ID: 1117673444

View in Genome Browser
Species Human (GRCh38)
Location 14:58131599-58131621
Sequence CCTCCAAAGCAGGAAGTGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 256}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117673444 Original CRISPR CCTCCAAAGCAGGAAGTGCA GGG Exonic
900548927 1:3243942-3243964 TCTCCACAGCAGGAAATGAAGGG - Intronic
900690855 1:3979463-3979485 CCCTCAAAGCAGCAAGTTCAAGG - Intergenic
901037173 1:6343337-6343359 CCTCCAAAGAAGCAGGTGCTGGG - Intronic
901452233 1:9342791-9342813 TCTCCAAAGGAAAAAGTGCAGGG - Intronic
901646898 1:10721707-10721729 CCTGCAAACCAGGAAGTGGACGG + Intronic
902337333 1:15760999-15761021 CCTCCCAAGCAGTGACTGCAGGG - Intronic
902903095 1:19533788-19533810 CCAGCAAGGCAGGAAGTGGAAGG + Intergenic
903118533 1:21197835-21197857 ACTCTAAAACTGGAAGTGCAGGG - Intergenic
903227152 1:21900236-21900258 CCGCCAAACCAGGAACTGCAGGG - Intronic
903490972 1:23728283-23728305 CATTCAAACCAGGAAGTGAAAGG + Intergenic
905136515 1:35804680-35804702 CAGCCACAGCAGGAAGTGGAGGG + Intergenic
905297571 1:36963849-36963871 CTCCCAAAGCAGGCAATGCATGG + Intronic
906711491 1:47933429-47933451 CTGCCAAAGCACAAAGTGCAAGG - Intronic
907198043 1:52703247-52703269 TGGCCAAAGCAGGAAGGGCAGGG - Intergenic
907695461 1:56722689-56722711 TTGCCAAAGCAGAAAGTGCAAGG + Intronic
909929661 1:81481536-81481558 CCCCCAAATCAGGGAGAGCAAGG - Intronic
910156766 1:84228080-84228102 TCCCCAAAGCAGGGCGTGCAAGG + Intronic
910653799 1:89599676-89599698 GCTCCAAAACAGTAATTGCAGGG - Intergenic
911339562 1:96620240-96620262 TCCCCAAAGCAGGAAGTCTATGG + Intergenic
911373450 1:97023054-97023076 CTTCCAAAACAGGAAGTACTAGG + Intergenic
914021505 1:143872876-143872898 ACTACAAAGCAGGAATCGCAAGG + Intergenic
914659995 1:149780793-149780815 ACTACAAAGCAGGAATCGCAAGG + Intergenic
914825403 1:151135544-151135566 CCTGCAAAGCAGGGAGGGGATGG - Intronic
916701634 1:167301715-167301737 CCTCCCAACCAGGAACTGTAAGG - Intronic
917643820 1:177009707-177009729 CCTCCAGAGCAGGCAGTGTAAGG + Intronic
918433296 1:184484516-184484538 CCCCGAAGGCAGGAACTGCATGG + Intronic
918452268 1:184670882-184670904 CCTCAAAAGCAGGAAGGGTTGGG - Intergenic
922315182 1:224435070-224435092 CCTCCGAAGCCGGGCGTGCATGG + Intronic
922748857 1:228061515-228061537 CCTCCAGAGCTGGAATTCCATGG + Intergenic
922901328 1:229138942-229138964 TCTCCACAACAGGAAGGGCAAGG - Intergenic
1062807289 10:432318-432340 CTTTCAAAACAGGAAGTGCCAGG - Intronic
1069743401 10:70699821-70699843 TCTCCAGACCAGGAAGTGGAAGG - Intronic
1069757432 10:70781866-70781888 CGTCCAAAGCAGTAGGTGCCAGG + Exonic
1069797849 10:71064646-71064668 CTCCCCAAGCAGGAATTGCAGGG - Intergenic
1069980444 10:72248787-72248809 CAACCAATGCAGGAAGTCCAAGG - Intergenic
1073322774 10:102625791-102625813 TCTCTAAAGCAAGAAGTGGACGG - Intronic
1074561588 10:114539971-114539993 CCTCCTAATTAAGAAGTGCAGGG - Intronic
1074992048 10:118717860-118717882 CCTCCATAGCAAGATGTGCCGGG + Intronic
1075935470 10:126337365-126337387 ACTTCAAAGCAGGAAGAGGAAGG - Intronic
1076781272 10:132725992-132726014 CCTCAAAAGCAAGCAGTTCACGG + Intronic
1080404187 11:31964351-31964373 CCAACAAAGTAGGAAGTGCCTGG - Intronic
1080668283 11:34354934-34354956 GCTCCAGGGCAGGAAGTGGAGGG - Intronic
1085158799 11:74321992-74322014 GCTCCAAAAGAGGAAGTGCACGG + Intergenic
1085517420 11:77119523-77119545 CCTCCAATGCAGGAAGGCTAAGG - Intronic
1085527729 11:77173866-77173888 CCTCTAATGCAGGGGGTGCAGGG + Intronic
1087859283 11:103133556-103133578 ATTCAAAAGCAGGAAGTGGAGGG + Exonic
1088640703 11:111870678-111870700 CCTTAAAAGCAGGAAGTGGAAGG - Intronic
1089580907 11:119481605-119481627 CCTCCGAAGCGGGAAGTCCCAGG - Intergenic
1089702897 11:120255930-120255952 CCGCCAAACAAGAAAGTGCAGGG - Intronic
1089792312 11:120953853-120953875 CCTCCACTGCAGTAAGTGGAGGG - Intronic
1090444186 11:126749156-126749178 ACTCCAAAGCAGGGAGGACAAGG - Intronic
1090522710 11:127496247-127496269 CCGCTAATGCAGGAGGTGCAAGG - Intergenic
1091460573 12:641317-641339 TCTGCAAAGCAGGAGGTGGAGGG - Intronic
1091815181 12:3432293-3432315 CCTCCACAGGCTGAAGTGCAAGG - Intronic
1094197754 12:27767228-27767250 CCCCCAAAGCTGGAATTACAGGG + Intronic
1095241126 12:39860012-39860034 GGTCCAAAGCAAGAAGAGCAAGG + Intronic
1096244305 12:49975694-49975716 CCTGCAAGGCAGGAAGCCCAAGG - Exonic
1098160801 12:67647595-67647617 CCTCTCGAGAAGGAAGTGCATGG + Intergenic
1099038430 12:77619554-77619576 CCTTCTAAGCAGGCATTGCATGG + Intergenic
1100789699 12:98117251-98117273 CCTCCAAAGCCTGATTTGCATGG + Intergenic
1102455610 12:113069247-113069269 CTAGCAAAGCAGGAAGTGGAGGG - Intronic
1103376205 12:120457986-120458008 CATTCAAAGCAGGAGGAGCATGG + Intronic
1103727083 12:123003332-123003354 ACAGCAAAGCAGGAAGTGCCAGG - Intronic
1104615012 12:130260118-130260140 CACCCAAAGCATGGAGTGCAGGG + Intergenic
1105586912 13:21754211-21754233 CCGCCAAAGCAAGAAGGGCCAGG + Intergenic
1105943092 13:25169039-25169061 CCTCCAAAGCTGAAAGAGCCAGG - Intronic
1107692235 13:42965466-42965488 CCCTCAAAGCAGGATCTGCAAGG + Intronic
1109050288 13:57472159-57472181 CCTCAAAAGCAACGAGTGCATGG - Intergenic
1109622609 13:64928915-64928937 GCCACAAAGCAGGAAGTGAATGG - Intergenic
1113122740 13:106941978-106942000 CCTGCATAGCAGGAAGTGAGCGG - Intergenic
1113472853 13:110559102-110559124 CCTGCAAGGCAGGCAGTGGATGG - Intronic
1115628663 14:35221107-35221129 GCTCTAAAACAGGAAGTGGATGG - Intronic
1115781861 14:36777653-36777675 CACCCAAAGCAGGAGGGGCATGG + Intronic
1115799565 14:36977278-36977300 CCTTCATAGCAGGAAGGGGAAGG - Intronic
1116781683 14:49243969-49243991 CCCCTAACCCAGGAAGTGCAAGG + Intergenic
1117673444 14:58131599-58131621 CCTCCAAAGCAGGAAGTGCAGGG + Exonic
1118633798 14:67729257-67729279 CCGCCAGAGCAGGCAGAGCAGGG - Exonic
1120000831 14:79301604-79301626 CCTCCAAGGGATGATGTGCAAGG - Intronic
1122383687 14:101329383-101329405 CCTCCAAAGCTGAAAGCACAAGG + Intergenic
1123625801 15:22226229-22226251 CCTCCAATCCAGGCACTGCAGGG + Intergenic
1125838551 15:42775882-42775904 CTTCCAAAGCAGGATGTGGCAGG - Intronic
1126016516 15:44356579-44356601 CTTCCAAAGCAGGAAGCACCAGG + Intronic
1130790055 15:87144665-87144687 CCTCTAAAGAAGGAAATGCTAGG - Intergenic
1131778806 15:95831665-95831687 CCTCCAAAGCACAAAGTACTAGG + Intergenic
1131926013 15:97384805-97384827 CCTCAAAAGCTGGAAAAGCAAGG - Intergenic
1132285036 15:100656739-100656761 CCTCCAGTGCAGGCAGGGCATGG - Intergenic
1132327734 15:100985827-100985849 ACTCCTTTGCAGGAAGTGCAGGG - Intronic
1135117370 16:19735079-19735101 GCCCCAAAGCAGGAATAGCAAGG - Intronic
1137485134 16:48884228-48884250 CTTCCAAGGTAGGAAGTGAAGGG - Intergenic
1138243018 16:55444482-55444504 CCTCCTGAGCAGGAGGTGCTGGG + Intronic
1139120437 16:64009762-64009784 GCTCCACAGCAGGAGGTGAATGG - Intergenic
1140033798 16:71358292-71358314 CTTCCACAGCAGGAAGAGCTGGG - Intergenic
1140506556 16:75477291-75477313 CCTGCAAAGCAAGCAGGGCAAGG - Exonic
1140819320 16:78648361-78648383 TCCCCAAAGCAGTAAGTGCAGGG - Intronic
1141156424 16:81600454-81600476 CCTCAAAAACAGTAAGTGAAAGG + Intronic
1141609843 16:85175165-85175187 TATCCAAAGCAGAAGGTGCAGGG - Intronic
1141652140 16:85398368-85398390 CCTCCTGAGCAGGAGGTGGAGGG + Intergenic
1142264828 16:89058845-89058867 CCTCCACAGCAGGAAGACCATGG + Intergenic
1142418357 16:89955307-89955329 CCCCCAAGGCAGGAAGGGCCAGG + Intronic
1142574712 17:898906-898928 CCTGCAAAGAAGGAAGGACAGGG + Intronic
1142888963 17:2930496-2930518 CCTGCGAAGTAGGAAATGCAGGG - Intronic
1144521161 17:15953100-15953122 CCTGCAGAGCTGGGAGTGCAGGG + Intronic
1145245152 17:21264141-21264163 CTGCCACAGCAGGAAGTGCTGGG - Intergenic
1145987586 17:29057595-29057617 CTTCCAAAGCAATTAGTGCAAGG - Intergenic
1146462567 17:33057738-33057760 CCTCCAGGGCAGGAAGTTCTGGG + Intronic
1147953129 17:44118020-44118042 GCACCAAAGGAGAAAGTGCAGGG + Intronic
1152312286 17:79558606-79558628 CCTCTCAAGCAGTGAGTGCATGG - Intergenic
1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG + Intergenic
1152689189 17:81710239-81710261 GCTCCAAAGCAGAAAGAGCAGGG - Intergenic
1152959207 18:68336-68358 CTCCCAAATCAGGAAATGCAAGG + Intronic
1153758154 18:8303860-8303882 CCTGCAACTCAGGAAGTGCTTGG - Intronic
1155208432 18:23580560-23580582 CCACCAGAGCTGGGAGTGCAGGG + Intronic
1156270231 18:35523875-35523897 TCTCCAGAACAGGAAGAGCAAGG - Intergenic
1156349148 18:36287960-36287982 CCTCCAAAGCATGGAGCCCAAGG + Intergenic
1156671770 18:39479375-39479397 CTTTCAAAACAGGAAGAGCAAGG - Intergenic
1156672085 18:39482686-39482708 ACTTCAAATCAGGAAGAGCAAGG + Intergenic
1157587693 18:48815604-48815626 CATCCAAAGCTGGCACTGCAGGG + Intronic
1158421066 18:57294721-57294743 GCTCCACAGCAGGAGGTGAATGG + Intergenic
1160009135 18:75090282-75090304 GCTCCAAAGTAGGAATTGCGTGG + Intergenic
1162627167 19:11893999-11894021 CCTGCAAAGCAAGATATGCATGG + Intronic
1163173727 19:15550522-15550544 GCTGCATTGCAGGAAGTGCAAGG + Intronic
1163290668 19:16377217-16377239 CCTCCCAAGGAGGAGGTGAAAGG + Exonic
1165521025 19:36314089-36314111 CCTGCAAACCAGGAAATACATGG + Intergenic
1165623044 19:37264499-37264521 CCTGCAAACCAGGAAATACATGG - Intergenic
1168491554 19:56815039-56815061 AGTCCACAGCAGGAAGTGCCTGG - Exonic
925680153 2:6411885-6411907 CCTCCCAAGCAGGAACAGCCAGG - Intergenic
925871398 2:8274470-8274492 TCTCCAGAACATGAAGTGCAAGG - Intergenic
928351605 2:30561394-30561416 CCCACAAAGCATGAAGAGCATGG - Intronic
929037382 2:37707230-37707252 CCTCCCAAGCAGGCAGGGCCGGG - Intronic
929688819 2:44057824-44057846 GCTCCAATGAAGGAAGTACAAGG + Intergenic
931284577 2:60821123-60821145 TCTCCAAAGCAGAACCTGCAAGG - Intergenic
931517021 2:63055963-63055985 CCGCCAAAGTAGGAAGAGGAGGG - Exonic
932856385 2:75237801-75237823 CTCCAAAAGTAGGAAGTGCAAGG - Intergenic
934526418 2:95054669-95054691 CCTCCATGGCAGGAAGCTCACGG - Intergenic
934572581 2:95382264-95382286 CCTCCAAGGCAGTGAGTGCGAGG - Intronic
935094765 2:99933990-99934012 CCTCCAAAGCCTGTAATGCATGG - Intronic
935159235 2:100514844-100514866 CTTCTGAAGCAGGATGTGCAGGG - Intergenic
935203796 2:100880937-100880959 CCAAGAAAGCAGCAAGTGCAGGG + Intronic
938066051 2:128282623-128282645 CCTGCAAGGCAGGAAGTGGCAGG + Intronic
938415456 2:131100326-131100348 AATCCAAAGCAGGGAGTGAAGGG + Intergenic
939129724 2:138220260-138220282 CATACAGAGCAGGAAGTGTAAGG + Intergenic
939444424 2:142290425-142290447 ACTCCAAAGCAGAAAATGAAAGG + Intergenic
940478950 2:154203657-154203679 TCTCCAAAGCACCAGGTGCAAGG - Intronic
944667327 2:201968646-201968668 CCTCAGAAGCAAGCAGTGCATGG + Intergenic
945346067 2:208718222-208718244 TCTCCAAAGCATAAAGTGCAAGG - Intronic
946337058 2:219044906-219044928 CCTCCAAAACAGTAGCTGCAGGG - Intergenic
946486310 2:220103779-220103801 CCTCAGGAGCAGGAAGTTCAGGG - Intergenic
948087649 2:235264943-235264965 CCTGCACAGCAGGAGGTGCGTGG + Intergenic
948829827 2:240593203-240593225 CCTCTAAAGCCTGAAGTGCTAGG - Intronic
948836183 2:240627052-240627074 CCTCCTGGGCAGGAAGTGGAAGG + Intronic
948868136 2:240785543-240785565 CCTCCAGAACAGGAAGCCCAAGG + Intronic
1168892091 20:1301183-1301205 CCTCCACAGCAGGAAGTAGATGG - Intronic
1168961537 20:1873430-1873452 CCTCCTAAGCAGAAAGCTCAGGG - Intergenic
1172529025 20:35617867-35617889 CCTCCAAAGCACCCAGGGCAGGG - Intronic
1172770467 20:37379380-37379402 CCCCAGAACCAGGAAGTGCAAGG + Intronic
1172978216 20:38922002-38922024 CTTCCAAAGCAGGTGCTGCATGG + Exonic
1173585234 20:44177211-44177233 CCTCCAAGGCAGGAAGTCTATGG + Intronic
1174744948 20:53052329-53052351 GCTCCACAGCAGGAAGTGAGTGG + Intronic
1175713111 20:61236821-61236843 CCTCCAAAGCAGGAAGAAGAGGG - Intergenic
1176046946 20:63097643-63097665 CCTCCTAAGCAGGACGTGGAGGG - Intergenic
1176109162 20:63403364-63403386 GCTCCAAGGCTGGAAGTGCGAGG + Intergenic
1176181963 20:63753686-63753708 CCTGCACAGCAGCAAGTACATGG - Intronic
1178274474 21:31224445-31224467 CCTCCAAAACATGAAGCTCAGGG + Intronic
1178722112 21:35019196-35019218 CCTGCAAGGCAGGAAGTGCCAGG - Intronic
1182132858 22:27870829-27870851 CCTCCACAGCAGCAAGTGGATGG + Intronic
1182749002 22:32626970-32626992 CCTCCAAAGCTGGGGGTGCAGGG - Intronic
1183263333 22:36810460-36810482 CCTCAAAAGCATGAAGTGTGGGG + Intronic
1183813515 22:40278641-40278663 CCTCCAGAGCAGCAACTGCTAGG - Intronic
1184894838 22:47400848-47400870 CCTCCACAGCCTGGAGTGCATGG + Intergenic
1203275655 22_KI270734v1_random:84138-84160 CCCCCAAGGCAGGAAGGCCAAGG + Intergenic
949848962 3:8402162-8402184 GCTTCAAAGCAGGAAGTCAATGG - Intergenic
950354519 3:12395045-12395067 CCTTCAAAGCTGTGAGTGCATGG - Intronic
953575651 3:44111255-44111277 CCTGCAAAGCAGGGGGTGTAAGG - Intergenic
954318297 3:49813207-49813229 CCTCAAGAGCAGGAAGGGCTGGG - Intronic
954540268 3:51389055-51389077 CCCCCAAGGCAGCCAGTGCACGG + Exonic
954617342 3:51976043-51976065 TCTCCAAAGCGGGAAGGGCGGGG - Intronic
955148818 3:56346840-56346862 CCTCCAATGGAGAAAGGGCAAGG + Intronic
955635818 3:61028464-61028486 CCTCAAAAGAAGCAAGGGCAAGG + Intronic
955791466 3:62592696-62592718 CCTTCACAGCTGGCAGTGCATGG + Exonic
956092442 3:65682271-65682293 CCTACAAAGAAGGAAGTGGGAGG + Intronic
956152692 3:66259908-66259930 TTACCAAAGCAGCAAGTGCAAGG - Intronic
956187823 3:66579294-66579316 CTTCCAAGGCATGAAGTTCATGG - Intergenic
962261861 3:133915462-133915484 CCTCCCAAGAGGGAAGTGGAGGG - Intergenic
963877010 3:150487261-150487283 CCCCCAAAGCTGAAAGTGAAGGG + Intergenic
965626875 3:170690533-170690555 CCACCACCACAGGAAGTGCAGGG + Intronic
965769742 3:172169263-172169285 CCACCAAAGGAGCAAGTGAAGGG + Intronic
967243067 3:187460141-187460163 CCCCCAATGCATGAAATGCATGG + Intergenic
968293144 3:197554646-197554668 CCCTCAAAGTAGGAACTGCAGGG + Exonic
968477892 4:820935-820957 CGGCCCAGGCAGGAAGTGCAGGG - Intronic
969248942 4:5954581-5954603 CCTCCACGGCAGGCAGCGCATGG + Intronic
969498478 4:7539697-7539719 CCTCCACAGCAGGAAGGGGCGGG - Intronic
969978873 4:11133529-11133551 TCTCCATAGCAGGCAGTGCAGGG - Intergenic
970430481 4:15984543-15984565 GCTCCACAGCAGGAAGTGAGGGG + Intronic
970497229 4:16638757-16638779 CCTCGAAAGCAGGAAGAGTGAGG - Intronic
971255157 4:25007831-25007853 CCTGCAAAGGAGGAAGTGCATGG + Intronic
976468973 4:85404923-85404945 CCTCCAAAGCAGCAATTGCTTGG + Intergenic
976616922 4:87087450-87087472 TCTCCAGAGCAGGATGAGCAAGG + Intronic
978334458 4:107650825-107650847 CATCCAAAACAGGAAGAGAAGGG + Intronic
978586144 4:110277720-110277742 GCTCCAAAGCAGGCAAGGCAAGG + Intergenic
979952536 4:126911670-126911692 CCTTCCAAACAGAAAGTGCAAGG + Intergenic
980589484 4:134866445-134866467 CCACTAAAACAGGAAGTTCATGG + Intergenic
982007119 4:151074314-151074336 CTTCCATAGCAGGAAGAGGAGGG + Intergenic
982857746 4:160406709-160406731 CCTGCAAAGGAGAAAGTGTAGGG + Intergenic
983069819 4:163254567-163254589 CCTCCAACTCAGAAAGGGCAGGG + Intergenic
984888118 4:184468937-184468959 CTTCCAAAGGAGGAAGTGATTGG + Intronic
985350424 4:189055546-189055568 CCACCACTGCAGGAAGTGCCAGG + Intergenic
986274836 5:6264646-6264668 TCTGCAAGGCAGGAAGTGCAGGG + Intergenic
986485342 5:8230210-8230232 CCTCCTAAGAAGGCAGTGCATGG + Intergenic
989822431 5:45810002-45810024 CTTCCAAAGCAGGAAGTAGTAGG + Intergenic
990346840 5:54880045-54880067 TCTGCAAAGCAGGAAGTCCAGGG - Intergenic
992294586 5:75314972-75314994 CCTCCAAAGGAGCAACTGTAAGG + Intergenic
995336080 5:111001382-111001404 ACTGAAAAGCAGGAAGGGCAAGG + Intergenic
996587068 5:125101118-125101140 CCTATAAAACAGGAAGTGAAAGG - Intergenic
997229329 5:132231278-132231300 CCTGCAAGGCAGGAAGACCAAGG - Intronic
997255201 5:132423116-132423138 CCTCCAAAGTGGGAGCTGCAGGG + Intronic
998184764 5:139969793-139969815 CCTCTCAAACAGGAAGGGCAAGG + Intronic
1000067226 5:157705088-157705110 GGGCCAAAGCAGGAAATGCAGGG - Intergenic
1001122356 5:168991315-168991337 CCTCCAAAGGAGGAAGTGGTAGG + Intronic
1001441423 5:171746437-171746459 TATCCAAACCAGGAAGTACAAGG - Intergenic
1001731465 5:173963686-173963708 CCTCCAAATAAGGAAGCGCCAGG - Intergenic
1002015924 5:176322695-176322717 CCTGAAATGCAGGAAGTGAAGGG - Intronic
1002575417 5:180171238-180171260 CCTCCCAAGCAGAAAGTCCCGGG - Intronic
1002595232 5:180317868-180317890 CCTCCAGAGCATCAGGTGCAGGG - Intronic
1002598353 5:180338946-180338968 TCTGCAAATCAGGGAGTGCATGG - Intronic
1003426276 6:6000124-6000146 CCTCCAAGGCCGGAACTGCGGGG + Intronic
1004356419 6:14933403-14933425 TCTCCAAAGCAGGGTTTGCATGG - Intergenic
1005088427 6:22031423-22031445 CATCCAGAGCAGGAACGGCATGG - Intergenic
1005222622 6:23605105-23605127 CTTCCAAAGCAGAAAGTTCCAGG + Intergenic
1006424568 6:33956139-33956161 CTCCCCAAGCAGGAAGGGCAAGG - Intergenic
1008960579 6:57261753-57261775 GCTCCAAAGCAGGGAGGGAATGG - Intergenic
1011751533 6:90459601-90459623 CCTGTAAAACGGGAAGTGCAGGG + Intergenic
1011981303 6:93382440-93382462 GCTCCACAGCAGGATGTGCGGGG - Intronic
1014937880 6:127405146-127405168 CCACCAAAATAGGAAGTTCAAGG - Intergenic
1018008930 6:159650033-159650055 ACTCCCAGGCAGGAAGTGAAGGG + Intergenic
1018453321 6:163929303-163929325 CCACAAAAGCAAGAAGTGAAAGG - Intergenic
1019111708 6:169722899-169722921 CGTCAAATGCTGGAAGTGCAAGG + Intronic
1019794563 7:3040281-3040303 CCTGCAAAGCAGATAGTGCAGGG + Intronic
1020257712 7:6511095-6511117 CCTCCAAAACAGGGAGGGGAGGG + Intronic
1021254372 7:18372373-18372395 CCTCCAAACCAGGACAGGCATGG + Intronic
1023515171 7:40994566-40994588 CATCCAAACCAGGAAATGCAGGG + Intergenic
1025212116 7:57025780-57025802 CCTCCAAGGCATGCAGTGGACGG + Intergenic
1025659838 7:63551048-63551070 CCTCCAAGGCATGCAGTGGACGG - Intergenic
1025754308 7:64321345-64321367 CCTTCAAAGCAAAAGGTGCATGG - Intronic
1029675294 7:102064535-102064557 CCTCCAAGGCATGCAGTGGATGG + Intronic
1030512082 7:110494905-110494927 CCTCCAAATTGGAAAGTGCAAGG + Intergenic
1030904008 7:115160338-115160360 GCTGCAAAGCAGGAAGTGAGTGG + Intergenic
1033535504 7:142308394-142308416 CCTTTAAAGGAGCAAGTGCAGGG + Intergenic
1033685361 7:143635411-143635433 ACTTCAGAGCTGGAAGTGCAGGG - Intronic
1033688531 7:143714629-143714651 ACTTCAGAGCTGGAAGTGCAGGG - Intronic
1033699254 7:143822209-143822231 ACTTCAGAGCTGGAAGTGCAGGG + Intergenic
1034788076 7:153943496-153943518 CCTCCCAAGTAGGGAGGGCAGGG + Intronic
1035026563 7:155830388-155830410 CCTCCCAAGGAGGACGTGCAGGG - Intergenic
1036259604 8:7229298-7229320 CCTCAAAAGCAGGAAAGACAGGG + Intergenic
1036307013 8:7610226-7610248 CCTCAAAAGCAGGAAAGACAGGG - Intergenic
1036311647 8:7687868-7687890 CCTCAAAAGCAGGAAAGACAGGG + Intergenic
1036357861 8:8058213-8058235 CCTCAAAAGCAGGAAAGACAGGG - Intergenic
1036358925 8:8064355-8064377 CCTCAAAAGCAGGAAAGACAGGG - Intergenic
1036641543 8:10587394-10587416 CCTCCAAAGCAAGTGGAGCAAGG - Intergenic
1036727745 8:11234751-11234773 CCTCCAAATCAGGAATGGTAAGG - Intergenic
1036893088 8:12608733-12608755 CCTCAAAAGCAGGAAAGACAGGG + Intergenic
1038069775 8:24001319-24001341 CTTTCAAAGCAGCAATTGCAGGG - Intergenic
1039971065 8:42322161-42322183 CCTCCAGAGCAGGAAGGTCGGGG - Intronic
1040481711 8:47832969-47832991 CCTGCAAAGCAGGGAGTCCAGGG + Intronic
1041040704 8:53843333-53843355 ACTCCAAAGCAGCAAGAGGAGGG + Intronic
1043789740 8:84449313-84449335 CCACTACAGCAGGAAGAGCAGGG + Intronic
1045397016 8:101771269-101771291 CCTCCAGATCAGCAAGTTCAGGG + Intronic
1048428327 8:134343199-134343221 CCTTCAATGTAGGAAGTACAGGG - Intergenic
1049196968 8:141320995-141321017 GCCCCAAAGCAGGAAGGGCTGGG + Intergenic
1049215467 8:141405868-141405890 CCTCCAGCACAGGCAGTGCAAGG + Intronic
1049534812 8:143174063-143174085 ACTCCAGAGCAGGAAGTGTGTGG - Intergenic
1051147395 9:14041802-14041824 CCTCCCAGGCAGGAAGCTCAGGG + Intergenic
1051673000 9:19531119-19531141 CTTCCAAAGCAGGAACAACATGG - Intronic
1057817029 9:98303499-98303521 CCTCCAGAGCAGGATCTGCTGGG - Intronic
1057821227 9:98332596-98332618 CCTCCAAAGCACACAGTGCAGGG + Intronic
1059382806 9:113941085-113941107 CTTCCAAATCAATAAGTGCAAGG - Intronic
1186986333 X:15018275-15018297 TATCCAAAGCAGGAAGTGGAGGG + Intergenic
1187155538 X:16717658-16717680 CCTTCAGAGCAGGGAGTTCATGG - Intergenic
1187471221 X:19571088-19571110 CCTCCACCGCAGGAGGGGCAGGG + Intronic
1190436405 X:50429930-50429952 CCTCTGAAGCAGGTAGTGAAAGG + Intronic
1191733445 X:64363788-64363810 CGCCTAAACCAGGAAGTGCAAGG + Intronic
1195666088 X:107432664-107432686 CCTCCAAAACGGTAAGAGCAGGG + Intergenic
1195832324 X:109072561-109072583 GAGCCAAAGCAGGAAGTACAAGG - Intergenic
1196462414 X:115944193-115944215 GGCCCAAAGTAGGAAGTGCATGG - Intergenic
1196831097 X:119776197-119776219 TCTCCAAAGGAAGAAGGGCATGG - Intergenic
1197133778 X:123037000-123037022 CCTGCCAAGCAGAAAATGCAGGG - Intergenic
1199794400 X:151180639-151180661 CCTCCACAGCAGGACAGGCATGG - Exonic