ID: 1117677169

View in Genome Browser
Species Human (GRCh38)
Location 14:58166725-58166747
Sequence TCTCCACTCAGTGTATCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117677169_1117677170 -3 Left 1117677169 14:58166725-58166747 CCTTGGGATACACTGAGTGGAGA 0: 1
1: 0
2: 2
3: 16
4: 158
Right 1117677170 14:58166745-58166767 AGAACTCAGCCACACCGTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117677169 Original CRISPR TCTCCACTCAGTGTATCCCA AGG (reversed) Intronic
900474609 1:2870264-2870286 TCTCCACCCAGTGCAGCCCCCGG + Intergenic
900647592 1:3715948-3715970 GGTGCACTCAGTGTCTCCCAGGG + Intronic
900939844 1:5791647-5791669 CCTAGACTCAGTGCATCCCAAGG - Intergenic
901524118 1:9808661-9808683 TCTCCACTCAGTCTGTCCCCAGG - Intronic
901767940 1:11515668-11515690 TCTCCACTCACCCTATGCCAAGG - Intronic
903706915 1:25292683-25292705 TCTCCATTCAGTGTCTCCACTGG - Intronic
903720323 1:25400664-25400686 TCTCCATTCAGTGTCTCCACTGG + Intronic
908930697 1:69313269-69313291 TCACCACTCAGCGTCTCCCTTGG + Intergenic
910069983 1:83201258-83201280 TCTCCTCTCAGTGTATCATAGGG + Intergenic
911744938 1:101430957-101430979 TCTCCAGTCAGTTTATTCCTTGG - Intergenic
913487731 1:119348883-119348905 TCTCCACTCAGAATCCCCCATGG + Intergenic
915743406 1:158137583-158137605 TCACCACTCAATTTTTCCCAGGG + Intergenic
915913304 1:159927559-159927581 TCTTCACTCAGTGAACCTCAGGG - Intronic
920365903 1:205448307-205448329 TCGCCCCTCACTGTAGCCCATGG + Intronic
922600488 1:226847835-226847857 TCTCCACTCAGAATCCCCCATGG - Intergenic
923398427 1:233590556-233590578 TGTTCACTCAGTTAATCCCAAGG - Intergenic
1062964633 10:1598074-1598096 TTTCCACTCAGTGTATCCATGGG - Intronic
1069178966 10:65332361-65332383 TCTGGCTTCAGTGTATCCCATGG - Intergenic
1074929538 10:118109997-118110019 TTTCCTATCAGTGTATCTCAGGG + Intergenic
1077216826 11:1398478-1398500 TCTCCACCCCCTGTATCCCCAGG - Intronic
1078026349 11:7699295-7699317 TCTCTAGTCAGTTTATCACAAGG + Intronic
1080216287 11:29845027-29845049 TCACCACATAGTGGATCCCAGGG - Intergenic
1080472434 11:32559261-32559283 ACTCCACACAGTGCATCTCATGG - Intergenic
1080702873 11:34659453-34659475 TCTCCACTCATTGGATCCTAAGG - Intronic
1083268593 11:61559088-61559110 TAACCACTCAGTGTCTCCCACGG + Intronic
1087970868 11:104481466-104481488 ACTCCTTTCATTGTATCCCATGG - Intergenic
1089806365 11:121094279-121094301 ACTCCAACCAGTGAATCCCATGG + Intergenic
1090177508 11:124664149-124664171 TCTCTTGTCAGTGTAACCCAGGG - Intronic
1091697232 12:2636089-2636111 TCTCCCTGCAGTGTCTCCCACGG - Intronic
1091901095 12:4144686-4144708 TCTGAATTCAGTGTATCCCATGG - Intergenic
1094230541 12:28097580-28097602 AGTCCACTCAGCCTATCCCAGGG + Intergenic
1095236546 12:39803010-39803032 TCTGCCTTCATTGTATCCCAAGG - Intronic
1095526209 12:43128986-43129008 TCTCCACTCACCAGATCCCACGG - Intergenic
1095596630 12:43966548-43966570 TTTCCCCTTAGAGTATCCCAAGG - Intronic
1097166838 12:57090516-57090538 TCTCCGCTCAGCTTTTCCCAGGG - Intronic
1097355752 12:58599586-58599608 TATCCACTGAGTGTCTACCATGG + Intronic
1098166376 12:67702619-67702641 TCTCCTCTCAGGGAATCACAAGG - Intergenic
1100376502 12:94020964-94020986 TGTACACTCAGTGTATGACAAGG - Intergenic
1105337189 13:19484211-19484233 TCTTCACTCATTGTAACTCAAGG + Intronic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1107741619 13:43456411-43456433 TCTACACTCAGGGTTTCCCTTGG - Intronic
1112839581 13:103559736-103559758 TCTCCTCTCAGGGTATGTCAAGG - Intergenic
1113342276 13:109438266-109438288 CTTCCACTCAGTTTATCCAAGGG + Intergenic
1113361468 13:109635198-109635220 TATCCACTCATTCCATCCCAAGG + Intergenic
1113395432 13:109943036-109943058 TCTCTACTCAGAGTCTCACAAGG - Intergenic
1114541001 14:23458311-23458333 TCTCCACTCAGCATATCTAAAGG - Intergenic
1115900467 14:38141328-38141350 TCTCAAGTAAGTGTATCCAAAGG - Intergenic
1117110623 14:52449920-52449942 ACTGCTTTCAGTGTATCCCAAGG - Intronic
1117677169 14:58166725-58166747 TCTCCACTCAGTGTATCCCAAGG - Intronic
1118777920 14:68985334-68985356 CCCCCACTCAGTGTAACACAGGG + Intergenic
1123179962 14:106460397-106460419 TCTCCTCTCTGTGGATCTCACGG + Intergenic
1123772106 15:23539102-23539124 TATTCACTCAGTGAATCCCAAGG - Intergenic
1126207339 15:46060252-46060274 TGTTCACTCAGTTGATCCCAAGG - Intergenic
1126492459 15:49253304-49253326 TCTCCACTAAATGGATCCCAGGG + Intronic
1128713924 15:69893207-69893229 TCTTAACTCAGTGGCTCCCAGGG - Intergenic
1130031085 15:80314930-80314952 TCTCCAGTTAGTGAATACCAAGG - Intergenic
1131181660 15:90244196-90244218 TCTCCAGTCAGTGGTTCCCATGG + Exonic
1131570991 15:93535826-93535848 TCTCCACCCACTTTTTCCCAAGG + Intergenic
1134292500 16:12913668-12913690 TCTCCCCTCACTGTGTCCCCTGG + Intronic
1134835216 16:17355482-17355504 TCTCTACCCAGTCTACCCCAGGG - Intronic
1135476043 16:22776082-22776104 TCTCCACTCACCATAACCCAGGG - Intergenic
1138527120 16:57615290-57615312 TCTCCACTCTCTGTATCCTGTGG - Intronic
1139782236 16:69361478-69361500 TCTCCCCTCAGAGTACCCAAAGG - Exonic
1141700029 16:85638171-85638193 TCTCCTCTCATTGTGTCTCAAGG + Intronic
1144322698 17:14145465-14145487 TCTTCACTCACTCTACCCCATGG - Intronic
1146593193 17:34146535-34146557 TTTACACTCAGTGTTTCCCGTGG - Intronic
1146597212 17:34179855-34179877 ACTCCACTCAGAGAATCCCTGGG - Intergenic
1152001224 17:77646317-77646339 TGTCCACCCAGAGTTTCCCACGG - Intergenic
1153549167 18:6242582-6242604 TATCCACTCAGGGTGTCCCTTGG - Intronic
1155380795 18:25219990-25220012 TCTCCAAATAGTGTATCCAAGGG - Intronic
1157784199 18:50467466-50467488 TCTCCACTCAGGGTCTCACAAGG + Intergenic
1160588343 18:79925513-79925535 TCTCTGCTCAGTGCATGCCAGGG - Intronic
1166552624 19:43676509-43676531 TCTCCACTCAGGGCCTCCCTGGG + Intergenic
1166716615 19:44972716-44972738 TCTCCTCTCGGGGGATCCCAGGG + Intronic
1167985470 19:53311066-53311088 CCTCCACTCAGGGTCTCACAAGG + Intergenic
925188849 2:1867173-1867195 TCTCCACTCAGTGACTTCCTGGG - Intronic
925747182 2:7053398-7053420 TCTCTACTCAGGGTCTCACAAGG + Intronic
928333377 2:30374861-30374883 TTTCTACTAGGTGTATCCCAGGG + Intergenic
929808330 2:45168503-45168525 TCTCCCCTCAATGTATAGCATGG + Intergenic
933657798 2:84904081-84904103 TCTCACCTCAGTTTATGCCAAGG + Intronic
937351921 2:121171217-121171239 TCTCAACTCAGGGAGTCCCAGGG + Intergenic
937896856 2:126983185-126983207 TCTCTGCTCAGGGTATCACAAGG + Intergenic
938836903 2:135113252-135113274 TCACCAGCCAGTGTTTCCCAAGG - Exonic
939697419 2:145343825-145343847 TCTCCATTCAGTGCCTCACAGGG + Intergenic
942009555 2:171746543-171746565 TCTCCTCTCTGGATATCCCATGG + Intronic
942674949 2:178416786-178416808 TCTCAACTCAATTTATCCCTTGG - Intergenic
1169039814 20:2483742-2483764 TCTCCCCTGAGTGTATCCTCTGG + Exonic
1169150919 20:3288683-3288705 TATCCAGTCAGTCTACCCCAAGG - Intronic
1170658694 20:18315547-18315569 TCTCCCCTGAGTGTATCCGCTGG - Exonic
1172882391 20:38210576-38210598 TCTCCCCTCACTGCATCCCCTGG - Exonic
1175591156 20:60193251-60193273 TCTCAACTCAGTGTATCTGGTGG + Intergenic
1176736375 21:10550992-10551014 TCTTCACTCACTGTAACTCAAGG - Intronic
1180994806 22:19960067-19960089 TCTGCAGGCAGTGTCTCCCAGGG - Intronic
1183532766 22:38371716-38371738 TCTTCACTCATTGTAACTCAAGG + Intronic
1184559897 22:45256287-45256309 TCTCTGCTCAGGGCATCCCAGGG + Intergenic
952682701 3:36113457-36113479 TCTCTGCTCAGTATATCACAAGG + Intergenic
954659281 3:52218311-52218333 TCTCCACCCAGTGCCTCCCAGGG - Intergenic
957827571 3:85468701-85468723 TCCCCACTTAATGTATCCCACGG - Intronic
958682418 3:97348736-97348758 TGTCTACTAAGTGTATCACAAGG + Intronic
960090521 3:113633859-113633881 TCTCAGCTCAGTGGACCCCAAGG - Intergenic
962177323 3:133167935-133167957 TCACCTCTCAGTTTATTCCAAGG + Intronic
966235201 3:177693448-177693470 ACTCCACGCCGTGTATCTCAGGG + Intergenic
968512409 4:1001407-1001429 TCTCGCCTCAGTGACTCCCACGG - Intronic
969519058 4:7665251-7665273 TCTACACTCAGTCTGTGCCAAGG + Intronic
970190043 4:13507275-13507297 TCTCTACTCAGGGTTTCACAAGG + Intergenic
971509258 4:27403836-27403858 TCTCTACTCAGGATATCACATGG + Intergenic
971640834 4:29130722-29130744 TCTCAACTCAGGGTCTCCTAAGG + Intergenic
971700675 4:29970634-29970656 TCTCTACTCAGGGTCTCACAAGG + Intergenic
976932432 4:90584507-90584529 TCTCTACTCAAAGTATCACAAGG - Intronic
983188970 4:164734417-164734439 TCTCTACTCAGGGTATCCCAAGG + Intergenic
985370391 4:189280340-189280362 TCGTCACTCAGTCGATCCCAAGG + Intergenic
985971395 5:3381230-3381252 TCTTCACCCAGTGGACCCCATGG - Intergenic
986291100 5:6399530-6399552 TCTCCAGGCTGTGGATCCCAGGG + Intergenic
986351922 5:6888426-6888448 TCTCTGCTCAGTGTCTCACAAGG + Intergenic
987385409 5:17324396-17324418 TTTCCTCTCACTATATCCCATGG - Intergenic
988991175 5:36672335-36672357 TCTCCACTCTGTCTATGCCCTGG - Intronic
990445629 5:55891451-55891473 TCTCCACTCAGAGTCTCAGAAGG - Intronic
996015215 5:118526042-118526064 TCTCTGCTCAGGGTCTCCCAAGG - Intergenic
997439230 5:133897538-133897560 TCTACACTGAGTGTTCCCCAAGG - Intergenic
998072988 5:139213297-139213319 TCAACACTCAGTGTATGCAAAGG - Intronic
998176816 5:139906338-139906360 ACTTCACTCATTGTAACCCATGG + Intronic
998196532 5:140077686-140077708 TATCACATCAGTGTATCCCATGG - Intergenic
999222692 5:149994318-149994340 TTTCCAGTAAGTGTATCTCAGGG - Exonic
999576311 5:152981919-152981941 TCTCCACTGAGTGTGTTCTATGG - Intergenic
1001447469 5:171796963-171796985 GCTCCACTCAATCTATTCCAAGG + Intergenic
1001962270 5:175886661-175886683 ACTCCACTCAGTGGATCGCAAGG + Intergenic
1003224098 6:4189280-4189302 TCTCTACTGAGTGTAGGCCAGGG + Intergenic
1004040084 6:11966797-11966819 TCTCTACTCAGGGCCTCCCAAGG - Intergenic
1005070397 6:21857009-21857031 TCTCTGCTCAGTGTGTCACAAGG - Intergenic
1005361891 6:25038712-25038734 TCTCTGCTCAGGGTCTCCCAAGG - Intronic
1006653165 6:35568036-35568058 TCTCCACTCTGTCTCTCGCAAGG - Intergenic
1007265271 6:40590989-40591011 CCTCCACTGAGTCTATTCCATGG + Intergenic
1008464698 6:51817462-51817484 TCTCCCCTCAGTATATCATAGGG - Intronic
1012264648 6:97127056-97127078 TCTCTACACAGTTTATGCCAGGG - Intronic
1013612742 6:111810327-111810349 CCTTCACTGAGAGTATCCCAGGG + Intronic
1016662470 6:146597722-146597744 TCTCCACTCAGCATAGCCTATGG - Intergenic
1017652194 6:156593910-156593932 TCTCCACTCAGGGTCTCACAAGG + Intergenic
1018284489 6:162222632-162222654 CCTCCACTCAGGGTCTCACAAGG - Intronic
1020718368 7:11708652-11708674 TCTCCACTCACTCTAGCTCAAGG + Intronic
1022336475 7:29426701-29426723 TCTCCACTCAGAGTATCACAAGG + Intronic
1022556030 7:31297254-31297276 TCTCCAATCAGCTTATCCCGTGG - Intergenic
1022609528 7:31855150-31855172 TCTCTGGTCAGGGTATCCCAAGG + Intronic
1022620213 7:31975944-31975966 TGTGCATTCAGTCTATCCCATGG + Intronic
1023354888 7:39356579-39356601 TCACACCTCTGTGTATCCCAGGG + Intronic
1024479373 7:49848279-49848301 CCTCCACTCAGAGCCTCCCACGG + Intronic
1026178410 7:68017850-68017872 TCTCCACTTGGTGTCCCCCAGGG + Intergenic
1026565711 7:71488248-71488270 TCTCCACCAAGTCTATCCCTGGG - Intronic
1027287755 7:76666417-76666439 TCTCCTCTCAGTGTATCATAGGG + Intergenic
1029012255 7:97274221-97274243 TGTTCACTCAGTTTATCCTAAGG + Intergenic
1029787644 7:102808647-102808669 TCTCCGCTCAGGGAATCACAAGG + Intronic
1030106536 7:105992157-105992179 TCTGCATTCTCTGTATCCCAAGG + Intronic
1034635516 7:152564319-152564341 ACTCCACTCATTATTTCCCAGGG + Intergenic
1034745193 7:153517929-153517951 TCTTCTTTCAGTGTGTCCCAGGG + Intergenic
1035643639 8:1201690-1201712 GCTCCATTCACTGGATCCCACGG - Intergenic
1041202773 8:55467025-55467047 TTTCCACTCTGTGTCTCACAAGG + Intronic
1042123588 8:65514184-65514206 CCTCCACTCTCTGTAGCCCAAGG - Intergenic
1043571674 8:81610835-81610857 CCTCCACTCCGTGTATCCACAGG - Intergenic
1046181762 8:110658378-110658400 TTTCCTCTTACTGTATCCCAGGG - Intergenic
1046756956 8:117982137-117982159 TCTCTGCTCAGTGTCTCACAAGG + Intronic
1047438052 8:124851636-124851658 TCTCCATTTAGTGTTGCCCAAGG + Intergenic
1050596973 9:7213753-7213775 TCTCCACTAAGTGCCTTCCAAGG + Intergenic
1057930165 9:99186026-99186048 TCTCCACACAGTGCATCTGAGGG + Intergenic
1058847229 9:108972979-108973001 CCTCCCCTCAGTGGAACCCATGG - Intronic
1185824439 X:3236384-3236406 TCTCTACTCAGGGTCTCCCCAGG + Intergenic
1186148853 X:6653211-6653233 TTTCCACTCAGTGTTTCCATGGG - Intergenic
1187244524 X:17542008-17542030 TCTCTTCTCATTGTTTCCCAAGG - Intronic
1189968953 X:46398747-46398769 TCTCGGCTCAGGGTATCACATGG + Intergenic
1193046623 X:77061091-77061113 TCACCACTTAGAGTAGCCCAGGG + Intergenic
1194618123 X:96132910-96132932 TCACAACTCACTGTCTCCCATGG + Intergenic
1195068404 X:101257717-101257739 TCTCAGCCCAGTGTTTCCCAGGG - Intronic
1197352966 X:125400368-125400390 TGTTCACTCAGTTGATCCCAAGG + Intergenic
1197485745 X:127049368-127049390 TCTCCACTCACTGCAACCCCTGG + Intergenic
1198330558 X:135618683-135618705 TCTCCGCTGACTGTCTCCCAAGG - Intergenic
1198336370 X:135670313-135670335 TCTCCGCTGACTGTCTCCCAAGG + Intergenic
1198444150 X:136694520-136694542 TCTCCACTCTTTGTTTACCATGG - Intronic
1199652787 X:149963464-149963486 TCTCCATTCACTGTATGCCAGGG - Intergenic
1202015870 Y:20406070-20406092 TGTCCACTGAATGTTTCCCATGG + Intergenic