ID: 1117674054

View in Genome Browser
Species Human (GRCh38)
Location 14:58138256-58138278
Sequence GAGGCTGCACAGGTGGCTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 303}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117674054_1117674062 11 Left 1117674054 14:58138256-58138278 CCCAGAGCCACCTGTGCAGCCTC 0: 1
1: 0
2: 5
3: 36
4: 303
Right 1117674062 14:58138290-58138312 GGCCTCCTTCCATACCCTCATGG 0: 1
1: 0
2: 2
3: 17
4: 179
1117674054_1117674059 -10 Left 1117674054 14:58138256-58138278 CCCAGAGCCACCTGTGCAGCCTC 0: 1
1: 0
2: 5
3: 36
4: 303
Right 1117674059 14:58138269-58138291 GTGCAGCCTCTGTCCAAGGCTGG 0: 1
1: 1
2: 2
3: 20
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117674054 Original CRISPR GAGGCTGCACAGGTGGCTCT GGG (reversed) Exonic
900343945 1:2202150-2202172 GAGTCTGCACAGGGGCCTCCTGG - Intronic
901146686 1:7069654-7069676 GAGCCTGGACAGCAGGCTCTGGG + Intronic
901348634 1:8570741-8570763 CAAGCTGCACAGATGGCTCCAGG + Intronic
901678457 1:10900136-10900158 GAGGCAGCCCAGCTGGATCTCGG + Intergenic
901833240 1:11906880-11906902 GAGGCTGGAAAGATGGCCCTGGG + Intergenic
901869200 1:12127497-12127519 TAGGCTGAGCACGTGGCTCTTGG - Intronic
902137636 1:14324044-14324066 TAGGGTGCACAGGTTGCTGTGGG - Intergenic
902810149 1:18883461-18883483 GAGGATGGACAGGAGGCTGTTGG - Intronic
903853191 1:26320562-26320584 GCTGCTGCACAGCTGGCTCTTGG - Intergenic
904200028 1:28813459-28813481 GAGGCAGCAGAGGTTGGTCTGGG + Intronic
904424489 1:30414732-30414754 GAGGCTGCAGGGTTGGCTCCAGG - Intergenic
904443618 1:30550409-30550431 GAGGCTGCAGCAGAGGCTCTGGG - Intergenic
904820734 1:33242159-33242181 GAGGCTGCAGGGGTGGATCAGGG + Intergenic
905393065 1:37650551-37650573 GAGCCTCCACAAGTGGGTCTCGG + Intergenic
907304936 1:53508220-53508242 GGGCTTGCACAGGTGGCTCTGGG - Intronic
908600566 1:65734592-65734614 GAGGAGGCACAGGTGTCTGTAGG - Intergenic
910046277 1:82921090-82921112 GAGGCTGCCTGGCTGGCTCTTGG + Intergenic
911142881 1:94524760-94524782 AAGGCTGGACAGGAGGCTCCTGG + Intergenic
912470168 1:109901294-109901316 GAGGAAGCCCAGGTTGCTCTGGG - Intergenic
913374408 1:118134708-118134730 TAGTCTGGACAGGTGGCTCAAGG - Intronic
914754898 1:150557088-150557110 GAGGCTGCAGGGCTGGCTCGGGG + Intronic
915253013 1:154603827-154603849 GAGGCTGCACAGGTAGAGGTGGG + Intronic
915486782 1:156226940-156226962 GAGGTTGCAGAGGAGGCTCCTGG + Intronic
915592769 1:156880069-156880091 GAAGCTCCACACGTCGCTCTCGG - Exonic
918398835 1:184143821-184143843 GAGGAGGCGGAGGTGGCTCTGGG + Intergenic
919250815 1:195054342-195054364 GGGGCTGCACAGGGCGCTCGCGG + Intergenic
920367590 1:205456308-205456330 GAGGCTGTGGAGGTGGCTCGTGG - Intergenic
920452948 1:206073983-206074005 GAGGCTGCAAAGGTGGGAATGGG - Intronic
922555609 1:226529967-226529989 GAGGCTTCAGGGGAGGCTCTGGG - Intergenic
922798532 1:228353354-228353376 GAGGCTGGAGAGGTCACTCTGGG + Intronic
922806326 1:228391771-228391793 GGTGCTGCACAGGTGGTGCTGGG + Intergenic
1062864184 10:835998-836020 CAGGCTGCACTGGTGGCTCAGGG + Intronic
1063467141 10:6254207-6254229 GGGGCTGGACTGGTGGCTCAGGG - Intergenic
1064097014 10:12431371-12431393 CCGGGTGCACAGGTGGGTCTGGG + Intronic
1064349686 10:14565770-14565792 GAGGCTGCAAAGGAGGCTGAAGG + Intronic
1064417883 10:15166767-15166789 AAGGCAGCACAGATGCCTCTGGG + Intronic
1067107845 10:43377460-43377482 GAGTCTGCACAGGTGGACCTAGG + Intergenic
1069781601 10:70959657-70959679 GAAGCTGCACAGCTGTGTCTTGG + Intergenic
1072506547 10:96073547-96073569 TAAGCTGCACAGTTGGTTCTGGG + Intergenic
1073435806 10:103514945-103514967 CAGGCTGGGCAGGTGGCTCATGG + Intronic
1074422526 10:113322072-113322094 CAAGCTCCACAGGTGGTTCTGGG + Intergenic
1075211689 10:120496451-120496473 GGGTCCTCACAGGTGGCTCTGGG + Intronic
1076245159 10:128941574-128941596 GAGGCTGCACTGCTGTCTCCTGG - Intergenic
1076248919 10:128969101-128969123 GAGGCAGCACAGGTGAGACTTGG + Intergenic
1076676936 10:132151998-132152020 GAGGCTGAGCAGGTGGCTTCAGG - Intronic
1076893325 10:133295908-133295930 AAGTCTGCACAGGTGGCACAAGG + Intronic
1077134935 11:993783-993805 GACGCTGCACAGGTGGAACTTGG - Exonic
1077390628 11:2299202-2299224 GAGGCTGCAAAGGCAGCTCCTGG + Intronic
1077440393 11:2566153-2566175 CAGGCTGCAAAAGTGGCCCTGGG - Intronic
1077564712 11:3290250-3290272 GAGCCAGCGCAGGTGGCTTTTGG + Intergenic
1077570602 11:3336067-3336089 GAGCCAGCGCAGGTGGCTTTTGG + Intergenic
1077722523 11:4642840-4642862 GAGGCAGCAGAGATGGCTCCAGG + Intergenic
1079357698 11:19743662-19743684 GGGGCTGGAGAGGTAGCTCTAGG - Intronic
1080114484 11:28606812-28606834 GAGGCTGCTCTGGTGCCTTTGGG + Intergenic
1080460303 11:32449124-32449146 TATGCTGCCCAGATGGCTCTGGG + Intergenic
1081278093 11:41175754-41175776 GAAGCTGCAGAGGGAGCTCTGGG - Intronic
1081526011 11:43928261-43928283 GAGGCTGCACATGTGGCCTGGGG + Intronic
1082772277 11:57217275-57217297 GAAGCTGTCCTGGTGGCTCTTGG - Intergenic
1083184532 11:61009487-61009509 GTGCCTGCACTGGTGGGTCTGGG + Intronic
1083254028 11:61485516-61485538 AAGGATGCACAGGTGGCTGGAGG + Intronic
1083752109 11:64766510-64766532 GAGACTGCAGAGGTGGGACTGGG - Intronic
1083763158 11:64829656-64829678 GAGGCTGCGCCGTTGGCGCTGGG - Exonic
1083855425 11:65390780-65390802 CAGGCTGCCCAGCAGGCTCTGGG - Intronic
1084121554 11:67071860-67071882 CAGGCTGCACAGGCGGCTCCAGG - Exonic
1086103886 11:83128995-83129017 GAGTCTGCAGAGCTGGATCTGGG - Intergenic
1087078647 11:94149337-94149359 GCAGCAGCACAGGTGGCCCTTGG - Intronic
1088717883 11:112564845-112564867 GAGGCTGCAGGGGTGGAACTGGG + Intergenic
1090112008 11:123922215-123922237 GGGTCTGTACAGATGGCTCTGGG + Intergenic
1090626593 11:128613879-128613901 GAGGGGGCTCAGGTGGCTGTGGG + Intergenic
1091221393 11:133931728-133931750 GAGGCCACAGAGGAGGCTCTTGG - Exonic
1091633504 12:2180028-2180050 GAGGCTGCTCAGGAGGCAGTTGG - Intronic
1091655112 12:2340497-2340519 GAGGTTGTACAGGTGGCACTTGG - Intronic
1091960088 12:4686573-4686595 GAGGCTGAACAGGAGGGTTTAGG - Intronic
1094491818 12:30965476-30965498 GAAGCAGGACAGATGGCTCTGGG - Intronic
1100994369 12:100287105-100287127 GAGGCACCAGAGGTGGCTTTTGG - Intronic
1101574742 12:105987063-105987085 TAGGCAGCATAGTTGGCTCTAGG + Intergenic
1102182483 12:110922948-110922970 GAGTCTGCAAAGGGGGCTCCAGG + Intergenic
1103485498 12:121279975-121279997 GAGCCTGCACAGGTGTGTCCGGG - Intronic
1103485698 12:121281316-121281338 GAGCCTGCACAGGTGTGTCCGGG - Intronic
1104440002 12:128786740-128786762 GAGGGGGCACAGCTGGCTCCTGG + Intergenic
1104821998 12:131682465-131682487 GGGGATGGGCAGGTGGCTCTGGG + Intergenic
1105837296 13:24223008-24223030 GAGCCTGCACAGGGGGCTGCGGG - Exonic
1106122679 13:26873613-26873635 GAGGCAGCACCGTTGGCTCTAGG + Intergenic
1106639169 13:31564931-31564953 GAGGATCCAAAGATGGCTCTGGG + Intergenic
1107609603 13:42099864-42099886 GGGGCTGCAGAGGTGCTTCTGGG + Intronic
1113372104 13:109733637-109733659 GAGCCTGGACAGGTGGATCCGGG - Intergenic
1113738392 13:112694052-112694074 GAGGCTGCCCTGGTTCCTCTCGG - Intronic
1113922025 13:113918639-113918661 GAGCCTGGCCAGGTGGCTCTGGG - Intergenic
1115052421 14:29079415-29079437 GAGGAAGTTCAGGTGGCTCTGGG - Intergenic
1116786799 14:49296932-49296954 GAGCCTACACAGGTAGCACTTGG + Intergenic
1117674054 14:58138256-58138278 GAGGCTGCACAGGTGGCTCTGGG - Exonic
1118473322 14:66094538-66094560 GAGGCTGCAGCGGAGGCTCTGGG + Intergenic
1119208548 14:72812553-72812575 GGTGCAGCTCAGGTGGCTCTCGG - Intronic
1119261670 14:73241386-73241408 GCAGCTGTCCAGGTGGCTCTGGG - Intronic
1120831532 14:89001571-89001593 GAGGCTGCAGAGCTGGGACTGGG - Intergenic
1121104079 14:91269560-91269582 GAGGCTGCAGAGATGGTCCTGGG + Intergenic
1121320166 14:92987482-92987504 ATGGCTGCACAGGTGGCCCCTGG + Intronic
1122290502 14:100678210-100678232 GATGCTGCAGATGTGGCTCTGGG - Intergenic
1123162196 14:106289248-106289270 GAGGCTGCACAGGAGAGTCTCGG + Intergenic
1126054558 15:44717792-44717814 GTTGCTCCACAGGTAGCTCTAGG + Exonic
1126918275 15:53490267-53490289 GAGGCTGCACATGGTGCTTTGGG + Intergenic
1129175915 15:73839614-73839636 AAGGCTGCACAGGTGGAGGTGGG + Intergenic
1129302902 15:74636546-74636568 TAGGCAGCACAGTTGGCTCACGG + Intronic
1129608428 15:77035951-77035973 GAGGTGGCACAGGTGGGTTTGGG - Intronic
1129992393 15:79976407-79976429 GAGGCTGCAAACCTGGCTCCAGG - Intergenic
1130112780 15:80979765-80979787 GACACTGCAGAGGTGGCTCAGGG + Intronic
1130955459 15:88624165-88624187 GCGGCTGCACAGGTGGATCCTGG - Intronic
1132247909 15:100311419-100311441 GGGGCTGTCCAGGTGGCTCAGGG - Intronic
1132247968 15:100311962-100311984 GGGGCTGTCCAGGTGGCTCAGGG + Intronic
1132481227 16:167121-167143 TAGGTTGCACATTTGGCTCTGGG - Intergenic
1132603262 16:783230-783252 GCGTGTGCACAGGTGCCTCTCGG + Intronic
1132609871 16:810309-810331 GAGGCTGCAGAGGTTGCTGTGGG + Intronic
1132662135 16:1066252-1066274 GGGGCTGCACGGGTGGGTCGGGG + Intergenic
1132678485 16:1130370-1130392 GAGGCTGCCCAGGAGGCTGGGGG + Intergenic
1132709254 16:1259163-1259185 GTGGGGGCACAGGTGGCTCCCGG + Intergenic
1132884241 16:2175582-2175604 GCCGCTGTACAGGTAGCTCTGGG - Exonic
1133023299 16:2976375-2976397 GACGCTGCACAGCTGGCGCCAGG + Intronic
1133146299 16:3789209-3789231 GAGCGAGCACAGGTGGGTCTCGG + Intronic
1133331928 16:4980236-4980258 GATGCTGGACAACTGGCTCTGGG + Intronic
1134619332 16:15675708-15675730 GAGGCACCACACCTGGCTCTGGG + Intronic
1134850399 16:17474144-17474166 GAGGCTGCTCTGGAGCCTCTTGG + Intergenic
1135054347 16:19218639-19218661 AAGGCTGCAGAGGTGGCTTGAGG + Intronic
1135636250 16:24078208-24078230 GCGGCTGCAGACATGGCTCTGGG - Intronic
1135872141 16:26161003-26161025 GAGGCTGATGAGGTGGCCCTGGG + Intergenic
1136006623 16:27334813-27334835 GAGGCTGCAAAGCTCTCTCTAGG - Intronic
1136611833 16:31371234-31371256 GAGGCTCCCCAGGTGGTCCTAGG + Intronic
1137257669 16:46790211-46790233 GAGGATGCAGACGTGGCTCACGG + Intronic
1138095787 16:54210381-54210403 GAGACTGACCAGGAGGCTCTCGG + Intergenic
1139589141 16:67923653-67923675 GAGACTGCCCAGGTGGGTCTTGG + Intronic
1140132975 16:72180326-72180348 GAGGCAGAACAAGTGGCTCTGGG - Intergenic
1142631320 17:1228618-1228640 TAAGCTCCACAGGTGGCTTTGGG + Intronic
1143137172 17:4718385-4718407 GTTACTGCACAGGTGGCTCCTGG + Intronic
1143623738 17:8096196-8096218 GAAGCTGGGCTGGTGGCTCTAGG + Intronic
1143723156 17:8827931-8827953 GAGGCTGCAGACGGTGCTCTGGG - Intronic
1143762638 17:9116207-9116229 GTGGCAGAACAGGTGCCTCTTGG + Intronic
1144582143 17:16465053-16465075 GAGGCTGCACTGGTGGCCACGGG + Intronic
1144661942 17:17076581-17076603 GAGGCTGCACATAAGGCCCTTGG + Intronic
1144701472 17:17343659-17343681 CAGGCTGCACAGGGAGCTCAGGG - Intronic
1144765534 17:17730586-17730608 GAGGCTGCACTAGTGGCCCCAGG - Intronic
1144783952 17:17821684-17821706 CAGGCTGCACAGTTGGTCCTTGG - Intronic
1145057712 17:19714310-19714332 GGGGCTGCCCAGGTGGCCATGGG - Intronic
1145275103 17:21424438-21424460 GAGGCTGCAATGGTGGGTCGTGG + Intergenic
1145849252 17:28075673-28075695 GAGGGTGCACATTTGACTCTGGG - Intronic
1146593898 17:34153412-34153434 GAGCCTGGACAGGTGGTTGTTGG - Intronic
1146793327 17:35765087-35765109 GAGGTGGCGCAGGTGGCTCCGGG + Intronic
1148077779 17:44949014-44949036 GAGGCTCCCCTGATGGCTCTTGG - Intergenic
1148139732 17:45319561-45319583 GAGGCTGCACAAGTGACTCAAGG - Intergenic
1148534718 17:48429913-48429935 GAGGATGGAAAGCTGGCTCTAGG + Intronic
1148772775 17:50076670-50076692 GAAGCTGAGCAGGTGGCTGTGGG + Exonic
1149507242 17:57204453-57204475 TAGGCTGCCCAGGAGGCTTTGGG - Intergenic
1149587632 17:57803331-57803353 GATGCAGCACAGGTGACTCTGGG + Intergenic
1152013891 17:77736904-77736926 AGGTCTGCACAGGTGGCTCCGGG + Intergenic
1152467026 17:80472274-80472296 GAGGCTGCACAGATGTCGCACGG - Intronic
1152530151 17:80913987-80914009 GAGGCTGCAGCGGTGCTTCTAGG - Intronic
1152645267 17:81465742-81465764 GAGGCTCCCCAGGAGGCTCAAGG + Exonic
1152888583 17:82867011-82867033 GTGTCTGCACAGCTGTCTCTGGG + Intronic
1158397791 18:57093225-57093247 GGGGCTGGACTGGTGGCTCTAGG + Intergenic
1159860714 18:73646028-73646050 GGGGCTCCACAGCTGCCTCTTGG - Intergenic
1160089977 18:75817890-75817912 GAGGGTGCACAGCGGGCACTGGG + Intergenic
1160143759 18:76347997-76348019 GAGGCTGCCCACGTGGCTGAGGG - Intergenic
1160907129 19:1456691-1456713 GAGGCTGCACACGTGCTTCGGGG - Intronic
1161009464 19:1953313-1953335 GAGGCTGCTGAGGTGGCGCAGGG + Intronic
1161321461 19:3643590-3643612 CAGGCTGCACAGGGCCCTCTGGG - Intronic
1161595793 19:5150461-5150483 GAGGCTGGCCTGGTGGCTCCGGG + Intronic
1162916638 19:13877766-13877788 GTGCCTGCACAGGTGGCTGGGGG + Intronic
1163040289 19:14597052-14597074 GAGGGTGCACAGGAGGACCTGGG + Intronic
1163093033 19:15034562-15034584 GAGGCTGGAGAGGTGGCTAGGGG + Intergenic
1163502462 19:17684813-17684835 GAGTCTGCACATGTGTGTCTAGG + Intronic
1164780739 19:30889741-30889763 AAGGATGCACAGGTTTCTCTAGG + Intergenic
1164931830 19:32181843-32181865 GAGGCTGCCCACCTGGCTTTGGG - Intergenic
1165050619 19:33139247-33139269 GAGGTTGCAGAGGTGGCTCCTGG + Intronic
1168339290 19:55614397-55614419 GAGGCTGGACACGTGGTTGTAGG - Exonic
925032755 2:663614-663636 TAGGCCGCACACGGGGCTCTTGG - Intergenic
925361104 2:3280905-3280927 GCAGCTGCACAGGCGGCTCCTGG - Intronic
925422779 2:3725721-3725743 GAGGCTGGCCAGGTGGATCCCGG + Intronic
926106942 2:10158509-10158531 CAGGCAGCAGAGGTGGCTCAGGG - Intronic
927148312 2:20181014-20181036 GAGGCTGGGCAGGTGAATCTAGG - Intergenic
927519363 2:23689762-23689784 GAGGTTGACCAGATGGCTCTGGG + Intronic
927843352 2:26458720-26458742 GAGGCTGGCCAGGTGCTTCTCGG - Intronic
929083948 2:38149118-38149140 GAGGCTGCACGGGCTGCTGTTGG - Intergenic
932460584 2:71879528-71879550 GCAGCTGCAGAGATGGCTCTGGG + Intergenic
933777107 2:85777779-85777801 CAGGCTCCACTGGAGGCTCTGGG - Intronic
935816449 2:106850503-106850525 GAGGCTGCAGTGGAGGCTTTTGG - Intronic
936236743 2:110748652-110748674 CAGGCTGTGCAGGTGGCTCCTGG + Intronic
936463464 2:112727618-112727640 CAGGCTGCACACTTGGCTTTTGG - Intronic
937071098 2:119063897-119063919 CAGGCTCCACAGGTGATTCTAGG - Intergenic
937816090 2:126252092-126252114 GAGGCTTCACAGCTGGCTCTTGG + Intergenic
938197776 2:129345449-129345471 CTGCCTGCACTGGTGGCTCTGGG - Intergenic
940346611 2:152635687-152635709 GAAGCTGCTCAGGAGGCTGTGGG + Intronic
941520165 2:166532242-166532264 GAGGCAGCACAGCTTGTTCTAGG - Intergenic
942328019 2:174791911-174791933 CAGGCTGCTCAAGTGGCTTTGGG + Intergenic
945850117 2:214995636-214995658 GAGGCTGAGCAGGAGGCACTAGG + Intronic
947573536 2:231254048-231254070 GACGCAGCACAGCTGGCTCTCGG + Intronic
947711973 2:232321586-232321608 GAGGCTGCACAGGGCGCCTTCGG + Intronic
948972327 2:241438864-241438886 GAGGCTGAGCAGGTGGATCATGG - Intronic
1169236783 20:3936090-3936112 CAGGCAGGACATGTGGCTCTTGG + Intronic
1172547435 20:35772442-35772464 GAGGCTGCTGATGAGGCTCTAGG - Intronic
1172998458 20:39088572-39088594 GAGGTTGCACAGCTAGCTGTAGG - Intergenic
1173413729 20:42837882-42837904 GAGGGGTCAAAGGTGGCTCTTGG + Intronic
1173561040 20:44005970-44005992 GAAGGTGCACAGGTGACTCCTGG + Intronic
1174066161 20:47867503-47867525 GAGACTGCAGAGGTGGATTTTGG + Intergenic
1175303185 20:57957382-57957404 GTGGCTGCAAAGTTGGCGCTTGG + Intergenic
1175739738 20:61412289-61412311 GGGACTGCACAGACGGCTCTGGG - Intronic
1175772397 20:61632005-61632027 AAGGCTGCGCAAGTGGCTGTCGG + Intronic
1175889642 20:62310515-62310537 GAGGCTGCACGGGAGGCCCCTGG - Exonic
1175922769 20:62457888-62457910 GGGGCTGCCCAGGTGGCTCGAGG - Intergenic
1176084771 20:63290914-63290936 GAGGCTGCACAGGAGGCCACTGG + Intergenic
1176128613 20:63486988-63487010 GAGGATGCAGAGGAGGGTCTGGG - Intergenic
1178244204 21:30935963-30935985 GAGCCTGCAGAGGAGGCTCTGGG - Intergenic
1178914406 21:36698784-36698806 GAGGCCGCCCCTGTGGCTCTCGG - Intergenic
1179554474 21:42163489-42163511 GAGGCTGCTGAGGAGGCTCCTGG + Intergenic
1179717792 21:43298718-43298740 GAGGGTGCACATGTGGGTGTAGG - Intergenic
1180137624 21:45871486-45871508 GATACTGCAGAGGTGGCTCTGGG + Intronic
1180168038 21:46040190-46040212 GGGGCTGCACAGCTGTCCCTGGG + Intergenic
1180939088 22:19645132-19645154 CAGGCTGCCCATGTGGCCCTTGG - Intergenic
1181082244 22:20423422-20423444 GAGGGTGCCCAGCTGGCTCCAGG + Intergenic
1181330340 22:22086164-22086186 GGGAATGCACAGCTGGCTCTGGG + Intergenic
1181924405 22:26346849-26346871 GAGGTTGCAAAAGTGGCCCTGGG - Intronic
1182096990 22:27632835-27632857 GGGGCTGCTCAGGAGGCTTTGGG - Intergenic
1182159170 22:28104627-28104649 AAGGCTGCACAGTTGGACCTTGG - Intronic
1182462139 22:30490627-30490649 GCGGTTGCACAGGTAGCTCTTGG + Intronic
1182566944 22:31207085-31207107 GAGGATGCACAGGAGCCTCCAGG - Intergenic
1182694496 22:32187524-32187546 GAGGCTGCTTGGGTGGCTCCAGG - Intergenic
1182696935 22:32204303-32204325 GTGGCTGCACTGGTCGCGCTGGG - Intergenic
1182716803 22:32363583-32363605 GAGGCTGCTTGGGTGGCTCCAGG + Intronic
1183362162 22:37388317-37388339 GAGGAAGCACAGGGGGCTGTGGG - Intronic
1183386140 22:37515874-37515896 GAGCCAGCAATGGTGGCTCTGGG + Intronic
1183734984 22:39639960-39639982 GAGCCTGCCCAGATGGTTCTAGG - Intronic
1184196483 22:42932829-42932851 GGGGCTGCCCAGGAGGCTCCAGG - Intronic
1184909096 22:47514094-47514116 GAGGCTGCCCAGGGGGCTCTGGG - Intergenic
950190902 3:10975412-10975434 GAGACTGCACAAAGGGCTCTAGG + Intergenic
950364181 3:12471531-12471553 GAGGCTGTGCAGGTGGCTGGAGG - Intergenic
953405957 3:42659858-42659880 GAGGCTGTCCAGGTGGGGCTAGG + Intronic
954291921 3:49654374-49654396 CAGGTGGCCCAGGTGGCTCTGGG - Exonic
954626443 3:52024444-52024466 GAAGGTGCACAGGTGGCTGTGGG + Intergenic
955370169 3:58344488-58344510 CAGGCTGCAGAGCTGGCTATTGG + Intronic
958176924 3:90007800-90007822 AAGGCTGCACAGGAGGCTCTGGG + Intergenic
958180421 3:90052716-90052738 GATGCTGCACAGCTGACTCCTGG - Intergenic
963162138 3:142161730-142161752 AAGGCTGCAGAGGTGGGGCTGGG + Intergenic
966805883 3:183807168-183807190 GAGGCTGAACACCTGGGTCTGGG - Intronic
966820538 3:183920724-183920746 GAGGCGGCAGAGGGGGCTGTCGG + Exonic
967309972 3:188096487-188096509 GAGGCTGAACAACTGGCTCGAGG - Intergenic
967989142 3:195118477-195118499 AAGGCTGCACAGGTGACGCCAGG + Intronic
967994847 3:195158717-195158739 CAGGCTGCACAGGGGCCTGTTGG - Intronic
968548387 4:1210175-1210197 GGGGCTGCAGAGGTGGCAGTGGG - Intergenic
968652015 4:1763886-1763908 GAGGCTGCCCAGAGGGCTCTGGG - Intergenic
968907597 4:3461888-3461910 GTGGCTGCACAGGTGACTGCGGG + Intergenic
969635634 4:8368120-8368142 CAGGCCGCACAGGTGGCACGTGG + Intronic
971073888 4:23126076-23126098 GAGTCTGGAGAGGTAGCTCTAGG + Intergenic
972642076 4:40934067-40934089 GAGGCTGCTCTGGTGGCGGTAGG + Intronic
972698283 4:41469079-41469101 GTGGATGCACAGATGACTCTTGG - Intronic
974683660 4:65195825-65195847 GAGGCCGCAGAGGAGGCTGTGGG + Intergenic
982378718 4:154724640-154724662 GTTGCTGCACAGGTGGCTGGAGG + Intronic
984851200 4:184154088-184154110 GAGGGTGCAGAGAGGGCTCTGGG - Intronic
985640135 5:1059738-1059760 GAGGCTGCACAGGTCTGTGTCGG + Intronic
985763060 5:1761518-1761540 CAGGGTGCACAGGAGGCTTTGGG - Intergenic
985890297 5:2710162-2710184 GAGGCTGCGCAGGTGGCGGGTGG + Intergenic
986438635 5:7759342-7759364 GAGGCTGAGCAGGTGGCTGGAGG - Intronic
986495633 5:8339097-8339119 GGGGCATCACAGGTGGGTCTGGG - Intergenic
986677486 5:10199423-10199445 GAGGCTGCACAGGTGAGTTTGGG - Intergenic
987111624 5:14693083-14693105 GAAGATGCACAGGTGGCTCCTGG + Exonic
987297568 5:16567576-16567598 GATGCTCCACAGGTGGCTGGGGG + Intronic
988785527 5:34563070-34563092 GAGCCTGGACAGCTGCCTCTTGG + Intergenic
992555537 5:77899278-77899300 GAGGCTGGACAGCTGGCTCGGGG - Intergenic
994321423 5:98399257-98399279 GTCTCTACACAGGTGGCTCTTGG - Intergenic
995984730 5:118156104-118156126 GAGGCTGCAGTGGTGGCATTAGG + Intergenic
996711018 5:126543773-126543795 GAAGCTGCACAGGAGCCTTTGGG - Exonic
997469753 5:134110626-134110648 GAGGCTGGGCTGCTGGCTCTCGG - Intergenic
997680352 5:135745983-135746005 GATGCTGCACAGGTTAGTCTTGG + Intergenic
997815953 5:137017181-137017203 GAGGCAGCACATGTGGCTTCTGG + Intronic
999149333 5:149416424-149416446 GAGGGTCCACAGATGGCTCAAGG + Intergenic
999394131 5:151215797-151215819 GAGGATGCACAGGATGCTCAGGG + Intronic
999701175 5:154229926-154229948 GGGGCTCCACAGATGGCTGTTGG - Intronic
1001709423 5:173766265-173766287 GAGTCTGCACGTGTGTCTCTGGG + Intergenic
1001913047 5:175536902-175536924 GAGCCTGCCCATCTGGCTCTAGG + Intergenic
1002027413 5:176404849-176404871 GAGGCTGCCCAGGGGGATGTGGG - Intronic
1002306758 5:178288034-178288056 GGGGCTGGACTGTTGGCTCTTGG + Intronic
1002649946 5:180684105-180684127 GAAGCTGCTCGGGGGGCTCTGGG + Intergenic
1003050624 6:2777863-2777885 CAGGCTGCACCACTGGCTCTGGG + Intronic
1006030281 6:31172592-31172614 GGGGCTCCAGAGGGGGCTCTGGG + Intronic
1007473604 6:42105578-42105600 GAGGCTGCTCTGGTGGCAGTGGG + Exonic
1007488256 6:42197510-42197532 GATGCTGCACTTGTGGCTCAGGG - Intergenic
1007727346 6:43924423-43924445 GCGGCTGCACTGCGGGCTCTGGG - Intergenic
1008092834 6:47309668-47309690 GAGGCGGCAAGGGAGGCTCTAGG + Exonic
1010316277 6:74454251-74454273 GAAGCTGGACATGTGGCTCCAGG - Intergenic
1010790738 6:80062267-80062289 GAAGCTGGACAGGTGGGTCGAGG - Intergenic
1011215954 6:85005746-85005768 GAGGGTGCTGAGGTGGCACTTGG - Intergenic
1014782926 6:125585655-125585677 GAGGCTGCACATGTTGCTCATGG + Intergenic
1016688253 6:146905756-146905778 GAGGCTGCAGCAGTGGCCCTGGG + Intergenic
1018853300 6:167657135-167657157 GAGGCTCCACAGGTGGCCCCTGG - Intergenic
1019359850 7:599092-599114 GAGGCTGCGGAGGGAGCTCTCGG - Intronic
1019496903 7:1345036-1345058 GAGGGGGCTCAGATGGCTCTGGG + Intergenic
1019564349 7:1672030-1672052 GGGGCTGCACAGCTGGCTGTAGG - Intergenic
1019626961 7:2020634-2020656 GAGGCTGACCCGGTGGCTGTGGG + Intronic
1019924250 7:4181856-4181878 GGGGCTGCACAGGGCACTCTGGG - Intronic
1019999928 7:4749812-4749834 GCGGCTCCAGAGGTGGCTTTAGG + Intronic
1022609051 7:31850078-31850100 AAGGATGCACAGGTTGCTCACGG + Intronic
1023843212 7:44108002-44108024 GAGGCTTCACAGGAGGCTCTGGG - Exonic
1026797568 7:73376255-73376277 TAGGTTGCCCAGGTTGCTCTGGG + Intergenic
1027745042 7:82062308-82062330 GAAGCTGCACAGGTAAGTCTGGG - Intronic
1028724229 7:94069437-94069459 CAGGAGGCACAGGTGGCTTTTGG + Intergenic
1032240341 7:130154588-130154610 CAGGCTGCGCAGCTGGCACTTGG - Intergenic
1034210622 7:149359089-149359111 GAGGCTACAGTGGAGGCTCTGGG + Intergenic
1034458782 7:151186751-151186773 GAGGCTGCAGATGGAGCTCTGGG - Intronic
1034936246 7:155202749-155202771 GATTCTGCACAGGCGGCTCAGGG + Intergenic
1035234407 7:157487254-157487276 GAGGCTGCACTGGTGGGGCTGGG + Intergenic
1035428139 7:158795911-158795933 AAGGCTGCACAGGAGGCACGGGG + Intronic
1036645372 8:10608966-10608988 GAGGCAGCAGAGGTGGCCCCTGG - Exonic
1037341281 8:17848251-17848273 GAGGCTTCATAGGTGGGCCTGGG - Intergenic
1038646517 8:29366357-29366379 GAGGAATCACAGATGGCTCTGGG - Intergenic
1039194647 8:35017507-35017529 GTGGCTGCACAAATGGCTGTGGG - Intergenic
1039822743 8:41148028-41148050 GAGGCTGCCTTGTTGGCTCTGGG - Intergenic
1039863073 8:41476350-41476372 GAGACAAGACAGGTGGCTCTAGG - Intergenic
1040462448 8:47661969-47661991 GAGGCTGCTCAAGTGACTCGAGG - Intronic
1040579371 8:48683835-48683857 GAGACTGTACAGCTGTCTCTTGG + Intergenic
1040602189 8:48896368-48896390 GAGGCAGCACAGGGGCCTGTGGG + Intergenic
1045379391 8:101608227-101608249 GAGGTTGCACAGCTGGCGCCTGG + Intronic
1045933590 8:107654470-107654492 GAGGCTGCAGGGGTGCCTCATGG + Intergenic
1047257693 8:123228076-123228098 GAGGATGCACAGGTGGATGGTGG - Intronic
1048252462 8:132878072-132878094 GGGGCTGCATATTTGGCTCTGGG + Intronic
1048865007 8:138753970-138753992 GAGGCTGCACAGTCAGATCTAGG + Intronic
1049425913 8:142537796-142537818 GAGGCTCCACAGGGGGCTGTTGG - Intronic
1049444868 8:142625243-142625265 GAGGCTGAACTGGGGGCCCTGGG - Intergenic
1049613919 8:143568145-143568167 GCGGCAGCAGAGGTGGCTCAGGG + Exonic
1053294455 9:36902916-36902938 GAGGCTGCACTTAGGGCTCTGGG - Intronic
1055810154 9:80140254-80140276 GAGGATGCAAAGGAGGCTTTGGG - Intergenic
1057185188 9:93053457-93053479 GGGGGTGCACAGGTGGGTCAAGG - Intergenic
1058737554 9:107907745-107907767 GAGGATGATCAGGTTGCTCTTGG - Intergenic
1060932068 9:127495468-127495490 GAGGCACCACAGGCGCCTCTGGG - Intronic
1061230016 9:129310197-129310219 GAGGTTGGCCAGGTGGCGCTGGG - Intergenic
1061416501 9:130450125-130450147 GAGGCAGGACAGGTGGCTCTGGG + Intronic
1061578649 9:131523404-131523426 GAGGCTCCACTGCTGGCCCTGGG - Exonic
1061623745 9:131828169-131828191 GTGGCTGCCCAGGCGCCTCTGGG + Intergenic
1062373868 9:136253404-136253426 GGGGCTGCACTGATGGCCCTGGG + Intergenic
1062384925 9:136305432-136305454 GAGGCTGCAGAGGGGTCCCTGGG - Intronic
1062423885 9:136497292-136497314 GAGGCTGCCCAGGTAGCCGTTGG + Exonic
1185888340 X:3802375-3802397 GAGGCTGTACAGGAGTCTCTGGG - Intergenic
1187697822 X:21939229-21939251 CTGGCAGCACAGGTGGCCCTCGG - Intergenic
1188290149 X:28377601-28377623 GAGGCTGCACATCTCACTCTGGG + Intergenic
1195196232 X:102500112-102500134 GAGGCTTCACAGGAGCCTCCTGG - Intergenic
1195235925 X:102898229-102898251 GAGGCTGCTCAGGGTACTCTAGG - Intergenic
1195301939 X:103538560-103538582 GAGGCTGCTCAGGGTCCTCTAGG + Intergenic
1199746179 X:150773123-150773145 GAGGCTGCTCAGGTGTCAGTAGG - Intronic
1200089069 X:153625947-153625969 GTGGCTCCACAGTTGGCCCTGGG - Intergenic
1200231568 X:154446324-154446346 TAGGGCACACAGGTGGCTCTGGG + Intronic