ID: 1117679858

View in Genome Browser
Species Human (GRCh38)
Location 14:58192855-58192877
Sequence CAGTAGGAATGGAGTAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117679852_1117679858 16 Left 1117679852 14:58192816-58192838 CCCAGGACTCATTATTATCTTCA 0: 1
1: 0
2: 0
3: 19
4: 237
Right 1117679858 14:58192855-58192877 CAGTAGGAATGGAGTAAAATAGG 0: 1
1: 0
2: 0
3: 19
4: 258
1117679853_1117679858 15 Left 1117679853 14:58192817-58192839 CCAGGACTCATTATTATCTTCAT 0: 1
1: 0
2: 0
3: 23
4: 276
Right 1117679858 14:58192855-58192877 CAGTAGGAATGGAGTAAAATAGG 0: 1
1: 0
2: 0
3: 19
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117679858 Original CRISPR CAGTAGGAATGGAGTAAAAT AGG Intronic
901285155 1:8072436-8072458 CTGAATGAATGGAGTAATATTGG - Intergenic
902202330 1:14843179-14843201 CAGTAGGAATCGACTTGAATAGG - Intronic
904963858 1:34356402-34356424 CTTTAAGAATGGAGCAAAATGGG - Intergenic
906977351 1:50589629-50589651 CACTAGCAATGGAGTTAAAAAGG - Intronic
907612816 1:55889584-55889606 CAGTTGGGATGGAGTAATAGAGG - Intergenic
909802545 1:79829961-79829983 CAAAAGAAATGGAGTAAATTTGG + Intergenic
913658511 1:120984680-120984702 CAGTAAGAGTGGAGTCAAACAGG - Intergenic
914009878 1:143767789-143767811 CAGTAAGAGTGGAGTCAAACAGG - Intergenic
914254960 1:145954409-145954431 CTGTAAGACTGGAGTTAAATGGG - Intronic
914523122 1:148435919-148435941 CAGTAAGACTGGAGTCAAACAGG - Intergenic
914648498 1:149676450-149676472 CAGTAAGAGTGGAGTCAAACAGG - Intergenic
914894348 1:151655220-151655242 CTTTAGGAATGGAGCTAAATTGG - Intronic
915847921 1:159288063-159288085 AGGTAAGAATGGAGTAATATGGG + Intergenic
917663459 1:177200456-177200478 CAGGAGGAATGGGGTCAGATGGG - Intronic
922011201 1:221589876-221589898 CTGTAGGCATGGATTAGAATAGG + Intergenic
922224630 1:223634520-223634542 CAGCACGAATGGACTAAAACAGG - Intronic
923078536 1:230632081-230632103 CAATAGGAATGGAGCAAGAGGGG + Intergenic
923610302 1:235486173-235486195 CAGTAGATATTCAGTAAAATGGG + Intronic
923853052 1:237817953-237817975 GAGTAGAAATGGAGTAAGAATGG + Intronic
924258603 1:242207105-242207127 CAGTAGGTTTTGAGTAAAGTAGG - Intronic
1063536225 10:6886392-6886414 CAGAAGGAATGCTGTAAAACAGG + Intergenic
1064045916 10:12015364-12015386 GAGTAGAAATAGGGTAAAATGGG - Intronic
1064291956 10:14043430-14043452 CAGTGGGCAGGGAGTGAAATTGG - Intronic
1064778417 10:18806036-18806058 CAGTAGGCTTGGAATAAAATTGG + Intergenic
1064849834 10:19698308-19698330 CACAAGGAATTGAGTAAAAGTGG + Intronic
1066331188 10:34425114-34425136 CAGTAGAGATGGAAAAAAATTGG - Intronic
1067710705 10:48649178-48649200 CAGTTGGAATGGGGTAATAAGGG - Intronic
1068175887 10:53457785-53457807 CAGAAGGAATTGAGTAACAGAGG - Intergenic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1070405867 10:76094042-76094064 CAGTAGGAAGGTAGTAAATATGG + Intronic
1070567643 10:77615727-77615749 AAGTAGGGTTGGAGGAAAATGGG - Intronic
1071364915 10:84889720-84889742 CAGGAGAAATGGAGGAAAATAGG + Intergenic
1074046310 10:109842607-109842629 CAGTAGGAATTAAGAAACATGGG + Intergenic
1078376641 11:10800181-10800203 AAGTAGGAAGAGAGGAAAATGGG + Exonic
1078666440 11:13329543-13329565 AAGCAGCAATGGAGCAAAATGGG - Intronic
1079740281 11:24050168-24050190 CAGTAGTAGTGAGGTAAAATTGG - Intergenic
1080546202 11:33321341-33321363 AAGAAGGATTGGTGTAAAATGGG + Intronic
1080565698 11:33507235-33507257 CAGAGGGTATAGAGTAAAATTGG + Intergenic
1085023221 11:73221908-73221930 GAGTAGGCATGGAGTAGAAGGGG + Intronic
1085978956 11:81698150-81698172 GAATAGGAATGGGTTAAAATGGG - Intergenic
1086799264 11:91151755-91151777 CAGAAGGAATAGAGTAAAGGGGG + Intergenic
1088593909 11:111425642-111425664 CAGTAGGTAGGAAGAAAAATAGG + Intronic
1089929604 11:122297138-122297160 CAGTACAAATGGACTAATATAGG - Intergenic
1090135498 11:124194260-124194282 CAGTATGAGTGAAGTGAAATAGG + Intergenic
1090250993 11:125251697-125251719 CAGCAGGAATGGAGGAAGAGAGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1092961332 12:13599095-13599117 GAGTGGCACTGGAGTAAAATAGG + Intronic
1093233974 12:16583703-16583725 CTGTAGGAATGGATTGAAAAAGG + Intronic
1094361349 12:29634558-29634580 CAGTAGTGATGGAGTGAAATCGG + Intronic
1094671022 12:32569422-32569444 CAGCAGGATTGGAGCAGAATGGG - Intronic
1096933310 12:55240874-55240896 CAGTAAGCATGGAGGAAAATTGG - Intergenic
1097181680 12:57175315-57175337 CAGCAGGAATGGAGACGAATGGG + Intronic
1098497766 12:71156147-71156169 CAGTAAAAATGGAGAAAGATTGG + Intronic
1098777928 12:74645432-74645454 CAGTAAGATGGGAGTAAAATAGG + Intergenic
1098876968 12:75875974-75875996 TGGTGGGAATGTAGTAAAATGGG + Intergenic
1099186797 12:79523756-79523778 CAGTAGGAAGGGAGGAAGAAGGG - Intergenic
1099751132 12:86773570-86773592 CAGTAGGAAAATAGTAAGATAGG - Intronic
1101788520 12:107907775-107907797 AAGTAGGAAAGGAGAAAAATAGG + Intergenic
1102726668 12:115071534-115071556 TAGTAGGATTGGAGTAGAAAAGG - Intergenic
1103657808 12:122487482-122487504 CAGTATTACTGGAGTCAAATAGG - Intronic
1107533629 13:41307642-41307664 CAGGAGGAATAGAGTGAAAGAGG - Intergenic
1108396023 13:49992356-49992378 CTGTAAGAATAAAGTAAAATAGG - Intergenic
1114211663 14:20621064-20621086 CAGTAGGGAGGGAGGAAACTTGG - Intergenic
1114303502 14:21399566-21399588 CAGTCGGAAAGGAGTAGAATAGG + Intronic
1114630570 14:24157040-24157062 CAGTAGGGATGAAGGAAAAGGGG + Intronic
1115389736 14:32841615-32841637 CTGTGAGAATGGACTAAAATTGG - Intergenic
1116274627 14:42816073-42816095 GAGTAGGAAAAGAATAAAATCGG - Intergenic
1116962388 14:50979550-50979572 CTGTAGGAAAAGAGAAAAATTGG + Intronic
1117679858 14:58192855-58192877 CAGTAGGAATGGAGTAAAATAGG + Intronic
1118677810 14:68207314-68207336 CTGTGGGAATGAATTAAAATTGG - Intronic
1120336779 14:83167612-83167634 CAGTGGGAGTGGAGTAAGGTGGG - Intergenic
1120841649 14:89090898-89090920 CAGTAGGAATGAAGAGAAACAGG - Intergenic
1121159439 14:91723524-91723546 CAGTAAAGATGCAGTAAAATAGG - Intronic
1121396334 14:93626559-93626581 TACAAGGAAAGGAGTAAAATGGG - Intronic
1121589312 14:95089564-95089586 CAGGAGGACTTTAGTAAAATGGG + Exonic
1121984624 14:98492556-98492578 CAGTAAGACATGAGTAAAATGGG + Intergenic
1122389224 14:101368903-101368925 CAGTAGGAACGGATTAAGACAGG - Intergenic
1124071709 15:26400963-26400985 CAGAAAGAATGGAGTAACACAGG - Intergenic
1124096030 15:26649511-26649533 CAGCAGGAATGGACTAAGACAGG + Intronic
1124174752 15:27413837-27413859 AAATAGGAATGTAGAAAAATTGG - Intronic
1126407284 15:48333848-48333870 CAGAAGGAAAGGAGAAAAACGGG - Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1127697994 15:61470581-61470603 CAGTGGAAATGGAGTGGAATTGG - Intergenic
1130684670 15:86026203-86026225 CCGTGGGAAAGGAGAAAAATGGG + Intergenic
1131497643 15:92927369-92927391 CAGAAAGAATGAAGTAAGATAGG - Intronic
1131607086 15:93917637-93917659 CAGTAGTTATGTTGTAAAATGGG + Intergenic
1137991739 16:53164037-53164059 CAGAAATAATGGAGTCAAATAGG - Intronic
1138219192 16:55236619-55236641 CAGCAGGGATGGAGTGAAAAAGG + Intergenic
1139278251 16:65748131-65748153 CAGTTGGAAAGGAGAAAAATTGG - Intergenic
1140030614 16:71335319-71335341 CAGTAGGCATGGGGGATAATTGG - Intergenic
1143987563 17:10928112-10928134 CAGAAGGAATGAAGAAAAAAAGG + Intergenic
1151119965 17:71782039-71782061 CAGTAGGAATGCTTCAAAATTGG - Intergenic
1203178610 17_KI270729v1_random:38599-38621 CAAAAGGAATGGAATATAATGGG + Intergenic
1153527877 18:6014957-6014979 CAGTAGGAGTGGACTGAAGTGGG + Intronic
1154234185 18:12587976-12587998 GAGTAGGGTTGGAGAAAAATGGG - Intronic
1155114397 18:22750324-22750346 CAGTGATAATGGAGGAAAATAGG - Intergenic
1155605364 18:27599780-27599802 CAATAGGAATAGAATAAAAAAGG - Intergenic
1155793260 18:30000261-30000283 CAGTAGGATGGGAGATAAATAGG - Intergenic
1159054977 18:63454368-63454390 CTGTGGGAAAGGAGTAAAGTTGG - Intergenic
1159340928 18:67132216-67132238 TAGTAGGAGTGGAGTAAACTTGG + Intergenic
1159451597 18:68609576-68609598 CAGTAGGGATTGAATAAACTTGG + Intergenic
1159553944 18:69925659-69925681 TAGTAGGGATGGAGCAGAATAGG - Intronic
1160073878 18:75653314-75653336 CACTAAGAATGCAGTAAATTTGG - Intergenic
925258116 2:2507134-2507156 CACCAGGAAGGGAGGAAAATAGG - Intergenic
927778906 2:25923796-25923818 AAGTAGGAGTGGAGTCGAATGGG - Intergenic
930137789 2:47919926-47919948 CAGGAGGAACAGAATAAAATAGG - Intergenic
930205840 2:48586001-48586023 CAATAGGAATGGACTACAAAGGG - Intronic
930361173 2:50381902-50381924 CAGTAGGAATGATTTAAGATGGG + Intronic
931401460 2:61935179-61935201 CAGGAGGATGGGAGAAAAATTGG + Intronic
932943837 2:76203434-76203456 CTGAAGGAATGGAATAAACTGGG - Intergenic
933041195 2:77468950-77468972 CAGTACAAATGTAGTAAAAACGG - Intronic
934249406 2:90336334-90336356 CAGGAGGAAGGGAGAAAAAAGGG - Intergenic
934260173 2:91467132-91467154 CAGGAGGAAGGGAGAAAAAAGGG + Intergenic
935828000 2:106970539-106970561 CAGTAGGGATGGAAAAGAATGGG + Intergenic
936292821 2:111239576-111239598 TAGTTGGAATGCAGTAACATTGG - Intergenic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
937510304 2:122587728-122587750 CAGTTGGCATGGACTTAAATGGG + Intergenic
939274009 2:139976587-139976609 CAGCAGGAATGCAGAAAAATTGG + Intergenic
939601234 2:144193368-144193390 GTGTAGTAATGGATTAAAATAGG - Intronic
941000094 2:160193665-160193687 CAGAAGGAAAGGAGGAAAATAGG - Intronic
943444922 2:187972802-187972824 AAGTAAGAAAGGAGTAAATTTGG + Intergenic
943582760 2:189703749-189703771 CAGTAGGGTTGGACAAAAATTGG + Intronic
948572075 2:238923988-238924010 CAATTGGAATGCAGTAAATTAGG + Intergenic
1169655309 20:7916174-7916196 TAGTAAAATTGGAGTAAAATTGG + Intronic
1172063031 20:32199983-32200005 TAATAGGAAGGGACTAAAATAGG - Intronic
1173057469 20:39629472-39629494 CAGGAGGAAGGGACTAAGATGGG + Intergenic
1173285008 20:41662377-41662399 AAGTGAGAATGGAGAAAAATGGG + Intergenic
1173593379 20:44242386-44242408 CACTAGGAAAGAAGTTAAATTGG + Intergenic
1178104604 21:29303924-29303946 CAGTGGGCATGCAGTGAAATTGG + Intronic
1179390210 21:40981858-40981880 TAGTAGGACTGGAGGTAAATTGG - Intergenic
1179601785 21:42483196-42483218 CAATAGTAACTGAGTAAAATAGG - Intronic
1179805415 21:43834245-43834267 CAGAAGGAAGGAAGTGAAATGGG - Intergenic
1181295007 22:21830741-21830763 CAGAAGGAATGAAGGAAATTGGG + Intronic
1182752817 22:32655367-32655389 CAGCAGGAATGGACTAAGACAGG + Intronic
1183902765 22:41018969-41018991 GGGTAGGGATGGATTAAAATGGG + Intergenic
1184641886 22:45877233-45877255 CAGGAGGACTGGATTAGAATGGG + Intergenic
949765285 3:7519537-7519559 CAGAAGGCATGGAGTTAAAGAGG + Intronic
951421204 3:22487725-22487747 CAATAGAAATGGGGTGAAATAGG - Intergenic
952609618 3:35192416-35192438 CAGAAGGATAGGAGTAAAACAGG - Intergenic
952637379 3:35548378-35548400 CAGTAGCAATAAAGAAAAATGGG + Intergenic
952974712 3:38683821-38683843 CAGAAGGCCTGGAGTCAAATTGG + Intergenic
953580214 3:44146881-44146903 AAGTAGGTATGGAATAAATTTGG - Intergenic
954786812 3:53099462-53099484 CAGTAGGAACGCAGCAAAACAGG + Exonic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956465601 3:69517804-69517826 CAGCAGGAATGGAGCCAGATAGG - Intronic
956968791 3:74496524-74496546 CAGTGAGATTGGGGTAAAATAGG - Intronic
957041039 3:75335798-75335820 AAGGAGGAATGGATTAAAGTTGG - Intergenic
958903326 3:99913997-99914019 AAGTAGAAATTGAGTTAAATAGG + Intronic
959636208 3:108574580-108574602 CAGGAGGAAAGGAGCACAATTGG - Intronic
959664639 3:108906929-108906951 CAGTAGAAATGAAGTATAAATGG - Intergenic
959723418 3:109517115-109517137 CAGGAGGGAGGGAGAAAAATTGG - Intergenic
960216769 3:115048954-115048976 CAGTATGAATGGAGTAAGTTTGG - Intronic
961672039 3:128540216-128540238 CAGTAGGAATGGAAAGAATTGGG + Intergenic
962875112 3:139530031-139530053 CAGTGGGAATGAAGAAAAACAGG + Intronic
963475608 3:145799809-145799831 CAGGAGAAATGGAGTAGAAATGG - Intergenic
964051409 3:152398527-152398549 CATTAGAAAAGGAGTAAAGTGGG + Intronic
964413872 3:156427460-156427482 CAATAGGAGTGTAGAAAAATAGG - Intronic
964633184 3:158834586-158834608 CAGTAGGAATGGAATGGATTGGG + Intergenic
965031459 3:163373627-163373649 CAGTAGTCATGGAGAAAAAATGG + Intergenic
967605271 3:191437953-191437975 CAATAGGAAGGGGGAAAAATAGG - Intergenic
970110355 4:12630855-12630877 CAATGGGAATGAAGTAGAATTGG - Intergenic
971561636 4:28085239-28085261 GTGTAAGAATGGACTAAAATTGG - Intergenic
973807696 4:54541366-54541388 GAGTAGGAAAGGAGTAAGAATGG + Intergenic
974046674 4:56904480-56904502 CATTAGGATTGGACGAAAATGGG + Intergenic
974046682 4:56904524-56904546 CATTAGGATTGGACGAAAATGGG + Intergenic
974199091 4:58615449-58615471 CAGCAGGAATGGAGTAAGACAGG + Intergenic
974366460 4:60955896-60955918 CAAGAGGAATGGAGAAAAACAGG + Intergenic
974871023 4:67642209-67642231 CAGTAGGAATCAAGAAAACTTGG - Intronic
976364117 4:84214039-84214061 CAGACAGACTGGAGTAAAATGGG + Intergenic
976421402 4:84848695-84848717 CTTTAGGAATGGAGAACAATGGG + Intronic
977856564 4:101902069-101902091 AGATAGGAATGGTGTAAAATTGG - Intronic
978094661 4:104761404-104761426 CAGCAGGAATGAAGGGAAATGGG - Intergenic
978211167 4:106136843-106136865 CAGTAGCTATTCAGTAAAATTGG + Intronic
978811539 4:112854855-112854877 TGGGAGGAATGGAGTAGAATGGG + Intronic
979763692 4:124438444-124438466 TAGTATGAAGGTAGTAAAATTGG + Intergenic
981696407 4:147563600-147563622 CAGTAAGAAGGGAAGAAAATTGG - Intergenic
981784922 4:148466414-148466436 CAGTATAAATGGACTAAATTTGG - Intergenic
981815086 4:148821480-148821502 CAGTAGGTTTTGAGTAAAGTAGG + Intergenic
982171712 4:152668349-152668371 AAGTAGAAATATAGTAAAATTGG - Intronic
982317279 4:154044548-154044570 CATTAGGAATTGTGTAAAATTGG - Intergenic
982522309 4:156433589-156433611 CTGTGGGAATGGATTAGAATTGG + Intergenic
983143323 4:164181032-164181054 CAGTGGGACTCCAGTAAAATAGG - Intronic
983527561 4:168774788-168774810 CAGGAGGAAGGGATTATAATGGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985368726 4:189261870-189261892 CAGGAGGAATAGAGCAAAGTGGG + Intergenic
986547482 5:8914345-8914367 CAGTAGGAAGAGAGCAAAGTGGG + Intergenic
987471549 5:18336466-18336488 AAGAAGGAATGGAGGAAAAGTGG + Intergenic
988266818 5:28962342-28962364 GAATAGGAATGGAGTGATATAGG - Intergenic
988659880 5:33253859-33253881 CATTTGGAATGGACTTAAATAGG - Intergenic
988842116 5:35093225-35093247 CATTAGGAAGGGAATAACATAGG + Intronic
988918713 5:35921248-35921270 CAGTTGGCATAGAGAAAAATTGG - Intronic
990200430 5:53366705-53366727 CATGGGGAATGGAGGAAAATGGG + Intergenic
990868548 5:60406183-60406205 CATCAGGAATGGGGTAAATTTGG - Intronic
990966009 5:61448875-61448897 CAGTAGGAATAGAGAGTAATAGG + Intronic
991005447 5:61823786-61823808 GAGTAGAAAGGGAGTAAAATAGG - Intergenic
991513208 5:67403420-67403442 CAGTGAGAATGGAGAAAAAGGGG - Intergenic
991552569 5:67856920-67856942 CAGGAGGTCTGTAGTAAAATGGG - Intergenic
992434582 5:76743120-76743142 CAGAAGGAATGGAGGAAATAAGG + Intergenic
992842895 5:80713740-80713762 CCATAGGACTGGAGTAAAAATGG - Intronic
993087837 5:83385769-83385791 CAGTGAGGATGGAGAAAAATTGG + Intergenic
993199194 5:84790757-84790779 CAGAAGAAATGGAGGATAATGGG - Intergenic
993379000 5:87184041-87184063 CAGTAGGAATGAATGGAAATTGG - Intergenic
994156699 5:96511675-96511697 AATTAGGAGTAGAGTAAAATTGG - Intergenic
994751903 5:103748395-103748417 CTGTAGGAATAAAGGAAAATTGG - Intergenic
995060659 5:107808807-107808829 CAGGAGGATTGGAGAAAAAGTGG - Intergenic
995183095 5:109247039-109247061 CAGTGGGGATGGAGTAAACTGGG + Intergenic
997416267 5:133731221-133731243 CAGTACGAATGGGTTATAATTGG - Intergenic
998770082 5:145533228-145533250 CATTAGGAACAGAGGAAAATAGG - Intronic
999538883 5:152549977-152549999 CAGTGTGGCTGGAGTAAAATGGG - Intergenic
999676501 5:154008927-154008949 CTGTAGGGATGGATTAAAATTGG + Intronic
1000538741 5:162512367-162512389 CAGTAGAAATTCAGTAAACTTGG + Intergenic
1001094904 5:168768436-168768458 CAGTAGGAAGGGAGAAGAACGGG + Intronic
1003823715 6:9928812-9928834 CAGTAGGAATGGTGGAATAATGG - Intronic
1006705952 6:36021530-36021552 AAGGAGGATTGGTGTAAAATAGG + Intronic
1006731339 6:36238593-36238615 CAGGAGGAAGGGAGCAAAGTGGG + Intergenic
1007311281 6:40947916-40947938 CAGGAGGAAGGAACTAAAATGGG - Intergenic
1008839475 6:55883448-55883470 CAGTAGCAATAGAGAAAAATAGG + Intergenic
1009026293 6:58004433-58004455 CATTAGAAAAGGAGTAAAAGCGG + Intergenic
1009201844 6:60755905-60755927 CATTAGAAAAGGAGTAAAAGCGG + Intergenic
1011287205 6:85737707-85737729 AAGAAGGAAGGGAGTAAAGTAGG - Intergenic
1011339048 6:86292327-86292349 AAGTAGGAAGGGTGTAAAACTGG + Intergenic
1012219560 6:96632082-96632104 AAGAAGGGATGGAGAAAAATGGG - Intergenic
1012241253 6:96875505-96875527 CAGTAGAAATGGAGAAAAGATGG - Intergenic
1012310475 6:97718309-97718331 CAGTAGGAATGGACAAAAGAGGG + Intergenic
1013243287 6:108265392-108265414 CAGTAGGAAAGTAGGAAAACAGG + Intergenic
1015058270 6:128930246-128930268 CAGTAGGAATGAAAAGAAATAGG - Intronic
1015299598 6:131637841-131637863 CTCTAGGAGTGAAGTAAAATAGG - Intronic
1015765828 6:136715483-136715505 GGATAGGAATGGAATAAAATTGG - Intronic
1018346797 6:162908148-162908170 CAATAGGAAAAGTGTAAAATTGG - Intronic
1018617307 6:165699646-165699668 CAGCAACAATGGAATAAAATTGG + Intronic
1019852379 7:3572920-3572942 AAGTAGGAATTGATTAGAATAGG + Intronic
1020103859 7:5411674-5411696 CAGAAAGAAGGGAGTAAAACAGG + Intronic
1020528601 7:9298264-9298286 CATTAGGAATGAATAAAAATAGG + Intergenic
1024247207 7:47479513-47479535 CAGGAGGAATGGAGTGAGACTGG + Intronic
1027542846 7:79489951-79489973 CACCAGGAATTCAGTAAAATTGG - Intergenic
1027691323 7:81349498-81349520 GAGTAAAAATGGATTAAAATTGG + Intergenic
1028755496 7:94428824-94428846 CAGTAGGCATTCAGTAAAGTTGG - Intronic
1030453878 7:109747718-109747740 AAGTTGGAATGGAGAAATATAGG - Intergenic
1031026191 7:116682775-116682797 CAGTGGGCATGGCGAAAAATTGG - Intronic
1031154326 7:118091294-118091316 TAGTAAGAATGAAATAAAATTGG + Intergenic
1031310885 7:120195624-120195646 CAGTAGGAAAAGAGTAAAGAGGG - Intergenic
1031767000 7:125792469-125792491 CGGTGAGAATGGAGAAAAATTGG + Intergenic
1032261890 7:130345027-130345049 CAGTAGCAATGGAGATAAAAGGG - Exonic
1032947076 7:136866633-136866655 CAGAAATAATGGAGTAAAAAAGG + Intergenic
1032951804 7:136922971-136922993 TAATAGGAATGGTGTAAAAGGGG + Intronic
1034607972 7:152335344-152335366 TAGTAAGAATGGTATAAAATGGG - Intronic
1034676269 7:152894705-152894727 CTGAAGGAATGGAGCAAAAGCGG + Intergenic
1036433170 8:8708258-8708280 CAGTAGGACAAGAGTTAAATGGG - Intergenic
1037127024 8:15363861-15363883 CACAAGCAAAGGAGTAAAATTGG + Intergenic
1040553076 8:48453595-48453617 CAGGAGGGAGGGAGAAAAATGGG + Intergenic
1040807926 8:51415205-51415227 CAGTAGGAATTGTAGAAAATTGG + Intronic
1041551953 8:59113157-59113179 CAGTTGGAATACAGTAAATTAGG - Intronic
1042300426 8:67273893-67273915 CAATAGGAATTGAGCATAATAGG - Intronic
1042331285 8:67583311-67583333 TAGAAGGAATGGAATAAAAAAGG + Intronic
1042650008 8:71029806-71029828 TAGTAAGAATGGTTTAAAATAGG - Intergenic
1047321381 8:123787322-123787344 CAGTAAGAGTGGAGTCAAACAGG - Exonic
1048480912 8:134792041-134792063 AAAAAGGTATGGAGTAAAATTGG + Intergenic
1048643739 8:136394094-136394116 CAGGTAGAATGGAGCAAAATTGG + Intergenic
1050368214 9:4892877-4892899 CAGCAAGAATGGAGGAAAAGAGG + Intergenic
1051906785 9:22104484-22104506 CACTAGGAAAAGAGAAAAATTGG + Intergenic
1051950334 9:22623165-22623187 CAGGAAGGATGGAGTAAATTTGG + Intergenic
1054894124 9:70288025-70288047 TAATAGGAATGGAGTAAAAAGGG - Intronic
1055593106 9:77838586-77838608 AAGTAGAAATGGGGTAGAATTGG + Intronic
1056219165 9:84434435-84434457 CATTAGGAATGGTGTCCAATAGG - Intergenic
1057946191 9:99330975-99330997 AAGTAGGAGTGGAGTAAGTTAGG - Intergenic
1058437588 9:104977271-104977293 TAGTAGGAAGGCAGAAAAATGGG + Intergenic
1058930495 9:109714485-109714507 AAGAAGGAATGGGGTGAAATTGG - Intronic
1059925330 9:119203838-119203860 CAATAGCAATTGAGTAGAATTGG - Intronic
1061279786 9:129590918-129590940 CTGTAGGAGTGGAGTAACAAGGG + Intergenic
1189008924 X:37025885-37025907 GAGTAGTAATGCAATAAAATAGG - Intergenic
1190447253 X:50538842-50538864 CAATATGAATGGAGAAAAAAAGG + Intergenic
1192217169 X:69168638-69168660 CAGTAGGAAAAGAGATAAATTGG - Intergenic
1194551577 X:95307439-95307461 AGCTAGGAATGGAGAAAAATGGG + Intergenic
1196506752 X:116454580-116454602 AAGTAATAATGGAGAAAAATGGG - Intronic
1196520967 X:116670686-116670708 AAGTAATAATGGAGAAAAATGGG + Intergenic
1198502291 X:137263305-137263327 CTGTAGGAATGGAAAGAAATTGG + Intergenic
1200563547 Y:4736116-4736138 CAGGAGGAAGAGAGTGAAATGGG + Intergenic
1201436189 Y:13961083-13961105 AAGTAAGACTGGAGTTAAATGGG + Intergenic