ID: 1117669796

View in Genome Browser
Species Human (GRCh38)
Location 14:58094978-58095000
Sequence ATGCAAATTTACCACTGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117669796 Original CRISPR ATGCAAATTTACCACTGAAT AGG (reversed) Intronic
901118697 1:6871948-6871970 TTGCAAATTTATCACTCAAAGGG - Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
903506650 1:23840546-23840568 CAGCAAACTTTCCACTGAATGGG - Intergenic
904414621 1:30351044-30351066 ATTCATATTGACCACTGAACTGG - Intergenic
908562141 1:65317605-65317627 ATGCAAACTTAACACTGCACAGG - Intronic
909198865 1:72663188-72663210 AAGCAAACTTTCCACTTAATGGG + Intergenic
909487332 1:76188593-76188615 ACACAAATTTTCCACTGTATAGG - Intronic
910968890 1:92834206-92834228 ATGCCACTTAACCACTGAAAAGG + Intronic
911289512 1:96039869-96039891 AAGCAAACTTTCCACTGGATGGG + Intergenic
912567726 1:110600583-110600605 ATGCACATTCACCACAAAATAGG - Intronic
913373372 1:118125478-118125500 ATACAAAATTACCACTAGATAGG - Intronic
913998684 1:143673889-143673911 ATGTTAATTTACCATTGTATAGG + Intergenic
914201006 1:145485655-145485677 ATGGTAATTTACCATTGTATAGG + Intergenic
914480117 1:148058787-148058809 ATGCTAATTTACCATTGTATAGG + Intergenic
914509164 1:148316276-148316298 ATGTTAATTTACCACTGTATAGG + Intergenic
915384703 1:155479459-155479481 ATGCAAATATGGCACTGAACTGG + Exonic
917890191 1:179429352-179429374 ATTCACATTTTCCACTGAACTGG - Intronic
917992189 1:180392457-180392479 ATACAAATTTTACAGTGAATAGG + Intronic
919627810 1:199929238-199929260 CTGCAAATTTTCCACTCCATGGG - Intergenic
921323938 1:213972107-213972129 ATGCAATATTACCACTGGACAGG + Intergenic
922414470 1:225408136-225408158 ATACAAAATTACCACTCGATAGG - Intronic
1063026811 10:2187175-2187197 ATTCAAATTCACCATTGAATTGG + Intergenic
1063741769 10:8830331-8830353 ATGCAAATTGTACACTGACTCGG - Intergenic
1064125391 10:12655429-12655451 ATGAGAAGTTACCAGTGAATGGG - Intronic
1064318041 10:14276456-14276478 AGGGAGATTTCCCACTGAATAGG - Intronic
1065397768 10:25258777-25258799 ATGTAAATTTTCCACTGTACAGG - Intronic
1065986160 10:30954162-30954184 AGCCAAATTTACCACTTTATGGG - Intronic
1067261944 10:44700392-44700414 ATGCAAATCTAGCTCAGAATGGG - Intergenic
1067283699 10:44891951-44891973 ATGCAGAGTTACCATTTAATTGG - Intergenic
1068506115 10:57901012-57901034 ATGCAAATTTACCTATGCACGGG + Intergenic
1068607386 10:59020967-59020989 ATGCAAGTTTAACACTGGAATGG - Intergenic
1069503282 10:68973822-68973844 ATGCAAAGTTACTTCAGAATGGG - Intronic
1070119144 10:73558772-73558794 ACACAAATTTACAACTGTATGGG - Intronic
1071070150 10:81682210-81682232 ATGCAAATTTATTAATGAACAGG + Intergenic
1072148710 10:92667347-92667369 ATACAAATTTTCGACTGCATGGG - Intergenic
1073220581 10:101869148-101869170 ATGCAAATTTTCAACTGCACAGG + Intronic
1074953542 10:118364704-118364726 ATTCAATTTCACCACTGGATGGG - Intergenic
1077652320 11:3984196-3984218 ATGCAAATTTACTTCAGCATTGG + Intronic
1077724112 11:4656869-4656891 ATGCAAATTTACCACTCATAAGG - Intergenic
1082120260 11:48372516-48372538 ATGCAAATTAGTCACTGAAGGGG + Intergenic
1083244745 11:61417991-61418013 ATGTAATTTTACAACTGTATTGG - Intronic
1087059051 11:93960734-93960756 ATGAAAATTTAACACTTAATGGG + Intergenic
1088002113 11:104894805-104894827 ATGCAAATTGACTAATGGATTGG - Intergenic
1091837423 12:3595465-3595487 TTGCTTATTTCCCACTGAATCGG - Intergenic
1093379052 12:18469147-18469169 AAGCAAATTTAACTCTGATTTGG - Intronic
1095516251 12:43009010-43009032 ATGCAAAAGTACAAATGAATGGG - Intergenic
1099339049 12:81403880-81403902 GTGCAATTTGACCTCTGAATTGG - Intronic
1099420017 12:82445972-82445994 ATGCAAATTTTTTACTGCATAGG + Intronic
1100026542 12:90135416-90135438 ATACAAAAGTACCACTAAATAGG + Intergenic
1104233610 12:126909987-126910009 CTGCAATTTTACCATTCAATGGG + Intergenic
1106936000 13:34720723-34720745 AAGCAAATTTTCCACTTGATGGG - Intergenic
1106990310 13:35411257-35411279 AAGCAAACTTTCCACTGGATGGG - Intronic
1107353757 13:39543814-39543836 ATGCAATTTTATAACTGAACAGG - Intronic
1109211894 13:59544788-59544810 ATGGAGAATTACCACTTAATTGG + Intergenic
1111260483 13:85733177-85733199 ATGCAAATTTTACACAGACTGGG - Intergenic
1111758668 13:92433115-92433137 ATGGAAATGAACCACAGAATGGG + Intronic
1114816478 14:25964819-25964841 ATGAAAATTCACCTCTTAATGGG - Intergenic
1114831872 14:26153371-26153393 ATGCGAACTTAGCACTGCATGGG + Intergenic
1116148859 14:41111487-41111509 AAGCAAATTTACAACTATATAGG + Intergenic
1117636565 14:57750826-57750848 CTACAAATTAACCACAGAATGGG - Intronic
1117669796 14:58094978-58095000 ATGCAAATTTACCACTGAATAGG - Intronic
1117793906 14:59371478-59371500 TTGCAAATTGTTCACTGAATCGG + Intergenic
1118104971 14:62648375-62648397 TTGAAAATTTACAACTGTATAGG + Intergenic
1118625846 14:67658175-67658197 ATGCAGATTTTCAACTGAGTAGG + Intronic
1120677379 14:87436711-87436733 AAGGAAATCTATCACTGAATGGG - Intergenic
1202917358 14_GL000194v1_random:188658-188680 CTGCAGATTTAGAACTGAATTGG - Intergenic
1124546374 15:30631332-30631354 AGGCAAAATTATTACTGAATTGG - Intronic
1125365287 15:38907624-38907646 ATGAAAATTGACCACATAATTGG + Intergenic
1126219878 15:46200475-46200497 ATGCAAAATTTCAACTGAACAGG - Intergenic
1126277428 15:46900539-46900561 AAGAAAATTTAGGACTGAATAGG + Intergenic
1127123208 15:55788821-55788843 ATGCCAAATTACCTCTGAAGAGG + Intergenic
1129301545 15:74628476-74628498 ATGCAAACCTACCAATGAAGCGG - Intronic
1130148024 15:81290154-81290176 AGGCAAAGTTACCACTTCATAGG - Intronic
1134364984 16:13568873-13568895 ATGCAAATTTAGCGCCGAAGAGG - Intergenic
1136006138 16:27330597-27330619 ATGCAATTTTATCACGGCATAGG + Intronic
1137348836 16:47692145-47692167 ATGAAAATTTATCACTACATAGG - Intronic
1139145269 16:64316460-64316482 ATACAAATAAATCACTGAATAGG - Intergenic
1139183372 16:64772795-64772817 ATTCAATTATACCACAGAATTGG + Intergenic
1140261039 16:73379816-73379838 ATCCTAATTTACCCCTGAGTTGG - Intergenic
1149145058 17:53480358-53480380 GTGCAAATTTACCATTAGATAGG - Intergenic
1150153146 17:62827383-62827405 ATGCTAATTTACCCTTTAATTGG + Intergenic
1151860054 17:76754151-76754173 ATCCAAAGTTACCAGGGAATAGG - Intronic
1153161599 18:2211302-2211324 ATGCAAATATAAAACTTAATAGG - Intergenic
1153321412 18:3777710-3777732 ACCCAAATTTATCACTGATTTGG - Intronic
1153827563 18:8890078-8890100 ATGGAAATTTTTCACTGCATTGG - Intergenic
1160456099 18:79001813-79001835 ATGGAATTTTACAACTGAAAAGG - Intronic
1162197348 19:8995635-8995657 ATGTAAGTTTCCCACAGAATGGG - Intergenic
1164805710 19:31114989-31115011 TTGCAAATATACCACTTAGTTGG - Intergenic
1168589753 19:57623167-57623189 ATGCAAAATTAACACTTTATAGG - Exonic
1202675228 1_KI270710v1_random:38259-38281 CTGCAGATTTAGAACTGAATTGG - Intergenic
925723307 2:6849066-6849088 ATGCACATTTTCCATTGAACTGG - Exonic
929017246 2:37510778-37510800 ATGCAAATTTTCAACTGCATGGG + Intergenic
929089925 2:38205361-38205383 AAGCAAATTTACCACAGGCTTGG - Intergenic
929470061 2:42182720-42182742 ATACAAAATTACCACAGACTGGG + Intronic
931937889 2:67218588-67218610 ATGTAAATTAACAACTGAAAAGG + Intergenic
934936260 2:98467910-98467932 ATGTAAAATTACCACTAAGTTGG - Intronic
939427374 2:142056711-142056733 ATGCATTTTGCCCACTGAATGGG - Intronic
940493614 2:154397076-154397098 TTGATAATTTTCCACTGAATAGG + Intronic
941335111 2:164232275-164232297 ATCAAAATTTACCACTTAAAAGG - Intergenic
942945990 2:181674090-181674112 ATGCATAATTACTATTGAATAGG - Intronic
945112801 2:206378886-206378908 TTTCAAACTTACCACTGAATTGG - Intergenic
945602086 2:211880995-211881017 AAGCAAACTTTCCACTCAATGGG + Intronic
945602398 2:211884394-211884416 ATGAAAATGTACCACGGAAACGG + Intronic
947045487 2:225978238-225978260 ATGAAAATTTACCAATAAAAAGG - Intergenic
947540008 2:230969884-230969906 ATGCAGCCTTACCACCGAATTGG - Intergenic
948797005 2:240410571-240410593 TTGCAAATTGACAACTGATTGGG + Intergenic
1168941552 20:1716691-1716713 ATGCCAATATCCTACTGAATGGG + Intergenic
1169043262 20:2513981-2514003 ATGCAAAATGACCACTTAATGGG + Intronic
1172023131 20:31929609-31929631 ATGAAAATATTCCACTGAGTAGG + Intronic
1172395562 20:34601905-34601927 CTGCAAATTTCCCAGTGAACAGG + Intronic
1176636715 21:9251901-9251923 CTGCAGATTTAGAACTGAATTGG + Intergenic
1177328276 21:19622492-19622514 ATGCAAATTTAACAATAAAGAGG - Intergenic
1177611231 21:23451253-23451275 ATGCATGTTTTCCAATGAATAGG - Intergenic
1185191987 22:49444096-49444118 ATGTTAAATTACCACTGCATTGG - Intronic
949265277 3:2149934-2149956 ATGCAAATTCAACAGGGAATGGG + Intronic
949477249 3:4459911-4459933 ATGCAATTTTCCAACTGAAAAGG + Intronic
950102132 3:10364234-10364256 ATGGAAACTTACCATTTAATGGG + Intronic
952162131 3:30704581-30704603 ATGCAAATTTCCCATAGAAAAGG + Intergenic
953232915 3:41080328-41080350 ATGCAAAATTACCATAGAAATGG - Intergenic
953831632 3:46302506-46302528 ATCCAAATTTCCAAATGAATTGG + Intergenic
956663141 3:71618763-71618785 ATGCAAATTTAACCCTGATTTGG + Intergenic
958097754 3:88969509-88969531 AAACAAATTTCCCACTGAAGAGG + Intergenic
959552433 3:107677804-107677826 ATACAAATTTACCAATGATTTGG + Intronic
960009203 3:112814918-112814940 ATGCAAGTTTTCCACTGCATGGG + Intronic
960884679 3:122382515-122382537 AAGCACATTTATGACTGAATTGG + Intronic
961121077 3:124370764-124370786 GAGCAAATTTTCCACTCAATGGG - Intronic
961137185 3:124522326-124522348 ATACAAATATACAAATGAATTGG + Intronic
961421585 3:126809509-126809531 AAGCAAAGTTTCCACTCAATAGG - Intronic
962708902 3:138069418-138069440 ACGCAAATTTTCAACTGCATGGG + Intronic
964081979 3:152770007-152770029 ATGCACATTTTCCATAGAATGGG + Intergenic
965101292 3:164302090-164302112 ATACAAATTTCCCTCTGAAAAGG + Intergenic
966652124 3:182313476-182313498 AGGCAAATTTACCAATCAAATGG - Intergenic
966765031 3:183453401-183453423 ATGCAGATTTTCGACTGTATGGG - Intergenic
966964420 3:184975956-184975978 ATGCAAATTTTCAACTGCAAGGG - Intronic
1202750180 3_GL000221v1_random:153118-153140 CTGCAGATTTAGAACTGAATTGG - Intergenic
969896472 4:10309816-10309838 ATGAAAATCTTCCTCTGAATAGG + Intergenic
970861011 4:20702200-20702222 ATCCAAAACTTCCACTGAATTGG + Intronic
971081941 4:23223006-23223028 GTGCAAATTTAACACTGAGATGG + Intergenic
975672505 4:76795819-76795841 ATGCAAATTTAAAACATAATGGG + Intergenic
976971817 4:91113030-91113052 GTGCAAATATGCCACAGAATAGG - Intronic
977238759 4:94541342-94541364 CTGCAAACTTACCACTTGATGGG + Intronic
978177157 4:105746080-105746102 ATGCAGATTTTCAACTGCATGGG - Intronic
978509004 4:109495343-109495365 ATGCTCATTTACCGCTGAAGTGG + Intronic
979109230 4:116730071-116730093 ATGCGCATCTACCAGTGAATGGG - Intergenic
979143453 4:117208726-117208748 ATACAAAATTACCACTAGATAGG + Intergenic
980068840 4:128220570-128220592 ATGCAAATTTACCAATAACTAGG - Intronic
981727899 4:147867217-147867239 ATGCATATTTACTAATGCATTGG + Intronic
982336167 4:154241011-154241033 GTGAAAATTTACCACTGAGTAGG + Intronic
983283235 4:165707343-165707365 AAGCAAAATAAACACTGAATTGG + Intergenic
985290598 4:188382743-188382765 ATACAAAATTACAACTGGATAGG - Intergenic
1202751604 4_GL000008v2_random:10343-10365 CTGCAGATTTAGAACTGAATTGG + Intergenic
986845075 5:11742741-11742763 TTGAAAATCTTCCACTGAATAGG + Intronic
986893086 5:12332738-12332760 ATGCAAATTTACCCCCCAAAAGG + Intergenic
987646756 5:20682809-20682831 ATGCAAATTTATCATAGCATGGG + Intergenic
992501362 5:77347437-77347459 ACCCAAATTTACAACTTAATAGG + Intronic
993279008 5:85900679-85900701 ATACAAATTTCCTATTGAATTGG - Intergenic
993764170 5:91834703-91834725 GTACTAATTTACCACTGATTTGG - Intergenic
993972565 5:94438106-94438128 ATGCAAATTAAACCCTGAAGCGG - Intronic
995518690 5:112978639-112978661 ATTCAAATGAACCACTGAAAAGG + Intronic
996283357 5:121759043-121759065 AGACAAATTTTCCACGGAATCGG - Intergenic
996865039 5:128110876-128110898 ATGCCAATTTACAAGTGAGTGGG + Intronic
1000271027 5:159683369-159683391 ATGCTAAATGACCAGTGAATGGG - Intergenic
1000991279 5:167914600-167914622 ATTGCAAATTACCACTGAATGGG + Intronic
1001874010 5:175183601-175183623 TTGCAAAATTTCCAATGAATGGG - Intergenic
1003275166 6:4644380-4644402 TTGGAAATTTACCACTGAACTGG - Intergenic
1004115437 6:12762169-12762191 AAGCAAATTTATGACTGACTGGG + Intronic
1004708533 6:18148081-18148103 AGTCAGATTTACCACTGACTGGG - Intronic
1007905352 6:45454325-45454347 ATAAAAATTTGCAACTGAATTGG + Intronic
1009474439 6:64071829-64071851 ATGCAAATTTTCCTCAGAGTTGG - Intronic
1010692839 6:78931056-78931078 ATTCTGTTTTACCACTGAATTGG + Intronic
1013670324 6:112395141-112395163 ATACAAAATTACAACTAAATAGG - Intergenic
1014136417 6:117895022-117895044 ATACAAATTTAAAACTGAATGGG + Intergenic
1014619303 6:123646012-123646034 ATGCAGATTTTCGACTGTATAGG - Intergenic
1014627837 6:123751526-123751548 ATGTATATTTACACCTGAATTGG + Intergenic
1015408049 6:132859463-132859485 ACAGAAATTTACCTCTGAATTGG + Intergenic
1017011623 6:150067546-150067568 ATGTGAAATTACCATTGAATGGG - Intronic
1024141079 7:46464033-46464055 CTGCAATTTTACCACTGAGGGGG + Intergenic
1025173868 7:56786697-56786719 ATACAAATTTACCAATCAACAGG + Intergenic
1025698233 7:63791260-63791282 ATACAAATTTACCAATCAACAGG - Intergenic
1025728381 7:64088544-64088566 ATCCAAAATTACCACTGAGCAGG - Intronic
1026180762 7:68038163-68038185 AAGCAAACTTTCCACTGGATGGG - Intergenic
1026356208 7:69559728-69559750 ATGCAAATATACTACTGCATCGG - Intergenic
1026677370 7:72439011-72439033 ATGCAGATTTTCAACTGCATGGG - Intronic
1027638310 7:80703002-80703024 ATGCAAATTTAATAGTGATTAGG - Intergenic
1027729869 7:81857757-81857779 ATGATAAATTACCACTGAGTGGG - Intergenic
1028974749 7:96899995-96900017 ATGCAAATATAAAACTAAATAGG - Intergenic
1029930888 7:104369742-104369764 ATGCAAATTTACACCACAATGGG - Intronic
1030565479 7:111149411-111149433 ATGCAGATTTTCAACTGCATGGG - Intronic
1030591823 7:111491330-111491352 ATGCAAATTTTTAACTGCATGGG + Intronic
1037223863 8:16559892-16559914 ATGCAATTTTATAACTAAATAGG + Intronic
1038500071 8:28036407-28036429 ATGCACATATACCAGTGAATGGG - Intronic
1038532147 8:28327093-28327115 ATGTAAATGTACAACTCAATGGG + Intronic
1039075608 8:33688284-33688306 ATGCAATTTTACCTCTCAAAAGG - Intergenic
1040779459 8:51090992-51091014 ATGCAAATTTACCCCAGAAGTGG + Intergenic
1040842281 8:51797206-51797228 CTGCAAATATCACACTGAATGGG + Intronic
1042086399 8:65113991-65114013 ATACAAAATTTCCACTCAATAGG + Intergenic
1042411850 8:68475253-68475275 ATGCAAATCTACCCCAGAAGAGG - Intronic
1042767562 8:72342272-72342294 ATGTAAACTTTCCACTCAATAGG + Intergenic
1045026574 8:98092635-98092657 ATGCAAAATTACCAAAGAAATGG - Intronic
1046994190 8:120497950-120497972 ATGCATATTTAACATTCAATAGG + Intronic
1048191608 8:132294507-132294529 ATGAGAATTTCCCACTGAAGAGG - Intronic
1049999826 9:1065547-1065569 ATGAAAAATTACCACTGAAAAGG + Intergenic
1052470809 9:28893847-28893869 ATGCTAAATGACCAGTGAATGGG - Intergenic
1053038918 9:34852317-34852339 ATGCAGATTTTCAACTGCATGGG + Intergenic
1056536677 9:87534011-87534033 ATGCAAATGTATAACTAAATGGG - Intronic
1058405319 9:104666913-104666935 CTGCACATGTACCCCTGAATTGG + Intergenic
1059509777 9:114834275-114834297 AGGAAAATTTACCAATGAAATGG - Intergenic
1203718820 Un_KI270742v1:183208-183230 CTGCAGATTTAGAACTGAATTGG - Intergenic
1185660772 X:1727224-1727246 ATGCTAAATGACCACTTAATGGG + Intergenic
1185995220 X:4939630-4939652 ATGAAAAATTTCCACTCAATTGG - Intergenic
1186054917 X:5640070-5640092 ATGCAAAATTACAACTACATAGG - Intergenic
1187354409 X:18553418-18553440 TTGGAAATTTATCACTGACTTGG + Intronic
1187695436 X:21914321-21914343 ATAGAAATTTACCACTGCAAAGG + Intergenic
1187827165 X:23343358-23343380 ATGGAAATGCACCACTGATTGGG - Intronic
1187865463 X:23719541-23719563 ATACAATTTTTCCACGGAATGGG + Intronic
1188071907 X:25727571-25727593 ATGGAAATTTGCCTCTGACTAGG + Intergenic
1188753977 X:33937370-33937392 ATGCAAATTTAAAACACAATGGG - Intergenic
1189940947 X:46120234-46120256 ATGCAATTTTATCTCTGATTAGG + Intergenic
1192102748 X:68282086-68282108 ATACAAATTTCCAACTGATTTGG - Intronic
1192638380 X:72842382-72842404 TTGCAAAGTCACCACTGATTGGG + Intronic
1192643334 X:72878426-72878448 TTGCAAAGTCACCACTGATTGGG - Intronic
1192836072 X:74801301-74801323 ATGCAAGTTTTCCACTCATTTGG + Intronic
1194056704 X:89143978-89144000 TTGCAAATTTAATGCTGAATAGG + Intergenic
1194511155 X:94796456-94796478 ATACAAAATTACAACTGGATAGG - Intergenic
1195515839 X:105774794-105774816 ATGCAATTTTAGAAATGAATGGG + Intergenic
1197358968 X:125474269-125474291 ATCAAAATTTACCACTCTATTGG + Intergenic
1199750357 X:150810455-150810477 AAGCAAATTTACTACTGTAAAGG + Intronic
1201172977 Y:11288043-11288065 CTGCAGATTTAGAACTGAATTGG - Intergenic