ID: 1117670940

View in Genome Browser
Species Human (GRCh38)
Location 14:58105143-58105165
Sequence AAAACTATGCCAAAAATAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 580
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 544}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117670940 Original CRISPR AAAACTATGCCAAAAATAAC AGG Intronic
901168028 1:7233808-7233830 AAAAGTCAGCCAAAAAGAACGGG - Intronic
901255294 1:7820014-7820036 CAAAGTATGCCAAACATAAGTGG + Intronic
902198468 1:14815833-14815855 AAGATGATGCCAAAAATGACTGG - Intronic
903607994 1:24589004-24589026 AAAACTATGCCAACCATGCCAGG - Intronic
903615662 1:24653818-24653840 AAAATTCTGTCCAAAATAACTGG - Intronic
904294307 1:29507951-29507973 ATAACTATGAAAAAAACAACTGG + Intergenic
906891373 1:49719281-49719303 AAAACAATTCCCACAATAACTGG + Intronic
906957881 1:50391081-50391103 AATACTATGCTGAAAATAAGTGG + Intergenic
907229715 1:52984999-52985021 AAAAATATGCAAAAATTAGCCGG - Intronic
907626598 1:56036390-56036412 AAATCTTTGCCAAAAATTCCTGG + Intergenic
908645218 1:66270968-66270990 AAAATTATTCTCAAAATAACTGG - Intronic
908817697 1:68050905-68050927 AAAACTTTGCCAACAAAAACCGG + Exonic
910062364 1:83109313-83109335 AAAACTATTCTAAAAATCAGAGG + Intergenic
910573660 1:88734739-88734761 AGAAATACACCAAAAATAACAGG - Intronic
910610571 1:89137252-89137274 TAAACTATTCCAAAAAAAATGGG + Intronic
911289780 1:96043302-96043324 AAAACAATACAAAAATTAACTGG - Intergenic
911802157 1:102155682-102155704 AAAACTATGCCACTATTCACTGG - Intergenic
911816620 1:102360327-102360349 AAAATTATCCCAAAACTTACTGG + Intergenic
912305781 1:108564999-108565021 AAAACAATACCAAGAAAAACTGG - Intronic
912601260 1:110935194-110935216 AAAACTTTCCCAAAAAGGACAGG + Intergenic
912755664 1:112322813-112322835 AAAAGTATGCATAAAAGAACAGG - Intergenic
912929980 1:113949330-113949352 ATGACAATGCCAAAAATAGCTGG - Intronic
912964192 1:114223150-114223172 AAAAATATGCCACTAATTACAGG + Intergenic
913550461 1:119912651-119912673 AAAAATAAACCAAAAATAGCAGG + Exonic
914896143 1:151675525-151675547 AAAACTCTGGAACAAATAACAGG - Intronic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
915760100 1:158302883-158302905 AAAACTATTCCAAAAATTGAGGG + Intergenic
915825741 1:159074086-159074108 AAATCTATTTTAAAAATAACAGG - Intronic
916034881 1:160913011-160913033 AAAAATATACAAAAATTAACTGG - Intergenic
916838695 1:168577242-168577264 AAAACTAAGCCCCAAATGACTGG + Intronic
917072028 1:171161944-171161966 AAAACTCTTCCACAAAGAACAGG + Intergenic
917529776 1:175824213-175824235 AAAACTCTCCCGAAGATAACTGG - Intergenic
918018499 1:180661711-180661733 AAAAATATGCAAAAATTAGCTGG + Intronic
918277459 1:182967272-182967294 AAAACTTTTTAAAAAATAACTGG - Intergenic
918631348 1:186722652-186722674 AGAACTATGCTAAAATTAAAAGG + Intergenic
919291469 1:195638958-195638980 AAAAAAATACAAAAAATAACTGG + Intergenic
919438535 1:197595789-197595811 AAAACTATTCAACAAATGACTGG - Intronic
919529757 1:198702216-198702238 AGAACTGTACCAAAAATACCAGG - Intronic
919700247 1:200624076-200624098 AAAAAAATGCAAAAATTAACTGG - Intronic
919841135 1:201610180-201610202 AAAACTGTCCCACAAATCACAGG - Intergenic
920644673 1:207791897-207791919 CAATCTATGCCAAAGATAAAAGG - Intronic
920671015 1:208003617-208003639 ATAATTATGAAAAAAATAACAGG + Intergenic
922782210 1:228262030-228262052 ATAAATATGCCAAAAATATTTGG + Intronic
923007356 1:230061418-230061440 AACACTATGAAAAAAATAAAGGG + Intronic
923067849 1:230536643-230536665 AAAACTAAGCCACAAAGAACAGG + Intergenic
923734753 1:236594958-236594980 AAAAATATACAAAAATTAACCGG - Intronic
923887218 1:238171890-238171912 TAAATTGTGCCAAAATTAACAGG - Intergenic
923999973 1:239539774-239539796 AAAAAAATGCCAAAATTAGCCGG - Intronic
924187565 1:241510963-241510985 AAAACTATCACAGAAATAAAGGG - Intronic
924635132 1:245779284-245779306 AAAACAAAGCCAAAAAGAAAAGG + Intronic
924654533 1:245961558-245961580 TAAACTATTCCAGAAACAACAGG - Intronic
1064125488 10:12656328-12656350 AAAAATATGCCAAAATTAGCTGG + Intronic
1064498048 10:15936648-15936670 AAAACTATTCTAAAATTAAAAGG - Intergenic
1065461539 10:25971585-25971607 AAAACTCTCTCAAAAATAAAGGG - Intronic
1065583551 10:27195228-27195250 AAAACTAAGTTAAAAATAAAAGG - Exonic
1066366633 10:34783259-34783281 AAAACTATTCCAAATAAAAATGG - Intronic
1066789670 10:39048654-39048676 AAAACAATGCTAAATATAATTGG - Intergenic
1068241641 10:54309491-54309513 CAAAATATGCAAAAAATATCAGG + Intronic
1068322251 10:55434441-55434463 AAAACCATACCAATAATAATTGG - Intronic
1068426505 10:56872247-56872269 AAAAATATGACAAATACAACAGG + Intergenic
1068513550 10:57997054-57997076 AAAATTATTCCAAAAATGAAAGG + Intergenic
1069163796 10:65123745-65123767 AAAAGAATGCCAAGAATCACAGG + Intergenic
1069191484 10:65496503-65496525 GAAAATATGCCAAAAATATTTGG + Intergenic
1069234644 10:66055596-66055618 AAGACTATCCCAAAAGTTACTGG - Intronic
1069381490 10:67847122-67847144 AAAATTAAGCCAAAAATGCCGGG + Intergenic
1069611802 10:69778136-69778158 TAAAGTATGCCAAAACTTACTGG + Intergenic
1071108993 10:82132615-82132637 TAAACTATTCCAAAAATTAGAGG - Intronic
1071330878 10:84558738-84558760 AAAAATAAGACAAAAATGACTGG - Intergenic
1072116032 10:92371180-92371202 AAAACTATGCAGACAATAAAAGG + Intergenic
1072779834 10:98241106-98241128 AAAACTTTGCTAAAATTAAGAGG + Intronic
1073156747 10:101353681-101353703 AAAACTGTGGCAAGAATCACGGG - Intergenic
1073572897 10:104595815-104595837 CAAACTCTTCCAAAAAAAACTGG - Intergenic
1074251142 10:111749145-111749167 AAAACCATCCCTAAAATAACAGG + Intergenic
1074629216 10:115231590-115231612 GAAATGATGCCAAAAATAAAGGG + Intronic
1074732997 10:116397437-116397459 AAAACTGTTCAAAAAATGACTGG + Intergenic
1075703748 10:124485895-124485917 AAAACTATGCCAAGTAAGACCGG - Intronic
1075750144 10:124761984-124762006 AAAAATATTCCAAAACTAATAGG - Intronic
1075866459 10:125725213-125725235 GAAACTATTCAAAAAATAATAGG + Intronic
1076682963 10:132184536-132184558 AAATTTATGCAAAAACTAACCGG + Exonic
1077104336 11:835498-835520 AAAAATATACAAAAATTAACTGG - Intronic
1077132913 11:983177-983199 AAAAATATACAAAAATTAACTGG - Intronic
1077432611 11:2523357-2523379 AAAAATATGAAAAAATTAACTGG - Intronic
1077596785 11:3538817-3538839 AAAACAATGAAAAAAATGACAGG + Intergenic
1077859812 11:6167277-6167299 AAAATTATGCCAAAATTATGTGG + Intergenic
1077937850 11:6808813-6808835 AAAACTATTCCAAAAAGATGAGG - Intergenic
1077939326 11:6823865-6823887 AAAACAATACAAAAATTAACTGG + Intergenic
1078346187 11:10551252-10551274 TAAAATATGGCAAAAATAATCGG + Intergenic
1078651541 11:13199350-13199372 AAAACTATTCCAAAAAATCCAGG + Intergenic
1078872196 11:15358019-15358041 AAAACTAGGATAAAAATGACAGG - Intergenic
1079667939 11:23131383-23131405 AAAACTATTCCAAAAATTTGAGG - Intergenic
1080005678 11:27403780-27403802 AAAACAATTACAAAAATAAGTGG - Intronic
1080270062 11:30441736-30441758 AAACCTATGCAAAAAAAAAGGGG - Intronic
1081186908 11:40054379-40054401 AAATCTAAGCCAAAAATTAATGG + Intergenic
1081252672 11:40854611-40854633 AAAACTATACCAGAAAAAAAAGG - Intronic
1082725348 11:56728175-56728197 AAGATTCTGCAAAAAATAACAGG - Intergenic
1084574287 11:69978510-69978532 AAAACAATGCAAAAATTAGCTGG - Intergenic
1085847974 11:80087620-80087642 AGAACCATGGCAAAAATAAATGG - Intergenic
1086599161 11:88611257-88611279 AAAATTATTCCAAAAATACAAGG - Intronic
1087145646 11:94808453-94808475 AAAACTTTGCAAAACATGACAGG - Intronic
1087231031 11:95664171-95664193 AAAACTAAGCCAAAAGTTAATGG - Intergenic
1087380754 11:97401739-97401761 AAAAAAATGCCAAAATTAGCTGG - Intergenic
1088412703 11:109552958-109552980 AAATATATCCCAAATATAACAGG - Intergenic
1088689600 11:112314389-112314411 AAAACAAAGTCAAACATAACTGG - Intergenic
1090584653 11:128198100-128198122 GAAACTATAACAAAAATAAGAGG + Intergenic
1092270049 12:7016708-7016730 ATTACAATGTCAAAAATAACTGG + Intronic
1093716277 12:22386172-22386194 AAAAATATTCCAAAAATTATGGG + Intronic
1095697928 12:45161661-45161683 AAAACTATTCCAAAAATTTGAGG - Intergenic
1097400451 12:59122189-59122211 GAAGCTATGGCAAAAACAACAGG - Intergenic
1098486700 12:71029684-71029706 CAAACTATCCCAAAACTTACTGG - Intergenic
1098602445 12:72347847-72347869 TAAAATATGACAAAAGTAACGGG - Intronic
1098880398 12:75911492-75911514 AAAACTATACCACATATAGCTGG + Intergenic
1098933239 12:76445943-76445965 AAAAATATGACAAAATTGACTGG + Intronic
1099574064 12:84359292-84359314 AAAACTATGTCACAAAAAAGTGG - Intergenic
1099785930 12:87263854-87263876 AAAATAATTTCAAAAATAACTGG - Intergenic
1099971828 12:89508281-89508303 AAAAATTTACCAAAAATAAGAGG - Intronic
1100350505 12:93777049-93777071 AAAACTATTTAAAAAATAAGTGG + Intronic
1100450077 12:94697318-94697340 AAGACTATGGCAACACTAACTGG + Intergenic
1100801899 12:98240843-98240865 AAAACTCAGCCACAAATAAATGG + Intergenic
1102245722 12:111354454-111354476 AAAACTATGCCAAGATTGAGTGG + Intergenic
1102488533 12:113274533-113274555 AAAAATATTCCAAAAAGAAAAGG - Intronic
1102851429 12:116249319-116249341 AAAAGTATGCTAATAATAATAGG + Intronic
1102856741 12:116300620-116300642 AAAACTAGGCCAAAGAAAGCTGG - Intergenic
1105282491 13:18976289-18976311 AAAACAAAAACAAAAATAACAGG - Intergenic
1105339723 13:19510095-19510117 ACAACAATGCCAAAGCTAACAGG + Intronic
1105775498 13:23655745-23655767 AAAACAAAACCAAAAATAAGGGG - Intronic
1105793409 13:23825976-23825998 ACAACTATACAAAAAATATCAGG + Intronic
1105863366 13:24437253-24437275 AAAACTATTTTAAAAATAAAGGG + Intronic
1106153370 13:27127907-27127929 ATAACTAAGCCAAAACCAACAGG + Intronic
1106733374 13:32565267-32565289 AAAACTATGCTAAAAATACGTGG - Intergenic
1108242115 13:48475612-48475634 AATAATATGCCAAAAGTAATGGG - Intronic
1108418054 13:50221020-50221042 CAAACTATGCAAGAAATCACAGG - Intronic
1108841392 13:54620945-54620967 AAATCTATGAAAAAAAAAACTGG - Intergenic
1109468581 13:62773300-62773322 TTAACTAGGCCAAAAATAATGGG + Intergenic
1109525921 13:63575680-63575702 AAATCCATGCCAAAATTAAATGG - Intergenic
1109838553 13:67891619-67891641 AAAACTTAGCAAAAAACAACTGG - Intergenic
1110072955 13:71201348-71201370 ATAATTATGTCATAAATAACAGG - Intergenic
1110223650 13:73097706-73097728 AAAACGATTCTAAAAACAACTGG - Intergenic
1110787921 13:79555515-79555537 AACACTGTGGCAATAATAACTGG - Exonic
1111168125 13:84490382-84490404 AAAAATATTTCAAAAATAAGGGG + Intergenic
1111953147 13:94726726-94726748 CAAACTATGCCAAAACTTAATGG - Intergenic
1112172392 13:96987629-96987651 AAGATAATGCCATAAATAACAGG + Exonic
1112217369 13:97446941-97446963 AAAACTATCCCAAAACTTAGGGG - Intronic
1112426711 13:99309012-99309034 ATAACTATTTCAAAATTAACAGG - Intronic
1113980072 13:114267333-114267355 AAAACAATACAAAAAAAAACTGG + Intronic
1114518205 14:23314791-23314813 AAAACTATGACAAACAAAATTGG + Intronic
1115375402 14:32670184-32670206 AAAACTATCACAAGAATAGCAGG + Intronic
1116370891 14:44130308-44130330 AAAACTATGTCAAGAATGAAAGG + Intergenic
1116724707 14:48548069-48548091 GAAACTATTCCAAAAATTAGAGG + Intergenic
1117470544 14:56040149-56040171 TGAACTGTGCCAAAAATAATTGG + Intergenic
1117670940 14:58105143-58105165 AAAACTATGCCAAAAATAACAGG + Intronic
1117915857 14:60677171-60677193 AAAAGAATGATAAAAATAACAGG - Intergenic
1118245380 14:64105102-64105124 AAGACGATGGCAAAAATAATGGG - Intronic
1118583665 14:67330391-67330413 AATACAATGCCAAAACTTACGGG - Intronic
1118743091 14:68755327-68755349 AAAAAAATGCAAAAAATAGCTGG + Intergenic
1118785968 14:69045500-69045522 AAAACTAGGATAAAGATAACAGG + Intergenic
1120909947 14:89657193-89657215 CAAACTATGCCAAAACTCAGTGG - Intergenic
1121753499 14:96379984-96380006 AAAACTATGTAAAAAAGAAAGGG + Intronic
1122787412 14:104170209-104170231 AAAAAATTGCCAAAAATTACCGG + Intronic
1202891970 14_KI270722v1_random:167628-167650 AAAACAATAACAAAAATAATTGG + Intergenic
1123440177 15:20285176-20285198 AACAGTATGCCAGAATTAACAGG - Intergenic
1126486878 15:49191197-49191219 AAAAATAATACAAAAATAACTGG + Intronic
1127201511 15:56658248-56658270 AAAAATGTACCAAAACTAACTGG + Intronic
1127369460 15:58324234-58324256 AAAACTATTCTAAAATTCACAGG - Intronic
1127566346 15:60192935-60192957 TAAGCTATGACAAAAATAAATGG - Intergenic
1128191978 15:65710264-65710286 TAAAATAGGCCAAAAATAAAAGG + Intronic
1128996561 15:72301151-72301173 AAAAATATGCAAAAATTAGCTGG - Intronic
1130636232 15:85623001-85623023 AAAACTTTGCTAAAAATCATGGG - Intronic
1131101928 15:89698317-89698339 ACAAATATGCCAAAACTAAAAGG - Intronic
1131279664 15:91010438-91010460 AAAACAATGCAAAAATTAGCTGG + Intronic
1131753238 15:95532456-95532478 AAAACTACGCAAAACATGACAGG - Intergenic
1132755127 16:1480596-1480618 AAAACTAAGCCCAAAATAAGAGG + Intergenic
1133261457 16:4553497-4553519 AAAAATATACCAAAATTAGCTGG - Intergenic
1133307468 16:4819672-4819694 AAAACTATGGAAAGAATGACAGG - Intronic
1133403149 16:5503345-5503367 AAACCTATTCCAAAAAGAAGAGG - Intergenic
1134407557 16:13974933-13974955 AAAACCATACTAAAAATATCAGG + Intergenic
1134469407 16:14510024-14510046 AGAACAATGGCAAAAACAACTGG + Intronic
1134541551 16:15071018-15071040 AAAAACATGCCAAAAAAAATGGG + Intronic
1136068259 16:27773021-27773043 AAAACAATGGCAAAGATAAGAGG - Intronic
1136126728 16:28188518-28188540 AAAAGTATGCAAAACATATCCGG + Intronic
1136726766 16:32363748-32363770 AATAGTATGCCAGAATTAACAGG + Intergenic
1136844996 16:33569260-33569282 AACAGTATGCCAGAATTAACAGG + Intergenic
1137083891 16:36098991-36099013 AAAACTATACCCAAATTAATTGG + Intergenic
1137817047 16:51408286-51408308 AAAATTAGGGCAAAAAGAACTGG - Intergenic
1139586274 16:67906055-67906077 AAAATTATGACAAATAGAACTGG - Intronic
1140062143 16:71580036-71580058 GAAACTATCCCTCAAATAACAGG - Intergenic
1140242594 16:73217074-73217096 AAAACTATGACCAAATCAACTGG - Intergenic
1141958570 16:87389920-87389942 AGAACTATGACAAAAAAATCAGG + Intronic
1142336542 16:89492940-89492962 AAAAATATGCAAAAATTAGCTGG + Intronic
1202999668 16_KI270728v1_random:154010-154032 AATAGTATGCCAGAATTAACAGG - Intergenic
1203106704 16_KI270728v1_random:1417913-1417935 AACAGTATGCCAGAATTAACAGG + Intergenic
1203131266 16_KI270728v1_random:1690410-1690432 AATAGTATGCCAGAATTAACAGG - Intergenic
1203155164 16_KI270728v1_random:1869558-1869580 AACAGTATGCCAGAATTAACAGG + Intergenic
1143269193 17:5663231-5663253 AAAAATATACCAAAACTAACAGG - Intergenic
1143605936 17:7985882-7985904 AAAACTATTTTAAAACTAACTGG + Intergenic
1143967764 17:10769073-10769095 CAAACTATGCCAAAACTCAGTGG - Intergenic
1145801594 17:27689676-27689698 TAAACAATGCCAAATATAATTGG + Intergenic
1146577256 17:34005461-34005483 AACACTATCCTAAAGATAACAGG - Intronic
1147113141 17:38278682-38278704 AAAATTTTGACAAAATTAACTGG + Intergenic
1147279365 17:39345910-39345932 AAAATTATGCCAAACATAACAGG - Intronic
1148259928 17:46172658-46172680 AAAAGTATGCCAAATATCACAGG + Intronic
1148416480 17:47510552-47510574 AAAATTTTGACAAAATTAACTGG - Intergenic
1149402796 17:56315822-56315844 AGAACTAGGCCAGAAATAAAAGG + Intronic
1149411645 17:56414332-56414354 CAAACTATTCCAAAAAATACAGG + Intronic
1149572079 17:57679005-57679027 AAAAATATACAACAAATAACCGG - Intronic
1150118022 17:62572006-62572028 AAAACAATACAAAAATTAACTGG + Intronic
1151286129 17:73112628-73112650 AAAACTATTCAAAATATAAGGGG + Intergenic
1153823772 18:8856029-8856051 AAAGCTATGACAAGAACAACAGG + Intergenic
1153865439 18:9263908-9263930 ACACTTATGCTAAAAATAACTGG + Intronic
1153913610 18:9725553-9725575 ATAACAATAACAAAAATAACTGG - Intronic
1154941463 18:21116620-21116642 AAAACTATGCCAAAACCTAGTGG - Intergenic
1155687336 18:28571558-28571580 GAAACTATACCAAAAATTAGTGG + Intergenic
1155764443 18:29609884-29609906 AAAACTATGAAGAAAATAAAGGG - Intergenic
1158028669 18:52935552-52935574 AAGCCTATGCAAAAAATAAAAGG - Intronic
1158810916 18:61033094-61033116 AAAATTAAGCCAGACATAACAGG - Intergenic
1159272064 18:66165732-66165754 AAAAATATGGCAAATATAATAGG + Intergenic
1159684097 18:71394881-71394903 GAACTTATGCCAAAAATAAGTGG - Intergenic
1159694499 18:71538038-71538060 GAAAGTAAGCCAAAAATAAGAGG + Intergenic
1162705277 19:12550852-12550874 AAAGCTAGGCTAAAAAAAACGGG + Intronic
1163956462 19:20647007-20647029 AAAACTACGAAAAAAATTACCGG - Intronic
1164178402 19:22798185-22798207 GAAACTATGGCTAACATAACTGG + Intergenic
1164407044 19:27959173-27959195 AATTCTATGCTAAAAATTACAGG - Intergenic
1165082761 19:33319020-33319042 ACAACTATAACATAAATAACAGG + Intergenic
1165500046 19:36181701-36181723 AAAACTATGAAAAAATTAGCTGG - Intergenic
1165583356 19:36889334-36889356 GAAACTATTCCAAAAATTATAGG - Exonic
925448029 2:3944324-3944346 GAAACAATGCCAAAATTAACAGG + Intergenic
925583872 2:5442993-5443015 AAAACCACGCCAACAATATCAGG - Intergenic
927314732 2:21668690-21668712 AAAACTTTGCAAAAAATAGAAGG + Intergenic
927371791 2:22364077-22364099 AAAACTATTCTAAAATTCACTGG - Intergenic
928872850 2:36001124-36001146 AACACTACCCCGAAAATAACAGG + Intergenic
929397725 2:41542823-41542845 GAAACTATGCTAATAAAAACTGG - Intergenic
929634658 2:43505743-43505765 AAAAGAATGCAAAAATTAACAGG + Intronic
930286275 2:49432251-49432273 AAAACTATTACAAAAATAAATGG + Intergenic
930622677 2:53660131-53660153 AAAACTATGCAAATACTGACTGG + Intronic
930786194 2:55273808-55273830 AAAATTATTCCAAAATTAAAAGG + Intergenic
931448410 2:62346904-62346926 AAACCTAAGCAAAAAATAAACGG - Intergenic
931482477 2:62655651-62655673 AGAAATATGCTAAAAATAAAAGG + Intergenic
931785320 2:65612843-65612865 CAAATTATGCCAAAAATAAATGG - Intergenic
932890649 2:75593920-75593942 AAAATGATGGCAAAAATAAGGGG + Intergenic
933446818 2:82391499-82391521 AAAACAAAACCAAAAAAAACGGG - Intergenic
933656886 2:84895797-84895819 AAAACTAAAAAAAAAATAACTGG + Intronic
934085923 2:88509506-88509528 TGATCTATGCCCAAAATAACTGG - Intergenic
935334027 2:101998471-101998493 AAAACTATCCCAAAACTTAGTGG + Intronic
935587282 2:104812926-104812948 AAAATAATGACAAAAATAACGGG + Intergenic
935615504 2:105075955-105075977 AAAACAATGCCAAATAACACAGG - Intronic
935706078 2:105858928-105858950 AGAACTTTGCCACAGATAACAGG + Intronic
936727283 2:115334886-115334908 AAATCTATGCAAAATATACCAGG + Intronic
936999581 2:118453328-118453350 AAAACTATGTCGAATATAAGTGG + Intergenic
937971082 2:127550012-127550034 AATACAATGCCAAAAGTACCAGG - Intronic
938204014 2:129401765-129401787 AAAAATATGACAAAAAAATCTGG + Intergenic
938639400 2:133264655-133264677 AATACTCTGCCAAAAATATTGGG + Intronic
940033264 2:149287243-149287265 GAAACTATGCCAAGAAGAAATGG - Intergenic
940783351 2:157956913-157956935 ATAACTGTGCCAAAAACCACTGG + Intronic
941875436 2:170427769-170427791 TAAAATATAACAAAAATAACTGG + Intronic
942328719 2:174798781-174798803 AAGATTATTCCAAAAATAATGGG - Intergenic
942975318 2:182010116-182010138 AAAACTATCCTAAAATTTACAGG - Intronic
943071623 2:183147677-183147699 AAAACTATTCTAAAATTCACAGG - Intronic
943119782 2:183721129-183721151 TAAACTATGCAGAAAATTACTGG + Intergenic
943277545 2:185886868-185886890 AAATGTATGCCAAAAATACATGG + Intergenic
943329089 2:186537243-186537265 AAAACTATGAAAACAATAAAAGG - Intergenic
943396556 2:187343818-187343840 AAAACTATTCTAAAAATATATGG + Exonic
943544872 2:189262978-189263000 AAAACTATTCAGAAAATAATTGG + Intergenic
943692970 2:190887733-190887755 AACACTGTACCAAAAATAATAGG - Intronic
944287201 2:197965099-197965121 CAAACTATGCCAAAAAATAGAGG - Intronic
944917592 2:204377092-204377114 AAAATTATGCAAAAAATACATGG + Intergenic
947361427 2:229349341-229349363 AAAACTAAAACAAAAATAACTGG + Intergenic
948061489 2:235045816-235045838 AAAGCTATGCTAAAAATGAGAGG - Intronic
948516758 2:238509035-238509057 AAAAAAATTCCAAATATAACTGG - Intergenic
948539047 2:238673057-238673079 AGAACAATGCAAGAAATAACTGG - Intergenic
948833056 2:240608576-240608598 AAAAGTATGCAAGAAATAAAAGG - Intronic
1168785286 20:534165-534187 AATAATCTGCCAAAAACAACAGG + Intronic
1169614045 20:7418653-7418675 AAAACTATTTCAAAATTAAAAGG - Intergenic
1169686774 20:8283377-8283399 TGAACTATGCCAAAAATTAAAGG - Intronic
1170449713 20:16470135-16470157 AAAACTATGGAAAAAGTAAAAGG + Intronic
1170544701 20:17425755-17425777 AAACCTATGCCAAAGATGAAAGG - Intronic
1172168795 20:32916248-32916270 AAAACTAAAACAAAAATAAGAGG - Intronic
1173282524 20:41642312-41642334 GAAACTAAGCAAAAAATAAGAGG - Intergenic
1174213711 20:48899997-48900019 CAAACTAAGCCAAAAAAAAAAGG + Intergenic
1174242008 20:49144133-49144155 ATAAAAATGACAAAAATAACTGG - Intronic
1174656079 20:52173424-52173446 AAAACCATACAAAAAATAGCTGG + Intronic
1174663588 20:52236646-52236668 ATAACCATGCAAAAAATAACCGG + Intergenic
1174678610 20:52382296-52382318 AAAACAAAGAAAAAAATAACTGG - Intergenic
1175369054 20:58474719-58474741 AAAACAAAACAAAAAATAACAGG + Intronic
1175694908 20:61095069-61095091 AAAACTATGCAAAATAAAGCAGG + Intergenic
1176734470 21:10531667-10531689 ACAACAATGCCAAAGCTAACAGG - Intronic
1177247521 21:18548003-18548025 AAAGCTATATCAAAGATAACTGG - Intergenic
1178304889 21:31483175-31483197 ATAAGTAGGCCAAAACTAACAGG + Intronic
1178537829 21:33424901-33424923 AAAACAAAACCAAAATTAACTGG - Intronic
1178939803 21:36895796-36895818 TGAAATATTCCAAAAATAACTGG - Intronic
1180307395 22:11141007-11141029 AATAGTATGCCAGAATTAACAGG - Intergenic
1180545915 22:16503230-16503252 AATAGTATGCCAGAATTAACAGG - Intergenic
1180562213 22:16627143-16627165 ACAACAATGCCAAAGCTAACAGG - Intergenic
1181802294 22:25355524-25355546 AAAAATATGCAAAAACTAGCTGG + Intronic
1182213260 22:28694170-28694192 AAGAGTATGCCAGAATTAACAGG + Intronic
1182799064 22:33015764-33015786 AAAAATAAGCTAAAAATAATTGG - Intronic
1182903085 22:33915109-33915131 AAAACTATACTAAATATACCTGG + Intronic
1184079146 22:42205931-42205953 AAAAATATGCAAAAATTAGCTGG - Intronic
949685035 3:6559573-6559595 AAAAATATGCCAAATATAAATGG - Intergenic
949728617 3:7080163-7080185 AAAACTAATCCAAAAATATGTGG + Intronic
949817696 3:8077738-8077760 TAGACTATGAGAAAAATAACCGG + Intergenic
950587181 3:13902189-13902211 CAAGCAATGCCAAAAATTACTGG - Intergenic
950830162 3:15865983-15866005 AAAACCATGGCAGAACTAACTGG + Intergenic
950912859 3:16613207-16613229 AAAATTATGCCAAAGTTAAAAGG - Intronic
951069538 3:18310504-18310526 GAAAACCTGCCAAAAATAACTGG + Intronic
952045587 3:29314916-29314938 AGAAATATGCCAAAAATCACTGG + Intronic
952099288 3:29992886-29992908 AAAACTAGGCTATAAAGAACTGG + Intronic
953159849 3:40408530-40408552 AAAACTATGCTGAACATCACAGG - Intronic
954076419 3:48185057-48185079 AAAACTATGCCAAGAAAATCTGG - Intronic
955683829 3:61529729-61529751 AAAACTATACAAAAATTAGCTGG - Intergenic
956260859 3:67339531-67339553 GAAACTATCCCAAAAAAATCAGG + Intergenic
956331254 3:68111914-68111936 ATAACTATCTGAAAAATAACTGG - Intronic
956599656 3:71006951-71006973 ACAAGTTTGCCAAAGATAACAGG - Intronic
957449116 3:80353238-80353260 AAATCTATTCAAAAAATAAAAGG - Intergenic
957601678 3:82343547-82343569 AAAAATAAGCCAAAAATATAGGG + Intergenic
959275843 3:104276850-104276872 AAAACTTTGTCCAAAAAAACAGG + Intergenic
959486147 3:106928846-106928868 GAGACTATGCCATAAATAAATGG + Intergenic
960646427 3:119889402-119889424 AAAACTATAGCACAAAGAACAGG + Intronic
961354374 3:126326410-126326432 TAAATTATGCCATAAAGAACAGG - Intergenic
962683682 3:137825552-137825574 AAAACTCTCCTAAAAATAAAAGG - Intergenic
962956606 3:140272588-140272610 AAAAAAATGCAAAAATTAACTGG + Intronic
963769112 3:149370751-149370773 AAAACTTTGCTGAAAATAAAAGG - Intronic
964202624 3:154135121-154135143 GAAACTATTCCAAAAAAAATTGG - Intronic
964244759 3:154638530-154638552 AAAACTATTCTAAAATTAACAGG + Intergenic
964569585 3:158096976-158096998 AAAACAATACCAAAAGTATCTGG - Intronic
964574518 3:158150241-158150263 AAAAGGATGTCTAAAATAACTGG - Intronic
964727474 3:159829155-159829177 AATACTATGGGAAAAATAATAGG + Intronic
966106930 3:176347182-176347204 AAAAATATGAAAAAAATAATAGG + Intergenic
966246202 3:177810117-177810139 AAAACACTGCCAAAAAAATCTGG - Intergenic
967335355 3:188337799-188337821 TAAACTTTAACAAAAATAACTGG - Intronic
967444651 3:189552354-189552376 AAAACTATTCAAAAGACAACTGG + Intergenic
967448165 3:189591619-189591641 AAAAATATACCAAAATTCACTGG + Intergenic
968072004 3:195789901-195789923 ACAACTCTCCCAAAAACAACAGG - Exonic
970378945 4:15486199-15486221 CAAACTATTCCAAAAATCAGAGG - Intronic
971939864 4:33200428-33200450 AAAAATAGGCCAAAACTAAGGGG - Intergenic
971947052 4:33293145-33293167 AAAAGTAAGACAAAAATAATTGG - Intergenic
972007251 4:34125382-34125404 AAAACTATGTTAAAGATAAGGGG - Intergenic
972028210 4:34414695-34414717 AAGACTATGGCAGAAGTAACAGG - Intergenic
972526686 4:39919866-39919888 AAATCTTTGCCAAAAACAACAGG + Intronic
972536604 4:40005115-40005137 AAAACAATGTAAAAATTAACTGG - Intergenic
972932360 4:44088548-44088570 AATAATATGCCTAAAATAAGGGG - Intergenic
973062163 4:45740936-45740958 AAAACTATTCCAAAAATTAAGGG - Intergenic
973193932 4:47418138-47418160 AAAGCCATGCCAAAAATCACAGG - Intronic
973537868 4:51901933-51901955 AAAACAAAGCAAAAAAGAACAGG - Intronic
973586548 4:52398257-52398279 AAAAAACTTCCAAAAATAACAGG - Intergenic
974159316 4:58117505-58117527 AAAAATATGTTAAAAATAAATGG - Intergenic
974178255 4:58352708-58352730 AAAACTATACCTTCAATAACAGG + Intergenic
974200135 4:58626726-58626748 AAAACTATCCCAAAAATTTGAGG + Intergenic
974425585 4:61738912-61738934 TAAACTTTGCCAAGAAAAACTGG - Intronic
974640296 4:64621702-64621724 AAAACTTAGCCAAAAAAAAAAGG - Intergenic
975244533 4:72104289-72104311 GAATAAATGCCAAAAATAACAGG - Intronic
975672271 4:76792888-76792910 AAAACTAGGCCAAAAATTCTCGG + Intergenic
975819437 4:78254790-78254812 AAAAACATGCCAAATATGACAGG - Intronic
975944766 4:79692516-79692538 GAAACTATTCCAAAAAGAAAAGG - Intergenic
975961979 4:79920450-79920472 TAATCTATGCCAAAATTAAAAGG + Intronic
976440749 4:85071415-85071437 AAGACTCTGTCAAAAAAAACTGG - Intergenic
976660361 4:87534357-87534379 AAAATTAGGGCAAAAATAAGAGG + Intergenic
976722561 4:88183661-88183683 AAAACTATTCCAAAAAATAGAGG + Intronic
977554859 4:98478204-98478226 AGAACTAAGCCAAAAAGAAAAGG + Intronic
978360265 4:107924162-107924184 ATAAATATACCAAAAAGAACTGG - Intergenic
978475284 4:109121267-109121289 CAAACTATGAAAAATATAACTGG + Intronic
978596510 4:110382961-110382983 AAAACTATGCAAAAGATCAATGG + Intronic
979083931 4:116381104-116381126 AAAATTTTGGAAAAAATAACAGG + Intergenic
979541718 4:121891381-121891403 AAAATTATGGCAAAAAAGACTGG + Intronic
980342813 4:131572274-131572296 ATAATTATGCAAAAAATATCAGG - Intergenic
980420138 4:132548062-132548084 ATCACCATGCCAAAAATAGCAGG - Intergenic
980458444 4:133074564-133074586 AAAAGTATGCCAACAATACTGGG - Intergenic
980532505 4:134073262-134073284 AAAACTTGGCCAAAATTAAGGGG + Intergenic
980668719 4:135974390-135974412 AAAACTCTGCAAAAAAAAATAGG + Intergenic
980676376 4:136088404-136088426 AAATGTATGCCAGAAACAACAGG + Intergenic
981319459 4:143374920-143374942 AAAAGTATTCCAAGAATCACTGG - Intronic
981335443 4:143563525-143563547 AGAAATAGGCCAAAAATAAGGGG - Intergenic
982605703 4:157514298-157514320 AAAATTGTTCCAAAAATAATAGG - Intergenic
982902617 4:161026336-161026358 CAAACTATACGAAAAATAACAGG + Intergenic
983274157 4:165597244-165597266 AAAACTATGGGGAAAAAAACAGG - Intergenic
983429984 4:167636437-167636459 TAAACTCTGCCAAAACTCACAGG - Intergenic
983885790 4:172979067-172979089 AAATCACTGCCAAAACTAACAGG - Intronic
984007729 4:174333655-174333677 AAAATTATGCAAAAAATGAAGGG + Intergenic
987535914 5:19187331-19187353 AAAACAATCCCAACAATAAGTGG + Intergenic
987800407 5:22688695-22688717 AAAAATGTGCCAAAAATAATAGG + Intronic
987813023 5:22863616-22863638 AAAAATAAGCCAGAGATAACAGG + Intergenic
987904307 5:24055853-24055875 AAAACTTTTCCTCAAATAACTGG + Intronic
987970671 5:24939713-24939735 AAATCAAAGCCAAAAATAATAGG - Intergenic
988130663 5:27100048-27100070 AAAACTATGACAAAAAATCCAGG - Intronic
988196043 5:28007382-28007404 ATAAACATGTCAAAAATAACCGG - Intergenic
988413048 5:30911596-30911618 AAAAGTATGCCAAACATAAAGGG - Intergenic
988739515 5:34056340-34056362 AAAATGATGTCAAAAATAAAAGG - Intronic
990567871 5:57048196-57048218 AAAAAAATGCAAAAATTAACTGG + Intergenic
990856465 5:60272834-60272856 AAAAGTATACCTAAAATAAGCGG - Intronic
991205601 5:64046553-64046575 AAAACTATTCCAAAAAATAAAGG + Intergenic
991212264 5:64119141-64119163 AAAACTACCACAATAATAACAGG + Intergenic
991544951 5:67771394-67771416 AAAACAAAGCCAAGAATAAATGG + Intergenic
991662960 5:68968997-68969019 AAAACTTTTCCAAAAAGAATTGG + Intergenic
993123159 5:83800061-83800083 AAATCTATGCCATACACAACAGG + Intergenic
993361580 5:86982925-86982947 AAAACTATTATAAAAATAATGGG + Intergenic
994503618 5:100611643-100611665 AAAACTATTCCAAAAATTTGAGG - Intergenic
994638730 5:102377831-102377853 AAAAATATGCAAAAATTAGCTGG - Intronic
995347705 5:111139645-111139667 GAAACTATTCCAAAAGAAACAGG + Intergenic
996009104 5:118461039-118461061 AAAATTAAAACAAAAATAACAGG - Intergenic
996111339 5:119570005-119570027 AAAACTAAGCCACCAATGACAGG - Intronic
997146225 5:131436682-131436704 AAAAATATGACAAAAATATCAGG + Intronic
997356856 5:133268019-133268041 AAAAAAATGCCAAAACTAATGGG + Intronic
997687393 5:135798140-135798162 AAAATTATTCCAAATATCACAGG + Intergenic
997910192 5:137863970-137863992 AAAAATATGCAAAAATTAGCTGG + Intergenic
998256481 5:140592521-140592543 AAAAGTATACCAAAAAAAAAAGG - Intronic
998864355 5:146481216-146481238 AAAACTAAGCCAGGAAAAACAGG - Intronic
999241498 5:150130441-150130463 AACAATATGCCAAGAAGAACGGG + Intronic
999590502 5:153139826-153139848 AAAAATTTTCCATAAATAACTGG - Intergenic
999948128 5:156619447-156619469 AAAACTCTGACAATAAAAACAGG - Intronic
1000547011 5:162616001-162616023 CAAGCTATGACAAAAATAATAGG + Intergenic
1000789632 5:165589746-165589768 GAAACATTGCCTAAAATAACTGG + Intergenic
1002560367 5:180077692-180077714 AAAACTATTTAATAAATAACAGG + Intergenic
1002655896 5:180746428-180746450 AAAACTTTGACAAAAATCATAGG + Intergenic
1003069117 6:2930563-2930585 AAAACTCTTCCAAAAAGAAGAGG - Intergenic
1003375091 6:5569396-5569418 AAAACTATACAAAAATTAGCCGG - Intronic
1003766619 6:9244415-9244437 TAAACAATGACAAAAATAATAGG + Intergenic
1003861363 6:10324987-10325009 AAAAATATACAAAAATTAACTGG + Intergenic
1004374730 6:15081344-15081366 AAAAAAATGCAAAAATTAACCGG - Intergenic
1004461272 6:15838711-15838733 AAAACTATGCCAAAATTTTGGGG + Intergenic
1005679022 6:28186706-28186728 ATAATTATGCAGAAAATAACAGG - Intergenic
1006496652 6:34428154-34428176 AAAACTCTGTCAAAAAAAAAAGG + Intergenic
1006963024 6:37952965-37952987 AAAACTACGGAAAAAATAAATGG - Intronic
1007190338 6:40010768-40010790 CAAACTATCCCAAAAATAGAGGG - Intergenic
1007253861 6:40515078-40515100 TAAAGCATGCCAAAAATAAATGG - Intronic
1007382820 6:41501846-41501868 AAGACTAGGCCAAAAATAAGGGG - Intergenic
1008192508 6:48476521-48476543 AAAACTATCCCAACAAGAATGGG + Intergenic
1008820172 6:55622805-55622827 GAAACTATGCTACAAAAAACAGG - Intergenic
1008974225 6:57405674-57405696 ACTACTATGACAAAAATAAATGG - Intronic
1009163114 6:60307197-60307219 ACTACTATGACAAAAATAAATGG - Intergenic
1009227230 6:61030810-61030832 AATATTATGCCAAATATCACAGG - Intergenic
1009331499 6:62426872-62426894 AAAATTATGGTAAAAACAACAGG - Intergenic
1010089663 6:71965759-71965781 AAGACTTTGCAAAAAATAAGAGG + Intronic
1010468744 6:76200131-76200153 CAAACTATACCAAAAGTACCTGG + Intergenic
1010692665 6:78929053-78929075 GAAACTATTCCAAAAAATACAGG - Intronic
1010906649 6:81499922-81499944 AAAACTATTCTAAAATTCACTGG + Intronic
1011055997 6:83203972-83203994 AAAACAATGGCAGAAATAAATGG - Intergenic
1011383659 6:86769953-86769975 AAAACTATTCCAAAAAAACAAGG + Intergenic
1011450902 6:87490690-87490712 AAAACTAGGCAAAAAATATGAGG + Intronic
1011799245 6:90992286-90992308 AACACTTTGCCAAAAGTAAAGGG + Intergenic
1011968213 6:93187279-93187301 AAAAGTAAGCCAAAAATATGGGG - Intergenic
1013554894 6:111246370-111246392 GAAACTATGCTAAAAATACTTGG - Intergenic
1013788922 6:113813957-113813979 AAAACAAAACCAAAAATAACAGG - Intergenic
1013891280 6:115031366-115031388 AAAACCATTCAAAAAATAATAGG + Intergenic
1014920508 6:127209721-127209743 TAAACTGTTACAAAAATAACTGG - Intergenic
1015088687 6:129328574-129328596 AAAAGTAAGGAAAAAATAACTGG + Intronic
1015145591 6:129982216-129982238 AAAAATATGACCAAAATCACTGG - Intergenic
1015246570 6:131081236-131081258 AAATCAAGGCAAAAAATAACAGG + Intergenic
1015641384 6:135337148-135337170 AAAATTATGCCAAAAAAAAAGGG + Intronic
1015818257 6:137232793-137232815 AAGACTTGGCCAAAAAGAACAGG - Intergenic
1016482758 6:144499534-144499556 AAAACAATGCAAAAAAGAAAAGG - Intronic
1016711048 6:147172254-147172276 AAAAAAATGCAAAAATTAACTGG - Intergenic
1017712284 6:157181617-157181639 CAAACCATGCCCACAATAACTGG + Intronic
1018624999 6:165769360-165769382 AAAACAATGACAATAACAACAGG + Intronic
1020503128 7:8948782-8948804 AAAAATATGTCAAATATAAAAGG - Intergenic
1020558316 7:9697289-9697311 AATAATATGGCAAAGATAACTGG + Intergenic
1020971844 7:14953443-14953465 AAAACAATGCTCAAAATATCTGG + Intronic
1021135574 7:16960769-16960791 AAAACTATTCCAAAAATTTGAGG - Intergenic
1021868557 7:24981153-24981175 ATATCTATGCAAAAAATAAAAGG + Intronic
1022058261 7:26764281-26764303 AAAACTATGCAATAAAAAATAGG + Intronic
1023371703 7:39518438-39518460 AAAAATATGCAAAAATTATCTGG - Intergenic
1023447840 7:40250453-40250475 GAAACAATGTCAAAAATAATGGG + Intronic
1024790345 7:52958442-52958464 AAAACAATGCCCCAAATTACGGG - Intergenic
1024816905 7:53282113-53282135 AAAACAAGGCTAGAAATAACTGG - Intergenic
1026106543 7:67425149-67425171 AAAAATATACAAAAACTAACTGG - Intergenic
1026439911 7:70435125-70435147 AAAAGTATGCCAAAGACAAGAGG - Intronic
1027876256 7:83773484-83773506 AAAGCTATTCCAAAAGTAAAAGG + Intergenic
1027881948 7:83850861-83850883 ATGACTATGCCAAATATAACAGG - Intergenic
1027950468 7:84808689-84808711 GAAAATATGTCAAAAAGAACGGG + Intergenic
1028059844 7:86298512-86298534 CAAACTATGCCAAAACTTAGCGG - Intergenic
1028335167 7:89643549-89643571 AAAACTATCCCAAAACTCAGTGG - Intergenic
1030092604 7:105871036-105871058 TAAACTACTTCAAAAATAACTGG - Intronic
1030283392 7:107799966-107799988 AAAACTATGTTAAAACAAACTGG - Intronic
1031494578 7:122431094-122431116 AAAACTAACACTAAAATAACAGG - Intronic
1031762906 7:125737078-125737100 AAAACCATGCTAAAAAAAATAGG + Intergenic
1031783147 7:125995923-125995945 AAAACTTTCCCAGAAATACCAGG - Intergenic
1032001750 7:128270451-128270473 AAAACTATTTAAAAAATAGCTGG + Intergenic
1032621471 7:133537990-133538012 GAAAGTATACCAAAAAAAACAGG - Intronic
1033140169 7:138819042-138819064 AAAACTATACAAAAAGTAGCCGG + Intronic
1033335359 7:140447574-140447596 AAAACTATACAAAAATTAGCCGG - Intergenic
1033392988 7:140946058-140946080 AAAACAAAGCCAAACAAAACAGG - Intergenic
1034008564 7:147503193-147503215 CAAGGTATGCCAAAAATTACTGG - Intronic
1034098374 7:148430257-148430279 AAAACAATGCCATAAAAAAGTGG + Intergenic
1034327171 7:150247224-150247246 AAAGCTGTGCCAGAAATAAATGG - Exonic
1034383790 7:150721015-150721037 AAAACTATGCCTGAAACTACAGG - Exonic
1035753655 8:2013646-2013668 CAAACTATTCCAAAAATTAGAGG - Intergenic
1036478265 8:9114355-9114377 AAAACTATATCAAAAAGAATGGG + Intronic
1036531595 8:9594191-9594213 AATACTATACTTAAAATAACAGG - Intronic
1036739989 8:11351638-11351660 AAAGCTATGACAAAAATTTCTGG - Intergenic
1037650510 8:20834003-20834025 AAAAATATGAAAAAATTAACTGG - Intergenic
1038095880 8:24309277-24309299 TAAACTATGAGAAACATAACAGG - Intronic
1038245721 8:25853663-25853685 ACGACTGTGCCAAAAATAATAGG + Intronic
1038323724 8:26553883-26553905 AAAAAAAGCCCAAAAATAACAGG - Intronic
1038371731 8:27000406-27000428 AAAATAATGCAAAAAATAATAGG - Intergenic
1038539152 8:28377091-28377113 AAAAGTAATCCAAAAATATCAGG + Intronic
1039274093 8:35915744-35915766 ACAATTGTGCCAAAAATAAAGGG - Intergenic
1039673478 8:39632007-39632029 TAAATTATGCAAAAAATAACAGG - Intronic
1040484414 8:47856387-47856409 AAAAAAATGCAAAAATTAACTGG - Intronic
1040814107 8:51488837-51488859 AAAACAATGCCAGAAGAAACAGG + Intronic
1041535856 8:58924877-58924899 GAAACTATTCCAAAAAACACAGG - Intronic
1041544319 8:59024885-59024907 AAAACTTTGCCAAATTTGACTGG - Intronic
1041816052 8:61972641-61972663 AAATGAATGCCAAAAATAAAAGG + Intergenic
1042760926 8:72270667-72270689 AAAACTATTCCTAAAGAAACAGG - Intergenic
1043013883 8:74913580-74913602 ACAACTAAGCCAACAATAACAGG - Intergenic
1044006657 8:86945101-86945123 AATACTATGGTAAAAATAATTGG + Intronic
1044443858 8:92250744-92250766 AAAACTATGCCCAAAAAAAGTGG - Intergenic
1045047412 8:98293323-98293345 TAAACCAAGCCAAAAATAAATGG + Intronic
1045129326 8:99131124-99131146 AAAATTATTCCAAAAAGAAAAGG - Intronic
1045214613 8:100135053-100135075 AAAACTATGCAATTATTAACTGG + Intronic
1045237833 8:100371470-100371492 AAAACTATTCCAAAGAGAAAGGG - Intronic
1045313278 8:101022141-101022163 AAAAATATTTTAAAAATAACTGG + Intergenic
1045399119 8:101793830-101793852 ACCACTTTGCCAGAAATAACTGG + Intronic
1045621042 8:103978947-103978969 ATAACTTTACAAAAAATAACTGG + Intronic
1047439748 8:124867059-124867081 AAAATTATGCCAGAAAAAGCAGG - Intergenic
1047698851 8:127430359-127430381 CAAAATATGCCAAAAAGAAAAGG - Intergenic
1048912393 8:139148444-139148466 AAAACTTTCCCAAAACTGACAGG + Intergenic
1049134607 8:140884687-140884709 CAAACTATGCTATAAACAACTGG - Intronic
1049285386 8:141772243-141772265 AAAACTAAGAAGAAAATAACAGG - Intergenic
1050621137 9:7453129-7453151 AGAATTTTGCCAAAAATAAAAGG - Intergenic
1051010931 9:12413352-12413374 AAAACTATGCCTATAATCTCAGG + Intergenic
1051328728 9:16000826-16000848 AAAATTATGCTAAGAATAAGTGG - Intronic
1051704656 9:19864272-19864294 AAAACTATTCCAAAAAATAGAGG + Intergenic
1052651917 9:31315166-31315188 AAAACTATACCAAAAGTTAATGG + Intergenic
1053334725 9:37256802-37256824 TACACTAGGCCAAAATTAACAGG - Intronic
1055827362 9:80343445-80343467 AAAACTATTCCAAAAAATAGAGG + Intergenic
1055835455 9:80435273-80435295 AAAACTGTGCTACAAATAGCAGG - Intergenic
1056411435 9:86331587-86331609 AAAAATATGCCAAAGACAAAAGG - Intronic
1057180821 9:93029197-93029219 AAAAATATACAAAAAATAGCCGG - Intronic
1057224876 9:93287710-93287732 AAAACTGTTCAAAAAATAAAAGG - Intronic
1058218142 9:102260632-102260654 AAAACAACAACAAAAATAACCGG + Intergenic
1058354246 9:104063760-104063782 AAAAAAATGCAAAAATTAACTGG + Intergenic
1060255711 9:122028415-122028437 AATACTAAGCCAAAGAAAACTGG + Intronic
1060326897 9:122625617-122625639 CAAACTATGTCAAAACTCACAGG + Intergenic
1061855957 9:133442107-133442129 ACAACAAAGACAAAAATAACGGG - Intronic
1062296050 9:135827690-135827712 AAACTTCTGCCAAAAAAAACTGG + Intronic
1203489092 Un_GL000224v1:86855-86877 AAAACAATAACAAAAATAATTGG + Intergenic
1203501713 Un_KI270741v1:28750-28772 AAAACAATAACAAAAATAATTGG + Intergenic
1185475739 X:414220-414242 AAAAGCATGTCAAAAATAAAAGG + Intergenic
1186007242 X:5086154-5086176 AAAAATATTTCAAAATTAACCGG - Intergenic
1186322299 X:8441958-8441980 ACAACTATGGAGAAAATAACTGG - Intergenic
1187438565 X:19295495-19295517 CAAACCATACCAAAAATTACTGG - Intergenic
1187610968 X:20942411-20942433 AAAACAAAACAAAAAATAACTGG + Intergenic
1188020676 X:25153629-25153651 CAAACTATGCCAAAACTTAGTGG + Intergenic
1188283776 X:28303160-28303182 AAAACAATACAAAAATTAACTGG + Intergenic
1188617037 X:32170135-32170157 AAAAATATGTCAAAAGTAACAGG - Intronic
1188971896 X:36627899-36627921 AAAACTATTCCAAAAAATAGAGG - Intergenic
1189139842 X:38591835-38591857 AACACTATTCAAAAAAGAACTGG - Intronic
1189386948 X:40544903-40544925 GAAACCATGCCAAAAATGAGAGG + Intergenic
1189414152 X:40800037-40800059 AAAACAATCCCATAAAAAACTGG + Intergenic
1189455278 X:41182211-41182233 AAAAATATGCAAAAATTAGCTGG + Intronic
1189505126 X:41605687-41605709 AAAACTCTGTCAAAAAAAATTGG - Intronic
1189548017 X:42063097-42063119 GAAACTATGCCAAAAAATAGAGG - Intergenic
1190680626 X:52824866-52824888 AATAATGTACCAAAAATAACAGG + Intergenic
1191212434 X:57901864-57901886 AAAATTATTTCAAAAATTACAGG + Intergenic
1191215929 X:57932444-57932466 AGAACTCTGCCCAAAATAGCAGG - Intergenic
1191801242 X:65082709-65082731 CAAACTATTCCAAAAATTAGAGG + Intergenic
1192718407 X:73667218-73667240 AAAAATATGCTAAAAATAAAGGG - Intronic
1192747663 X:73955770-73955792 AAAACAAAGCAAAAATTAACTGG + Intergenic
1192991991 X:76470099-76470121 CAAACTATTCCAAAAAGTACAGG - Intergenic
1193631526 X:83894251-83894273 CAACCTATTCCAAAAAAAACAGG - Intergenic
1193696993 X:84720616-84720638 AAAACTATTCCAAAAAATAGAGG - Intergenic
1193961326 X:87928368-87928390 AAAACTATTCCAAAAATTTGAGG + Intergenic
1194528813 X:95016921-95016943 AAAAGTAAGCAAAAAATATCTGG + Intergenic
1195436684 X:104852500-104852522 AAAACCATGACAAATAGAACTGG - Intronic
1196888000 X:120265545-120265567 ATAAATATCCCAAAATTAACTGG + Intronic
1197023711 X:121721141-121721163 AAAATTATACCAAATATAAATGG - Intergenic
1197307969 X:124867088-124867110 CAAACTATTCCAAAAAATACAGG + Intronic
1197367000 X:125575572-125575594 CAAACTATTCCAAAAATTAGAGG + Intergenic
1198020502 X:132652567-132652589 GAAAGTATGCCAAAAATACAGGG + Intronic
1198441009 X:136663284-136663306 AAAACTATACCATAAAAAAAGGG - Intergenic
1198995064 X:142565340-142565362 CAAACTATGCCATAAAATACAGG - Intergenic
1199099792 X:143785671-143785693 AAAGCTATGATAAAAATAATGGG + Intergenic
1200298301 X:154945202-154945224 CAAACTATCCCAAAAATCAAGGG + Intronic
1200501372 Y:3954161-3954183 AAAACCTTGCAAAAAAGAACTGG - Intergenic
1201186751 Y:11412474-11412496 AATAATATGCCAGAATTAACAGG - Intergenic
1201383068 Y:13406397-13406419 AAAACTAGGACAAAAAAAAAAGG - Intronic
1201523041 Y:14897987-14898009 TAAACTAAGCCAAAAAGAGCAGG - Intergenic
1201681005 Y:16643577-16643599 AAAGGTATGGCAAAAGTAACTGG - Intergenic
1202282666 Y:23206552-23206574 AAAATTATGCCAAAGTTAAAAGG - Intergenic
1202283225 Y:23211967-23211989 AAAATTATGCCAAAGTTAAAAGG + Intergenic
1202434340 Y:24820937-24820959 AAAATTATGCCAAAGTTAAAAGG - Intergenic
1202434899 Y:24826353-24826375 AAAATTATGCCAAAGTTAAAAGG + Intergenic
1202592498 Y:26501172-26501194 ACAACAATGCCAAAGCTAACAGG - Intergenic