ID: 1117680680 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:58200076-58200098 |
| Sequence | GGCCGCGGCGCGCCGGGCCC GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 915 | |||
| Summary | {0: 1, 1: 1, 2: 23, 3: 106, 4: 784} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1117680680_1117680692 | 15 | Left | 1117680680 | 14:58200076-58200098 | CCCGGGCCCGGCGCGCCGCGGCC | 0: 1 1: 1 2: 23 3: 106 4: 784 |
||
| Right | 1117680692 | 14:58200114-58200136 | CGTCGCCGACGCCCGAGCGCCGG | 0: 1 1: 0 2: 0 3: 6 4: 105 |
||||
| 1117680680_1117680694 | 23 | Left | 1117680680 | 14:58200076-58200098 | CCCGGGCCCGGCGCGCCGCGGCC | 0: 1 1: 1 2: 23 3: 106 4: 784 |
||
| Right | 1117680694 | 14:58200122-58200144 | ACGCCCGAGCGCCGGAGCCCCGG | 0: 1 1: 0 2: 0 3: 12 4: 114 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1117680680 | Original CRISPR | GGCCGCGGCGCGCCGGGCCC GGG (reversed) | Intronic | ||