ID: 1117680680

View in Genome Browser
Species Human (GRCh38)
Location 14:58200076-58200098
Sequence GGCCGCGGCGCGCCGGGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 915
Summary {0: 1, 1: 1, 2: 23, 3: 106, 4: 784}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117680680_1117680694 23 Left 1117680680 14:58200076-58200098 CCCGGGCCCGGCGCGCCGCGGCC 0: 1
1: 1
2: 23
3: 106
4: 784
Right 1117680694 14:58200122-58200144 ACGCCCGAGCGCCGGAGCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 114
1117680680_1117680692 15 Left 1117680680 14:58200076-58200098 CCCGGGCCCGGCGCGCCGCGGCC 0: 1
1: 1
2: 23
3: 106
4: 784
Right 1117680692 14:58200114-58200136 CGTCGCCGACGCCCGAGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117680680 Original CRISPR GGCCGCGGCGCGCCGGGCCC GGG (reversed) Intronic