ID: 1117680694

View in Genome Browser
Species Human (GRCh38)
Location 14:58200122-58200144
Sequence ACGCCCGAGCGCCGGAGCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 114}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117680683_1117680694 16 Left 1117680683 14:58200083-58200105 CCGGCGCGCCGCGGCCGCGCGAG 0: 1
1: 0
2: 1
3: 27
4: 246
Right 1117680694 14:58200122-58200144 ACGCCCGAGCGCCGGAGCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 114
1117680686_1117680694 2 Left 1117680686 14:58200097-58200119 CCGCGCGAGGCCCCCGCCGTCGC 0: 1
1: 0
2: 1
3: 12
4: 210
Right 1117680694 14:58200122-58200144 ACGCCCGAGCGCCGGAGCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 114
1117680687_1117680694 -8 Left 1117680687 14:58200107-58200129 CCCCCGCCGTCGCCGACGCCCGA 0: 1
1: 0
2: 11
3: 124
4: 583
Right 1117680694 14:58200122-58200144 ACGCCCGAGCGCCGGAGCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 114
1117680688_1117680694 -9 Left 1117680688 14:58200108-58200130 CCCCGCCGTCGCCGACGCCCGAG 0: 1
1: 0
2: 0
3: 17
4: 140
Right 1117680694 14:58200122-58200144 ACGCCCGAGCGCCGGAGCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 114
1117680680_1117680694 23 Left 1117680680 14:58200076-58200098 CCCGGGCCCGGCGCGCCGCGGCC 0: 1
1: 1
2: 23
3: 106
4: 784
Right 1117680694 14:58200122-58200144 ACGCCCGAGCGCCGGAGCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 114
1117680682_1117680694 17 Left 1117680682 14:58200082-58200104 CCCGGCGCGCCGCGGCCGCGCGA 0: 1
1: 0
2: 2
3: 22
4: 230
Right 1117680694 14:58200122-58200144 ACGCCCGAGCGCCGGAGCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 114
1117680689_1117680694 -10 Left 1117680689 14:58200109-58200131 CCCGCCGTCGCCGACGCCCGAGC 0: 1
1: 0
2: 2
3: 16
4: 135
Right 1117680694 14:58200122-58200144 ACGCCCGAGCGCCGGAGCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 114
1117680685_1117680694 8 Left 1117680685 14:58200091-58200113 CCGCGGCCGCGCGAGGCCCCCGC 0: 1
1: 0
2: 4
3: 39
4: 342
Right 1117680694 14:58200122-58200144 ACGCCCGAGCGCCGGAGCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 114
1117680681_1117680694 22 Left 1117680681 14:58200077-58200099 CCGGGCCCGGCGCGCCGCGGCCG 0: 1
1: 1
2: 26
3: 107
4: 844
Right 1117680694 14:58200122-58200144 ACGCCCGAGCGCCGGAGCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117680694 Original CRISPR ACGCCCGAGCGCCGGAGCCC CGG Exonic