAAGAAAGATTTAGG + Intergenic
1096422170 12:51468303-51468325 GATGGATTCAAGAGCTAATCAGG - Intronic
1098744171 12:74214388-74214410 CATGGATCAAAGAGTAATTTTGG - Intergenic
1099306630 12:80964881-80964903 GATGGATTTGAGAGTTACTTAGG - Intronic
1099707441 12:86175379-86175401 AGTGGATTTAAGAGAAATTTAGG - Intronic
1100921506 12:99493525-99493547 GATGGATTTGAGAGATATTTAGG + Intronic
1100987603 12:100218496-100218518 GAAGGATTAAAGAGTATTTCCGG - Exonic
1102236555 12:111297603-111297625 GCTTGAGTCCAGAGTAATTTAGG - Intronic
1102310369 12:111840335-111840357 GATGGATTTAAGACATATTTTGG - Intergenic
1103300536 12:119922982-119923004 GCAGGATTCAAAAGTGATTTTGG + Intergenic
1103802332 12:123546929-123546951 GATGGATTTGAGAGAAATTTTGG - Intergenic
1104143993 12:126015158-126015180 CATGGATCAAAGAGTAATTCTGG - Intergenic
1104533979 12:129600592-129600614 CATGGATCAAGGAGTAATTTTGG - Intronic
1104991807 12:132628832-132628854 GAGGGATTCAAGACTATTGTGGG - Intronic
1107600303 13:42006047-42006069 GATGAATCCAAAAGAAATTTAGG - Intergenic
1108185891 13:47888157-47888179 GATGGATTCAGGAGAATTCTAGG - Intergenic
1108743768 13:53367929-53367951 GGTGGGTTCAAAAGTAATTGCGG - Intergenic
1109036787 13:57273068-57273090 AAGGGATTAATGAGTAATTTTGG + Intergenic
1110030557 13:70606492-70606514 TATGAATTCAAAATTAATTTTGG + Intergenic
1110098732 13:71567908-71567930 GATTCATTCAAGAGAATTTTGGG + Intronic
1110463885 13:75778993-75779015 AATGAATTCAAGAGATATTTAGG + Intronic
1110676201 13:78248314-78248336 AATGGAATCAAGATAAATTTGGG - Intergenic
1110813007 13:79830958-79830980 GATGCATGCAAGAGAAATATCGG - Intergenic
1110910179 13:80950667-80950689 GATGGATTCAAGAGCTATTTTGG + Intergenic
1111242224 13:85490066-85490088 GATGGATTTAAGATAAATTATGG - Intergenic
1113058139 13:106291171-106291193 AATGGATTCAAGAATTGTTTAGG + Intergenic
1114223663 14:20719115-20719137 CATGGATCAAGGAGTAATTTTGG - Intergenic
1115001581 14:28427288-28427310 TCTGGATTTAAAAGTAATTTAGG - Intergenic
1117172021 14:53110176-53110198 GATGAATTTGAGAGTGATTTAGG - Intronic
1117434362 14:55702034-55702056 GATGGGTTCAGGAGTTACTTAGG + Intergenic
1117665617 14:58053049-58053071 GATGGATTCAAGAGTAATTTAGG - Intronic
1118384372 14:65243531-65243553 GATGGATTCTAGAGGCATTTAGG + Intergenic
1119038429 14:71250379-71250401 AATGTATTCTAGAGTAATTACGG + Intergenic
1120084674 14:80257337-80257359 GATTGGTGCAAAAGTAATTTCGG - Intronic
1120793826 14:88609488-88609510 GATGGTTTCAGAAATAATTTTGG + Intronic
1120882013 14:89420914-89420936 GGTGGATCCAAGATGAATTTCGG + Intronic
1121416666 14:93783981-93784003 GATGGATTCAAGAATGATTTAGG - Intronic
1122042745 14:99000686-99000708 GATGGATTGAAAACAAATTTTGG + Intergenic
1122600476 14:102919045-102919067 GATGGATAGAAGAGTGATTATGG - Intergenic
1123835555 15:24187957-24187979 GATGAATTGAAGATTGATTTAGG + Intergenic
1123850323 15:24349313-24349335 GATGAATTGAAGAGTGATTTAGG + Intergenic
1123855261 15:24403873-24403895 GATGAATTGAAGAGTGATTCAGG + Intergenic
1123871288 15:24576807-24576829 GATGAATTGAAGAGTGATTCAGG + Intergenic
1124215297 15:27802722-27802744 TATGGATTCAAGTTTATTTTGGG - Intronic
1126326340 15:47481538-47481560 GATGGATACAAGACTGTTTTAGG + Intronic
1126657685 15:50996929-50996951 CCTGCATTCAAGAGTAACTTAGG + Intronic
1127492705 15:59480065-59480087 GATGGATTCTGGAGTGATTTTGG + Intronic
1129490815 15:75923873-75923895 AATGGATTCAAGATGAAGTTTGG + Intronic
1130922162 15:88356841-88356863 GACAGATTCAAGAGGCATTTAGG + Intergenic
1132118950 15:99159923-99159945 GATGCATTCAAGATCTATTTTGG + Intronic
1132157568 15:99506945-99506967 GGTTGATGCAAGAGTAATTGAGG - Intergenic
1134163784 16:11914988-11915010 GATGGAGCCAGGAGTCATTTGGG - Intronic
1134268245 16:12710243-12710265 GAAGGATTTAAGAGATATTTGGG + Intronic
1135052528 16:19204348-19204370 GAGGGATCCAGGAGTGATTTTGG + Intronic
1137737482 16:50735719-50735741 GATGGATTCCAGAGACATTTTGG + Intergenic
1137752253 16:50874548-50874570 AATGCTTTCAAAAGTAATTTAGG - Intergenic
1138512557 16:57516975-57516997 GATGGACTCAAGAGACCTTTAGG - Intronic
1138868857 16:60856117-60856139 GATGCATTAAGGAGTAATTGAGG + Intergenic
1139083342 16:63553223-63553245 AATGGATGCATGTGTAATTTGGG + Intergenic
1140644153 16:77011534-77011556 AATGGATTCAAGAAGTATTTAGG - Intergenic
1143042635 17:4050600-4050622 GATGGATTTTAGAGAAATGTTGG - Intronic
1143289765 17:5820012-5820034 GATGGATTCGAGAGATGTTTGGG - Intronic
1144189290 17:12829344-12829366 AAGGGTTTCAAGAGTGATTTGGG - Intronic
1144196698 17:12901634-12901656 CATGGATTCAACAGTCACTTGGG - Intronic
1145917256 17:28582045-28582067 AATGGATTCAATAGATATTTAGG - Intronic
1147473305 17:40684882-40684904 GATGAAATAAAGAGTCATTTGGG + Intergenic
1148146621 17:45369630-45369652 GATGGATCCAACAGGACTTTGGG + Intergenic
1148191638 17:45682583-45682605 GACGGATTGAGGAGGAATTTAGG - Intergenic
1148648743 17:49234455-49234477 GTTACCTTCAAGAGTAATTTAGG + Intergenic
1149006597 17:51812595-51812617 GATGGATTCAAGAAATGTTTAGG + Intronic
1149403680 17:56325159-56325181 GATGACTTCAGGAGTAATTTTGG - Intronic
1150089564 17:62311068-62311090 GATGGATAACAGAGTGATTTGGG + Intergenic
1150175195 17:63047447-63047469 GATGGATTCAAGAGACATTTAGG + Intronic
1150253928 17:63728964-63728986 GATTAAGTCAAGAGAAATTTAGG - Intronic
1150674629 17:67234403-67234425 AAAGGATTCAAGAGTTATCTTGG - Intronic
1150947309 17:69761961-69761983 GATGGATGAAAGAGTAAGTGAGG + Intergenic
1151085438 17:71374959-71374981 AATGGATACAATATTAATTTGGG - Intergenic
1152982477 18:291578-291600 GATTGATGCAAAAGTAATTGCGG + Intergenic
1155049711 18:22135943-22135965 GATGGATTCAAGAAACGTTTGGG + Intergenic
1156354167 18:36327420-36327442 GATGGGTGCAAAAGTAATTGCGG - Intronic
1159492535 18:69156357-69156379 GGTTGGTTCAAGAGTAATTATGG + Intergenic
1159844134 18:73438405-73438427 GATGGATCCAAATTTAATTTCGG + Intergenic
1159885984 18:73907460-73907482 GGTGGATGCAAAAGTAATTGAGG - Intergenic
1160158098 18:76449106-76449128 CATGGATTCAAGAGTGAGTTGGG - Intronic
1165125228 19:33590508-33590530 CATGGATCAAGGAGTAATTTTGG + Intergenic
1166658160 19:44627317-44627339 GATGGATTGAAGAGACACTTGGG + Intronic
1168460769 19:56555351-56555373 GATGGATTCCAGAGAAATTTGGG - Exonic
925680870 2:6420203-6420225 ACTGGAGTCAAGAGTGATTTGGG - Intergenic
925737937 2:6980513-6980535 CATGGAATCAAAAGTGATTTTGG - Intronic
925832301 2:7907696-7907718 GATGAATTCAAGATCCATTTAGG - Intergenic
926435413 2:12832752-12832774 GATGTTTTAAAAAGTAATTTAGG - Intergenic
928970485 2:37022842-37022864 GATGTATTCCAAAATAATTTTGG - Intronic
929021145 2:37554512-37554534 GAAGGATTCAAGACAAATGTAGG + Intergenic
929727911 2:44450737-44450759 TGTGGAGTCCAGAGTAATTTTGG + Intronic
930697400 2:54426021-54426043 GATGGATTCAAGAAAAAGTTAGG - Intergenic
931313952 2:61109104-61109126 GATTCATTCAAAAGAAATTTAGG + Intronic
931909780 2:66886335-66886357 CATGGATTCAAGAGTACTTAGGG + Intergenic
935522501 2:104124868-104124890 CATTCATTCAACAGTAATTTTGG - Intergenic
939092527 2:137795863-137795885 AATAGTTTCAAGAGAAATTTAGG - Intergenic
940479514 2:154210843-154210865 GATGGAATCAAGATATATTTAGG + Intronic
941979638 2:171440859-171440881 GATGGATCTAAGAATAATTATGG + Intronic
944375985 2:199042574-199042596 AATGGATTCAAGAGGTATTTAGG - Intergenic
944449170 2:199823489-199823511 CATGGATCAAGGAGTAATTTTGG - Intronic
944485109 2:200197251-200197273 AATGGATTTAAGAGACATTTTGG + Intergenic
944766950 2:202873279-202873301 GATGGATTCAACATTCATTCAGG - Intergenic
945383707 2:209172022-209172044 GATGGATCAAGGAGTAATTTTGG + Intergenic
945978191 2:216286842-216286864 GATGGATTCAAGCTAAACTTAGG + Intronic
946259078 2:218470315-218470337 GATGGATTCAAGAGATGCTTAGG - Intronic
947084095 2:226431497-226431519 GAGACATTCAAGAGGAATTTGGG + Intergenic
1168888938 20:1281199-1281221 GGTGGCTTCAAGAGAAATTTAGG - Intronic
1169763658 20:9125066-9125088 GATGGAGTCAAGCGTATTTCAGG - Intronic
1170036944 20:11999550-11999572 GATTGGTTCAAAAGTAATTGCGG - Intergenic
1171441013 20:25162995-25163017 GATGGCTTCAACATAAATTTTGG - Intergenic
1172525278 20:35597226-35597248 AATGGATTCCAGAGAAAATTTGG - Intergenic
1172834258 20:37862833-37862855 GATGGATTCAAGGTTGAGTTCGG - Intronic
1173073584 20:39794543-39794565 GGTGGATTCAAGAGAAATTTGGG + Intergenic
1173314763 20:41933065-41933087 CATGGAGTCAAGGATAATTTTGG + Intergenic
1173903872 20:46611623-46611645 GATAGATTTGAGAGTAATTTGGG - Intronic
1174676143 20:52358112-52358134 GATGGAATCAAGAAATATTTAGG - Intergenic
1176638883 21:9278042-9278064 AGTGTACTCAAGAGTAATTTAGG + Intergenic
1177194719 21:17891717-17891739 GGTGGATGCAAAAGTAATTGCGG + Intergenic
1177351522 21:19948429-19948451 ATTGGACTCAATAGTAATTTTGG - Intergenic
1177598813 21:23283703-23283725 TAAGGATTCAAGAAGAATTTAGG + Intergenic
1178558883 21:33619235-33619257 GATGGATTCAAGACATATTGAGG - Intronic
1179021097 21:37641883-37641905 AATGGATTCAAGACATATTTAGG + Intronic
1179328524 21:40375162-40375184 GATGGATTCAGGATATATTTTGG - Intronic
1179582920 21:42355626-42355648 GATGGATTCATGGGTTATTGTGG + Intergenic
1180372188 22:12050886-12050908 AGTGTACTCAAGAGTAATTTAGG + Intergenic
1180422926 22:12885548-12885570 AGTGTACTCAAGAGTAATTTAGG + Intergenic
1180927762 22:19567876-19567898 GAAGGATTCCAGAGAGATTTTGG + Intergenic
1182272587 22:29164810-29164832 CAGGGATTCAAGAGCAGTTTAGG + Intronic
1182449769 22:30412509-30412531 GATGGATTTAAGAATTATTTAGG + Intronic
1182866833 22:33611390-33611412 CATGGAGTCAAGAATTATTTTGG + Intronic
1182996086 22:34813646-34813668 GATGCATTCAAGGGAAAGTTGGG - Intergenic
949089942 3:15236-15258 GATGGATTTAAGGATATTTTAGG - Intergenic
949840060 3:8310879-8310901 TATGGAATCCAGAGAAATTTAGG - Intergenic
950828193 3:15847693-15847715 GATGGATTCCAGAGATACTTAGG - Intronic
950972004 3:17198311-17198333 GATGGATTTAAGGGTAATCTAGG + Intronic
951359019 3:21702679-21702701 GAAGCATTCAAGAGTGACTTGGG - Intronic
952697851 3:36290954-36290976 AAGGGACTCAAGTGTAATTTTGG + Intergenic
953396346 3:42573717-42573739 GATGGACTCAATAGAAATATGGG + Intronic
953474465 3:43194021-43194043 GATGGAGTGAAGAATAATTTTGG - Intergenic
953729965 3:45438872-45438894 GATGGAGGAAAGAGCAATTTGGG + Intronic
954159313 3:48709169-48709191 GATGAATTCATGTGTCATTTGGG - Intronic
955331676 3:58052363-58052385 GCTGGATCCAAGAGTAGTTTTGG - Intronic
955799527 3:62671518-62671540 GAAGGATTCAAGAGATATTTAGG - Intronic
956070939 3:65450386-65450408 AATGGATCCAAGAGATATTTAGG + Intronic
956411622 3:68985620-68985642 GATGCATTCAAGACATATTTTGG - Intronic
957029614 3:75224963-75224985 GATGGATTTAAGGATATTTTAGG - Intergenic
957572548 3:81966496-81966518 AATAGTTTCAAGAGTTATTTGGG + Intergenic
958445907 3:94214705-94214727 GATAGATTGAAGAGAAATTGAGG - Intergenic
958933277 3:100230302-100230324 CATGGATCAAGGAGTAATTTTGG + Intergenic
959502844 3:107126404-107126426 GATAAATTCAAGAGATATTTAGG + Intergenic
959548801 3:107630278-107630300 GATTGATTCAAAAATAATTGTGG + Intronic
959880208 3:111436355-111436377 TCTGGATTCATGAGTAATTTTGG + Intronic
961032657 3:123620067-123620089 GATAAATTCAGAAGTAATTTTGG - Intronic
961230261 3:125300369-125300391 GAGGGATTCAGTAGTAGTTTTGG - Intronic
961235522 3:125363104-125363126 GATGGTTTAAAGATTATTTTGGG - Intronic
962257238 3:133880873-133880895 GATTGATTCAAGAGTAGTGATGG + Intronic
963223837 3:142840552-142840574 GATGGACACAAAGGTAATTTTGG + Intronic
964076525 3:152699696-152699718 TATGGATCAAGGAGTAATTTGGG - Intergenic
964581577 3:158245274-158245296 TATGTACTCAAGAGTCATTTAGG + Intronic
964666840 3:159183863-159183885 GATGGATTCAAGAAACATTTTGG - Intronic
964961430 3:162432650-162432672 GATGGGTGCAAAAGTAATTGCGG - Intergenic
965371627 3:167869623-167869645 ACTGTATTCAAGAATAATTTAGG - Intergenic
965654235 3:170966892-170966914 GATAGATTCAAGAGTAACAAAGG - Intergenic
967541283 3:190670634-190670656 GATGGATCCAAGAGGAGCTTGGG - Intergenic
1202748012 3_GL000221v1_random:126977-126999 AGTGTACTCAAGAGTAATTTAGG - Intergenic
971609821 4:28708876-28708898 CATGGATCAAGGAGTAATTTTGG + Intergenic
972568494 4:40289719-40289741 GATGAATTTGAGAGCAATTTTGG + Intergenic
972732894 4:41812657-41812679 GACAGATGCAAGAGCAATTTAGG - Intergenic
972862515 4:43188040-43188062 GTTAGATTCAAGAGAAATATAGG + Intergenic
973791055 4:54378552-54378574 GAAGGATTAAAGAGTTCTTTAGG - Intergenic
975332123 4:73128423-73128445 CAGGGTTTAAAGAGTAATTTAGG + Intronic
977492158 4:97729375-97729397 GATTGATGCAAAAGTAATTGTGG - Intronic
979539807 4:121869125-121869147 GACAGATTCAAGAGATATTTGGG + Intronic
982837642 4:160142309-160142331 GATGGATCCAAGATTAAAATGGG - Intergenic
983054844 4:163089747-163089769 GATAGATTTTAGAGTTATTTTGG + Intergenic
984394928 4:179185373-179185395 GATGTATTGAAGATTAAATTTGG - Intergenic
984487464 4:180389012-180389034 GATGGATTCCAGAGACACTTAGG + Intergenic
1202753771 4_GL000008v2_random:36454-36476 AGTGTACTCAAGAGTAATTTAGG + Intergenic
986182937 5:5410418-5410440 GATATATTCAAGAGACATTTGGG + Intergenic
988746053 5:34139438-34139460 GAAGATCTCAAGAGTAATTTAGG - Intergenic
989206817 5:38817414-38817436 GATGGATCCAAGAGTTTTATTGG - Intergenic
989447498 5:41547736-41547758 GAAGAATGGAAGAGTAATTTTGG - Intergenic
993724605 5:91353640-91353662 GAGGGATACAAGAATAATTTGGG - Intergenic
993771360 5:91931862-91931884 AAAGGATTCAAGAGATATTTAGG - Intergenic
994996965 5:107076284-107076306 GATGGATTCAAGATATATTTTGG - Intergenic
995376452 5:111479844-111479866 GATGGATTCAAGAGGTGTTTAGG - Intronic
996108642 5:119538291-119538313 GATGAATTCAAGATATATTTTGG - Intronic
996833253 5:127763382-127763404 GATGGATTCAAGAGTGATTTGGG - Intergenic
996950453 5:129119650-129119672 TATGAATTCAACAGGAATTTGGG + Intergenic
997146823 5:131443377-131443399 CATGGATTCAAGAATTATTTAGG - Intronic
997427293 5:133812143-133812165 GTTGAATTCAAGATTTATTTTGG - Intergenic
998000863 5:138624265-138624287 TATGGATTAAAGAGATATTTAGG - Intronic
999085652 5:148886755-148886777 GATGGATTAGGGAGTTATTTAGG + Intergenic
999576696 5:152986680-152986702 GCTGCATTCAAGAGTAAATTAGG + Intergenic
1000013580 5:157257296-157257318 GATCGTTTCAATAGGAATTTTGG - Intergenic
1000139567 5:158388855-158388877 GATGGAGTCAAGAGATATTTCGG - Intergenic
1000266547 5:159643303-159643325 GATTGATGCAAAAGTAATTGTGG + Intergenic
1000407282 5:160901606-160901628 GATGCAATGAAGAGTAATTGAGG + Intergenic
1004638364 6:17490135-17490157 GCTGCATTCCAGGGTAATTTAGG - Intronic
1004881356 6:20011690-20011712 GATTGATGCAAAAGTAATTGTGG + Intergenic
1004889288 6:20083614-20083636 GATGGAATCAAGAGGTATTTAGG - Intergenic
1005544210 6:26847661-26847683 GAAGATCTCAAGAGTAATTTAGG - Intergenic
1005585740 6:27274792-27274814 GTTGGTTTCAGGAGCAATTTGGG + Intergenic
1005753603 6:28905696-28905718 AATGGATAAAAGAGTGATTTGGG - Intronic
1006654261 6:35576745-35576767 GATTGGTTCAAAAGTAATTGTGG - Intronic
1006971861 6:38053772-38053794 GATGGATTCAAGAGATATTTAGG + Intronic
1007226578 6:40319756-40319778 GATGGATTCAAGGGAAATGGAGG + Intergenic
1007678768 6:43620062-43620084 CATTGTTCCAAGAGTAATTTAGG + Intronic
1009014995 6:57889288-57889310 GAAAATTTCAAGAGTAATTTAGG - Intergenic
1009857586 6:69284324-69284346 GATGGATTCAAGAGGAAGCCTGG - Intronic
1013210715 6:107984208-107984230 GATGGATTCAAGAGATATTTAGG + Intergenic
1013434998 6:110094874-110094896 GATAGATTTAAGAGATATTTAGG - Intergenic
1014856191 6:126404267-126404289 CATGGATCAAGGAGTAATTTTGG + Intergenic
1014939537 6:127421993-127422015 AATGAATTCAAGAGTTTTTTGGG + Intergenic
1015783182 6:136892843-136892865 GATGGATTGGAGATTTATTTAGG - Intronic
1016271011 6:142290425-142290447 TATGAATTAAAGAGTAATCTTGG + Intergenic
1016901284 6:149105352-149105374 GATTGATGCAAAAGTAATTGCGG + Intergenic
1018470428 6:164091526-164091548 GATCGATGCAAAAGTAATTGTGG - Intergenic
1020376724 7:7495668-7495690 GATGGATTTGAGAGATATTTAGG - Intronic
1021386476 7:20036779-20036801 GATTGATGCAAAAGTAATTGTGG + Intergenic
1023552095 7:41381298-41381320 GATGGATTGAAAAGTAAAATAGG - Intergenic
1027412929 7:77941665-77941687 AATGGATTCAAGATATATTTTGG - Intronic
1027790239 7:82632399-82632421 GATGGAGACAAGAAAAATTTTGG - Intergenic
1028396852 7:90379194-90379216 GATGGATTTCAGAGAGATTTAGG - Intronic
1028660990 7:93274668-93274690 CATGGATCAAGGAGTAATTTTGG + Intronic
1030871272 7:114759220-114759242 GATGGATTCAAAATATATTTTGG - Intergenic
1031022223 7:116640589-116640611 GATGGATCCATGAGAAACTTTGG - Intergenic
1031152682 7:118072969-118072991 GATGGATTAAAGAGAACTTGTGG - Intergenic
1033827654 7:145211227-145211249 TATAGATTAAAGAGTAATATAGG - Intergenic
1033958826 7:146887056-146887078 GATGGATAGAAGAGTAAATAAGG - Intronic
1035858638 8:3004431-3004453 GATTGATTTAAGAGTAAAGTGGG - Intronic
1036537842 8:9669034-9669056 AAGGGATTAAGGAGTAATTTAGG + Intronic
1037323937 8:17670034-17670056 GATGGATCCAAGTGGCATTTAGG + Intronic
1037397544 8:18458974-18458996 GCTGAATTCAAGAGTGTTTTTGG - Intergenic
1037622167 8:20574079-20574101 GATGGATTCCGGAATAAATTTGG - Intergenic
1038662336 8:29507883-29507905 GATGTATTAAATAGAAATTTAGG - Intergenic
1039333188 8:36561548-36561570 GCTGCTTTCAAGAGTAATATGGG - Intergenic
1039587030 8:38715343-38715365 CATGGATTAAAGAGGTATTTAGG + Intergenic
1039971265 8:42323522-42323544 CATGGATGAAAGAGTGATTTAGG + Intronic
1041404276 8:57480437-57480459 CATGGATTACAAAGTAATTTTGG + Intergenic
1041854346 8:62433646-62433668 GGTTGATGCAAGAGTAATTGAGG + Intronic
1042628863 8:70793366-70793388 AATGGATTAATGAGTTATTTTGG + Intergenic
1043043310 8:75289703-75289725 GATGAATTCAATAGTACTTTAGG + Intergenic
1043209864 8:77498789-77498811 GATGGCTACTAAAGTAATTTAGG - Intergenic
1045392269 8:101727267-101727289 AATGGATTTAAGACAAATTTTGG - Intronic
1046648637 8:116812809-116812831 GATAGATTCAAGAGAAACGTAGG + Intronic
1047404734 8:124575954-124575976 GGTGGATTCAAGAGCTACTTAGG - Intronic
1048532922 8:135266576-135266598 CATGAATTCAAGAGAACTTTGGG - Intergenic
1048731835 8:137450650-137450672 AATGAATTTAAGAGTAATCTTGG + Intergenic
1049020624 8:139955415-139955437 GATGGATCCAAGAGCAAACTTGG + Intronic
1049065825 8:140313102-140313124 GTTGTATTCAAAAGTAATTCTGG - Intronic
1051004114 9:12321152-12321174 GATCAATTCAAGAATGATTTTGG - Intergenic
1051111780 9:13647042-13647064 AATGGATTTAAAAGAAATTTGGG - Intergenic
1051145464 9:14022814-14022836 GATGGATTGGAAAGTAGTTTAGG - Intergenic
1051728798 9:20116435-20116457 GATGAATTCAAGAGAAACATAGG - Intergenic
1052734500 9:32326687-32326709 GAGGGATTCAAGACTTCTTTGGG - Intergenic
1052833920 9:33236357-33236379 GATGGATTCAAGAGCTATGTAGG + Intronic
1053113802 9:35484666-35484688 GATAGATTCAAGGATGATTTAGG - Intergenic
1055144639 9:72918559-72918581 GAGATTTTCAAGAGTAATTTTGG + Intronic
1055211224 9:73795668-73795690 GATAGATTCAAGAAATATTTGGG - Intergenic
1056283511 9:85064887-85064909 AATGAATTCAAGAGATATTTAGG + Intergenic
1056339242 9:85608862-85608884 GATGGAAGGAAGAATAATTTGGG + Intronic
1058266628 9:102907249-102907271 GATAATTTCATGAGTAATTTGGG - Intergenic
1058507447 9:105680527-105680549 GATTGATGCAAAAGTAATTGTGG - Intergenic
1061552507 9:131345929-131345951 AATAGTTTCAAGATTAATTTTGG + Intergenic
1061554034 9:131355501-131355523 GATGGATTCCATATGAATTTAGG + Intergenic
1203716651 Un_KI270742v1:157060-157082 AGTGTACTCAAGAGTAATTTAGG - Intergenic
1203534560 Un_KI270743v1:21177-21199 AGTGTACTCAAGAGTAATTTAGG + Intergenic
1187302641 X:18065860-18065882 GATGGGTGCAAAAGTAATTGCGG - Intergenic
1187378691 X:18780693-18780715 AATAGATTCAAGAGGAGTTTAGG + Intronic
1189203701 X:39219743-39219765 CATGGATTCATGAGACATTTAGG - Intergenic
1190731432 X:53228689-53228711 GATGGATTCTAGAGCTATTTAGG - Intergenic
1191694452 X:63976008-63976030 GATGGGTTCACTGGTAATTTTGG + Intergenic
1192190238 X:68986843-68986865 GATGGATTTAGGAGTTATTTTGG - Intergenic
1192212065 X:69133976-69133998 GATGGATTCCAGAGCTATTAAGG - Intergenic
1192218658 X:69181530-69181552 AATGGATTCAAGAGCAATGCAGG + Intergenic
1192275388 X:69625002-69625024 AATGGAAGCAAAAGTAATTTGGG - Intronic
1193201130 X:78692327-78692349 GATTGATACAATAGTAATTGTGG + Intergenic
1193611511 X:83636894-83636916 GGTGGATGCAAAAGTAATTGTGG + Intergenic
1194373931 X:93109800-93109822 CATGGATTCAAGGATTATTTTGG - Intergenic
1194722246 X:97354114-97354136 GATGGATTCAAAAGTTATCTAGG - Intronic
1195887923 X:109659943-109659965 GATTGGTGCAAAAGTAATTTTGG - Intronic
1195911401 X:109891581-109891603 GATGGATTCAGGATATATTTTGG - Intergenic
1196035474 X:111139142-111139164 GATGGATTCAAGACCAGTTTAGG + Intronic
1196733601 X:118965122-118965144 GATGGAGAAAAGAGGAATTTAGG - Intergenic
1198446187 X:136716837-136716859 GATGGACTCAATAGTGATCTGGG + Intronic
1200681960 Y:6223871-6223893 CATGGATTCAAGGATTATTTTGG - Intergenic
1201396082 Y:13550560-13550582 AATGGATTAAAGACTAATATAGG - Intergenic