ID: 1117680692

View in Genome Browser
Species Human (GRCh38)
Location 14:58200114-58200136
Sequence CGTCGCCGACGCCCGAGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 105}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117680683_1117680692 8 Left 1117680683 14:58200083-58200105 CCGGCGCGCCGCGGCCGCGCGAG 0: 1
1: 0
2: 1
3: 27
4: 246
Right 1117680692 14:58200114-58200136 CGTCGCCGACGCCCGAGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 105
1117680681_1117680692 14 Left 1117680681 14:58200077-58200099 CCGGGCCCGGCGCGCCGCGGCCG 0: 1
1: 1
2: 26
3: 107
4: 844
Right 1117680692 14:58200114-58200136 CGTCGCCGACGCCCGAGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 105
1117680685_1117680692 0 Left 1117680685 14:58200091-58200113 CCGCGGCCGCGCGAGGCCCCCGC 0: 1
1: 0
2: 4
3: 39
4: 342
Right 1117680692 14:58200114-58200136 CGTCGCCGACGCCCGAGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 105
1117680680_1117680692 15 Left 1117680680 14:58200076-58200098 CCCGGGCCCGGCGCGCCGCGGCC 0: 1
1: 1
2: 23
3: 106
4: 784
Right 1117680692 14:58200114-58200136 CGTCGCCGACGCCCGAGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 105
1117680678_1117680692 25 Left 1117680678 14:58200066-58200088 CCTGGGACAGCCCGGGCCCGGCG 0: 1
1: 0
2: 2
3: 32
4: 344
Right 1117680692 14:58200114-58200136 CGTCGCCGACGCCCGAGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 105
1117680682_1117680692 9 Left 1117680682 14:58200082-58200104 CCCGGCGCGCCGCGGCCGCGCGA 0: 1
1: 0
2: 2
3: 22
4: 230
Right 1117680692 14:58200114-58200136 CGTCGCCGACGCCCGAGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 105
1117680686_1117680692 -6 Left 1117680686 14:58200097-58200119 CCGCGCGAGGCCCCCGCCGTCGC 0: 1
1: 0
2: 1
3: 12
4: 210
Right 1117680692 14:58200114-58200136 CGTCGCCGACGCCCGAGCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117680692 Original CRISPR CGTCGCCGACGCCCGAGCGC CGG Intronic