ID: 1117684343

View in Genome Browser
Species Human (GRCh38)
Location 14:58238086-58238108
Sequence TAGGAGAGAAAGGAAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 509}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117684338_1117684343 7 Left 1117684338 14:58238056-58238078 CCATCGATGGAGCACTCCCAAGT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1117684343 14:58238086-58238108 TAGGAGAGAAAGGAAGTAGCTGG 0: 1
1: 0
2: 4
3: 46
4: 509
1117684340_1117684343 -9 Left 1117684340 14:58238072-58238094 CCCAAGTGAAGAGATAGGAGAGA 0: 1
1: 0
2: 2
3: 50
4: 494
Right 1117684343 14:58238086-58238108 TAGGAGAGAAAGGAAGTAGCTGG 0: 1
1: 0
2: 4
3: 46
4: 509
1117684337_1117684343 8 Left 1117684337 14:58238055-58238077 CCCATCGATGGAGCACTCCCAAG 0: 1
1: 0
2: 0
3: 6
4: 36
Right 1117684343 14:58238086-58238108 TAGGAGAGAAAGGAAGTAGCTGG 0: 1
1: 0
2: 4
3: 46
4: 509
1117684336_1117684343 19 Left 1117684336 14:58238044-58238066 CCAAGGACTCACCCATCGATGGA 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1117684343 14:58238086-58238108 TAGGAGAGAAAGGAAGTAGCTGG 0: 1
1: 0
2: 4
3: 46
4: 509
1117684341_1117684343 -10 Left 1117684341 14:58238073-58238095 CCAAGTGAAGAGATAGGAGAGAA 0: 1
1: 0
2: 5
3: 33
4: 418
Right 1117684343 14:58238086-58238108 TAGGAGAGAAAGGAAGTAGCTGG 0: 1
1: 0
2: 4
3: 46
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117684343 Original CRISPR TAGGAGAGAAAGGAAGTAGC TGG Intronic
900385220 1:2407504-2407526 TAGGACAGCCAGGAAGTGGCTGG - Intronic
900538094 1:3188818-3188840 AAGGAGAGAGAGGAGGAAGCAGG + Intronic
900580214 1:3405044-3405066 TAGGAAGGAAAGGAAGTCTCAGG + Intronic
901653866 1:10758170-10758192 CAGCAGAGAATGGAAGTAGGAGG - Intronic
902079937 1:13813953-13813975 CAGCAGAGAAAGGGAGAAGCTGG + Intronic
903344981 1:22678120-22678142 TGGCAGAGTAAGGAAGGAGCTGG + Intergenic
904515861 1:31054379-31054401 TACGAGAGAAATAAAGTACCTGG + Intronic
905149679 1:35917920-35917942 GAGGAGGGAAAGGAAGTATAAGG - Intronic
905970188 1:42135976-42135998 TAGAACAGAAAGGAAGAAGGTGG - Intergenic
906687982 1:47774814-47774836 TAGGAGAAAATGGAACAAGCTGG - Intronic
906792833 1:48673927-48673949 CAGGGGAGGAAGGAAGCAGCAGG - Intronic
906816303 1:48883373-48883395 TAGGCAAGGAAGGATGTAGCAGG - Intronic
906875012 1:49528024-49528046 TAGGAGAGACAGCAAGTCTCTGG + Intronic
907361843 1:53923133-53923155 TGGGAGAGAAAGGAACTAATGGG + Intronic
907726216 1:57023188-57023210 CAGGAGAGAAAGCAATAAGCAGG - Intronic
907973766 1:59410951-59410973 TAGGAGAGAAAGAAAGAAGTTGG - Intronic
908457287 1:64316065-64316087 TAAGAGGAAAAGGAAGTACCAGG - Intergenic
908528681 1:65012503-65012525 TAAGACAGTAAGGAATTAGCAGG + Intergenic
909793780 1:79706603-79706625 TACGAGAGTAAGGGAGTAGGAGG - Intergenic
910046907 1:82928436-82928458 TGGGAAAGAAAGGAAGAAACAGG - Intergenic
910103185 1:83600113-83600135 AAGGAGAGAAAGAAAGGGGCGGG + Intergenic
910112664 1:83699464-83699486 AAGGAAAGAAAGGCAGAAGCAGG - Intergenic
910844830 1:91594904-91594926 TTGCAGAGAAAGGCAGTGGCCGG + Intergenic
911089968 1:94010423-94010445 TATGAGAGAAAGGACACAGCAGG - Intronic
911156676 1:94643842-94643864 TAGGAGACAGAGGTAGAAGCAGG - Intergenic
911719893 1:101179320-101179342 AAGGAGACAAAGGAAGAAGTAGG + Intergenic
912687770 1:111780367-111780389 TAGTGGAGAAATGAAGGAGCTGG - Intronic
913027016 1:114854117-114854139 GAGGAGAGAAAGGAGGCAGAGGG - Intergenic
913699884 1:121364289-121364311 AAGGAAAGAAAGGAGGAAGCAGG - Intronic
914137657 1:144915748-144915770 AAGGAAAGAAAGGAGGAAGCAGG + Intronic
914258178 1:145977370-145977392 AAGGAGAGGAAGGAAGGGGCTGG - Intronic
914395513 1:147263578-147263600 TAAGAGAGACATGAAGTAGAAGG - Intronic
914395521 1:147263695-147263717 TAAGAGAGACATGAAGTAGAAGG - Intronic
914918303 1:151831486-151831508 CAGGAAAGAAAGGGAGAAGCGGG - Intronic
915069023 1:153250271-153250293 TAGTAGAAAAATGAAGTAACTGG + Intergenic
916459539 1:165009075-165009097 TAGGAGAGAGAGCAAAGAGCTGG - Intergenic
916529879 1:165646849-165646871 TAGGAGTGCAAGGAGGTATCAGG + Intronic
916695797 1:167234981-167235003 TATGGGAGAAAGGAAGTGGTTGG - Intronic
916899266 1:169202939-169202961 GAGAAGAGAAAGGAAGAAGCTGG + Intronic
917045446 1:170854642-170854664 TTGGAGGGAAAGGAAAGAGCTGG + Intergenic
917527431 1:175801472-175801494 AATAAGAAAAAGGAAGTAGCAGG + Intergenic
918432512 1:184476784-184476806 TTGGAGACAAAGGAAGGAGATGG - Intronic
918674640 1:187267879-187267901 TACCAGAGAAAGGAAGTAGTAGG - Intergenic
918685603 1:187410927-187410949 CAGGAGAGAAAGGATGTGCCAGG - Intergenic
918876729 1:190056118-190056140 TAGGGAGGAAAGGAAGCAGCGGG - Intergenic
919232529 1:194792438-194792460 CAGGAGAGAAAGAAAGAAGGAGG + Intergenic
919434176 1:197536003-197536025 GAGGAGAGAAATGAAGGAACAGG + Intronic
919993700 1:202728265-202728287 TAGGGGAGAAAGGAAGGGACAGG + Exonic
920487298 1:206382998-206383020 AAGGAAAGAAAGGAGGAAGCAGG - Intronic
920774195 1:208920254-208920276 TAAGAGAGGAAAGAAGTAGTTGG + Intergenic
921650981 1:217677753-217677775 TTGTAGAGAAAGGAAGTATAAGG + Intronic
922353121 1:224751214-224751236 GAGAGGAAAAAGGAAGTAGCGGG + Intergenic
923446458 1:234076299-234076321 TAAAAGAAAAAGGTAGTAGCTGG + Intronic
923773260 1:236956397-236956419 ATGGAGAGAAAGGAAGAAACAGG - Intergenic
924514448 1:244754318-244754340 GAGGAGAAAAGAGAAGTAGCAGG - Intergenic
1063249915 10:4263591-4263613 TAGGAGAGGCAGGCTGTAGCCGG - Intergenic
1063538457 10:6908653-6908675 TAGGAGAGAAGGGAGGAAGAAGG - Intergenic
1063609922 10:7553540-7553562 TTGGAGAGAAGGGGAGTGGCGGG - Intergenic
1063796115 10:9515735-9515757 GAGGAAAGAAAGGAAGGAGAAGG + Intergenic
1063920555 10:10928005-10928027 TAAATGAGAAAGAAAGTAGCAGG - Intergenic
1063938340 10:11102313-11102335 TAAAAGAGAAAGGCATTAGCTGG + Intronic
1065155354 10:22864202-22864224 CATGAGAGAAATGAAGTAACTGG + Intergenic
1065169187 10:23010439-23010461 GAGGAGGGAAAGGAAGGAGAGGG - Intronic
1065915978 10:30355366-30355388 CAGGAGAGAAATGAGGTATCAGG + Intronic
1066362556 10:34745371-34745393 TAGAAAAGAAAGGAAGTAAAAGG + Intronic
1067560977 10:47304209-47304231 AAGGAGAGAAAGGCAGGAGATGG + Intronic
1067911275 10:50349447-50349469 TTGTCGAGAAGGGAAGTAGCTGG - Intronic
1068098588 10:52522707-52522729 GAAGAGAGAAAGGAAGTTCCTGG - Intergenic
1068737350 10:60429317-60429339 TAAGAAAGAAAGGAAGTAAAAGG + Intronic
1069083646 10:64114904-64114926 TAAAAAAGAAAGGAAGAAGCTGG + Intergenic
1069335938 10:67350343-67350365 TAGGAGAGAAAGATAGTTGGAGG + Intronic
1069984943 10:72276638-72276660 TTAGAGAGCAAGGAAATAGCAGG + Intergenic
1070106782 10:73440569-73440591 TAGAATAGAAAGGAAGTTACTGG - Intronic
1072250012 10:93574191-93574213 TAGGAGTGAAAGAAAAAAGCAGG - Intronic
1072510773 10:96122109-96122131 TAATAGAAAAAGGAAGTACCAGG - Intergenic
1072910567 10:99497269-99497291 TTGGAGGGAAAGGAAGGAGCTGG + Intergenic
1073653298 10:105384339-105384361 CAGGAGAGAAAAGAAATAGTTGG + Intergenic
1074005408 10:109417874-109417896 TAGTAGAGAAAGGAACACGCTGG - Intergenic
1074398557 10:113121265-113121287 TAGGAGAGGAAGGAAGGAAGAGG - Intronic
1074453044 10:113575025-113575047 TGGGACAGAAAAGAAGAAGCTGG + Intronic
1074600287 10:114907100-114907122 TTGGAGAGAATGGAAGAAGCTGG - Intergenic
1075597666 10:123743911-123743933 CAGGAGAGAAGGCAAGTAGGAGG + Intronic
1076061011 10:127413837-127413859 TAGGAGGAAAGGGAAGGAGCTGG - Intronic
1076105582 10:127820226-127820248 TGGGAGAGGAAGGAATTAACAGG + Intergenic
1076188918 10:128469395-128469417 TGGGAGAGGAAAGAAGGAGCTGG - Intergenic
1076556077 10:131322263-131322285 GAGGAGAGAAAGGCAGGGGCAGG + Intergenic
1078967111 11:16358624-16358646 TAAGAGGGAAAGAAATTAGCAGG + Intronic
1079343589 11:19633152-19633174 TGGGAGAGACAGGGAGGAGCTGG - Intronic
1080287267 11:30629757-30629779 TAGGAGAGATAAGTAGAAGCAGG - Intergenic
1080413899 11:32051793-32051815 AAGGAAAGAAAGGAAGGAGAAGG + Intronic
1081936279 11:46906007-46906029 AAGGACAGAGAGGAAGTAGGGGG + Intronic
1082025847 11:47571426-47571448 CAGCAGAGAAAGAAAGAAGCAGG - Intronic
1082769069 11:57191770-57191792 AAAGAGAGAAAGGAACTAGGCGG + Intergenic
1083204041 11:61137170-61137192 TAGGAGAGAAGGGAGTTGGCAGG - Intronic
1084897581 11:72285271-72285293 TATGAGAGAAAGGAAAGAGAAGG - Intergenic
1085303597 11:75472912-75472934 GAGGAGAGAAAGGAAGGAGGAGG + Intronic
1086222395 11:84463890-84463912 TAAGAGAGAAAGGGAGAAGGGGG + Intronic
1086837851 11:91648042-91648064 TAGGAGAGTAAGGTAGTAGATGG + Intergenic
1087209472 11:95432039-95432061 TAGAAGAGTAAGGATTTAGCAGG + Intergenic
1087552702 11:99672269-99672291 TAGGGAAGAAAGGAAGCAGAAGG + Intronic
1088058292 11:105611207-105611229 AAGGAGAGAAAGGAAGAGGAGGG - Intronic
1088363508 11:109016208-109016230 TAGGAGAGATGGGAATTAGAAGG + Intergenic
1089605782 11:119640458-119640480 CAGGAGGGAAAGGCAGGAGCTGG + Intronic
1089610550 11:119666354-119666376 AAGAAGAGAAAGGAAGCAGGTGG + Intronic
1089683664 11:120133531-120133553 TGGGTGAGAAAGGAGGTAGGGGG - Intronic
1090233403 11:125126983-125127005 TTGGAGAGAAAGGAGGGAGCTGG + Intergenic
1090508713 11:127348295-127348317 TGGGATAGAAAGGAAGTAATGGG + Intergenic
1091470539 12:722524-722546 CAGGAGAGAAAAGAAGCAGCTGG + Intergenic
1091659273 12:2371171-2371193 TAGGAGTGAAAGGGAGAGGCAGG + Intronic
1091736397 12:2925495-2925517 TAGGGGAGCAGGGAAGTAGCTGG + Intronic
1092183556 12:6462558-6462580 TGGGTGAGAAAGAAAGTAGAAGG + Intronic
1092203804 12:6603512-6603534 TAGGACAGACAGGAAGTGGCAGG + Intronic
1092766392 12:11856660-11856682 GGAGAGAGAGAGGAAGTAGCTGG - Intronic
1093933477 12:24977333-24977355 TAAGGAAGAAAGGAAGTTGCAGG + Intergenic
1095257688 12:40059303-40059325 GAGGAGACAGAGGAAGTAGATGG + Intronic
1095488027 12:42704527-42704549 GAGGAGAGAAAGGAAAGAGTTGG + Intergenic
1096251573 12:50036466-50036488 CAAGAGTGAGAGGAAGTAGCTGG + Intergenic
1096339354 12:50784342-50784364 TAGGAGAGATAGGGAGTTGGTGG + Intronic
1096551707 12:52377600-52377622 TACCAGAGAAAGGAAGAAGAAGG + Intergenic
1096581229 12:52586809-52586831 TAAGGGAAAAAGGAAGGAGCTGG - Intronic
1096745439 12:53723921-53723943 TGGGAAAGAAAGGAAGGAGAGGG - Intronic
1096979242 12:55718906-55718928 TGGGAGTGAAAGGAAGGAGCTGG + Intronic
1097080763 12:56429148-56429170 TAGGACAGGAAGGAAGAAGTTGG - Intronic
1097641957 12:62192388-62192410 GAGGGGAGAAAGAAAGGAGCGGG + Exonic
1097797236 12:63876320-63876342 TAGGATAGAAAGGAATAATCAGG + Intronic
1098014519 12:66090342-66090364 TGGCAGAGAAAGGAAGTTGAAGG + Intergenic
1098155089 12:67589432-67589454 GAAGAGAGAAAGCAAGAAGCTGG - Intergenic
1098450929 12:70617497-70617519 GAGGAGGGCAAAGAAGTAGCGGG - Intronic
1098532683 12:71558454-71558476 TAGTAGGGAAAGGAAGAGGCTGG - Intronic
1098545628 12:71707996-71708018 GAGGAGAGAAGAGAAGCAGCTGG - Intergenic
1100589959 12:96017884-96017906 TAGGAGAGAAAGAAAGTGATGGG - Intronic
1100637274 12:96446830-96446852 TAGAAGAAACAGGAAGTAGAAGG - Intergenic
1101210542 12:102531342-102531364 TAGGAGGGAAGGGAAATAGGAGG + Intergenic
1101888888 12:108693738-108693760 TAGGAGGGCAAAGAAGTAGGTGG - Intronic
1102129090 12:110510963-110510985 AAAGAGAGAAAGGAAGAAGGAGG + Intronic
1102162960 12:110784147-110784169 TGAGAGACAAAGGCAGTAGCTGG - Intergenic
1102642332 12:114378086-114378108 TAAGAGAGCAAGGAAGTAAAGGG + Intronic
1103135007 12:118499453-118499475 AAGGAGAGGAAGGAAGGAGAGGG - Intergenic
1103147583 12:118609019-118609041 GGGGAGAGAAAGGAGGTAGGGGG + Intergenic
1104400895 12:128475236-128475258 TAGGAGAAAAAAGAAATCGCAGG - Intronic
1104702835 12:130920232-130920254 TAGCAGAGAAAGGGAATGGCTGG - Intergenic
1110938292 13:81319144-81319166 TAGCAGAGAAAAGCAGCAGCTGG + Intergenic
1111937417 13:94571244-94571266 CAAGAGAGAGAGGCAGTAGCGGG + Intergenic
1112106813 13:96249434-96249456 AAGGAGAGAAATGGAGTAGGAGG + Intronic
1113086096 13:106570697-106570719 TAGGAGACAAAGGTATTAGGAGG - Intergenic
1113209311 13:107956826-107956848 GAGGAGAGGAAGGAAGTACAAGG - Intergenic
1114387715 14:22272230-22272252 TAGGAGAGAAAGGACTTCACTGG - Intergenic
1115618585 14:35119743-35119765 TAGGAAAGAAAGGAGGAGGCTGG + Intronic
1115872260 14:37817729-37817751 CAGGAGAGAATGGAAGAAACTGG + Intronic
1116322712 14:43491246-43491268 AAGCAGAGATAGGAAGTAGAGGG - Intergenic
1117474814 14:56083445-56083467 AAGTAGAGAAAGGAATTATCAGG + Intergenic
1117521276 14:56553570-56553592 GATGAGAAAAAGGAAGTAGCAGG - Intronic
1117684343 14:58238086-58238108 TAGGAGAGAAAGGAAGTAGCTGG + Intronic
1118142946 14:63104849-63104871 GAAGAGAGAAGGGAAGAAGCTGG - Intergenic
1118412208 14:65492917-65492939 GAGGAGAGAAGGGAAGCAGGTGG - Intronic
1118956487 14:70487799-70487821 TAGGGGAGACAGGAAGTAAATGG + Intergenic
1119448111 14:74683601-74683623 GTGGGGAGAGAGGAAGTAGCTGG + Intronic
1119621743 14:76136793-76136815 AAGGAGAGGAAGGAAGGAGGCGG - Intergenic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1120213085 14:81653513-81653535 TGGCAGGCAAAGGAAGTAGCTGG + Intergenic
1120476785 14:84998551-84998573 TAGGAGATAAAGGAGCCAGCAGG - Intergenic
1120653194 14:87159575-87159597 AAGGAGAGGAAGGAAGAAGGGGG + Intergenic
1120764855 14:88319578-88319600 TAGTAGAGAAAGGAACAAGTAGG + Intronic
1120939210 14:89930548-89930570 TAGGAGGAAAAGAAAGTAGAAGG - Intronic
1121343835 14:93120758-93120780 TAGGTGAGAAAGTAAGAACCAGG + Intergenic
1121962382 14:98273511-98273533 AAGGAGAGAAGGGAAGTATTAGG + Intergenic
1121967283 14:98322168-98322190 TAAGAGATAAAGGAAGGAGGTGG - Intergenic
1122308248 14:100779015-100779037 TAGGAGAGGGAGGGAGGAGCGGG - Intergenic
1122697129 14:103561656-103561678 ATGGAGAGAAACGAAGAAGCGGG - Intronic
1122928996 14:104924815-104924837 CAGGACAAAGAGGAAGTAGCTGG + Exonic
1123986300 15:25649297-25649319 TAGGGTAGGAAGGAAGCAGCAGG - Intergenic
1125102997 15:35936936-35936958 TTGCAGAGAATGGAAGTAGATGG + Intergenic
1125125653 15:36217093-36217115 TAGGAGAAAAAGGAGATAGAGGG - Intergenic
1125359395 15:38849659-38849681 TTGGAGAGACAGGCAGGAGCTGG + Intergenic
1125551466 15:40548068-40548090 TAGGAGTGAGAGGAAATAGAAGG - Intronic
1125898024 15:43318917-43318939 TGGGAGATGAAGGAAGCAGCAGG + Intergenic
1125962770 15:43846223-43846245 TAGGAGATTAAGGAAGTATGGGG + Intronic
1126274067 15:46855699-46855721 CAGAAGAGGAAGGAAGTAGTGGG + Intergenic
1126560728 15:50040853-50040875 CAGGAAAGAAAGGAAGTAGAGGG + Intronic
1126703280 15:51386005-51386027 TAGGAGGGAAGGGAAGAGGCTGG + Intronic
1127144007 15:56006533-56006555 CAGGAGAGAAAGCATGTAGATGG - Intergenic
1128245336 15:66128828-66128850 GAGTAGGGAAAGGAAGTAGATGG - Intronic
1129479360 15:75810781-75810803 CAGGAGAGAAAGGAAGTATCAGG - Intergenic
1129689747 15:77706425-77706447 TAAGAGAAAGAGGAAGTTGCTGG - Intronic
1129931152 15:79412165-79412187 CAGTAGAGGAAGGAAGTGGCTGG - Intronic
1130122911 15:81067410-81067432 AAGGAGAGAAAGGAAGAATTAGG - Intronic
1130306088 15:82712957-82712979 CAGGAGAAAAAGGAAGGATCAGG - Intergenic
1131224967 15:90616994-90617016 AAGGAGAGAATGGAAGAAGAGGG - Intronic
1131325097 15:91435416-91435438 GAGGAAGGAAAGGAAGTAGTAGG + Intergenic
1132244965 15:100287429-100287451 AAGGAGAGAAAGCAAGCAACAGG + Intronic
1134127995 16:11629608-11629630 AAGAAGAGGAAGGAAGGAGCCGG - Intronic
1134747044 16:16596457-16596479 CAGAAGAGACAGGAAGTAGCTGG + Intergenic
1134881381 16:17747542-17747564 AAGGAAAGAAAGGAAGGAGGGGG + Intergenic
1134912739 16:18042690-18042712 GAGGAGAGAAAGGGAGAAGAAGG - Intergenic
1134998432 16:18757203-18757225 CAGAAGAGACAGGAAGTAGCTGG - Intergenic
1135229195 16:20689719-20689741 TTGGAGAGGAAGGAAGTAAAAGG - Intronic
1135343130 16:21665649-21665671 AAGGAAAGAAAGGAAGAAACTGG - Intergenic
1135807249 16:25554053-25554075 GAGAGGAGAAAGGAAGAAGCTGG - Intergenic
1136100723 16:27993633-27993655 GAGAGGAGAAAGGAAGAAGCTGG + Intronic
1136120028 16:28126908-28126930 CAGGAGAGAACTGAAGTAGGGGG - Intronic
1137494537 16:48959516-48959538 AAAGAGAGAAAGGAGGCAGCAGG - Intergenic
1138347966 16:56331551-56331573 TGGGAGTGAAAGGAGGTACCAGG - Intronic
1139092899 16:63670793-63670815 TAGGAAAGAAAGAAAGAAGAGGG + Intergenic
1140879211 16:79182518-79182540 AAGGAGGGAAAGTAATTAGCGGG + Intronic
1141472590 16:84249601-84249623 GGGGAGAGAAAGGAAGGTGCTGG - Intergenic
1141585319 16:85029637-85029659 TATGAGAGAAAGGAGGGAGGAGG - Intronic
1142068120 16:88074342-88074364 TAGGAGGGAAGGCAGGTAGCTGG + Intronic
1142420146 16:89964881-89964903 TAGTAGAGAAAGGGAGCAGCTGG - Intronic
1142793099 17:2283973-2283995 AAGGAGAGAAAGGAATAAACAGG + Intronic
1142884662 17:2905226-2905248 GAGGAGAGAAGGGAAGGCGCAGG + Intronic
1143183729 17:4998680-4998702 CAGGACAGGAAGGGAGTAGCTGG - Intronic
1144174197 17:12688718-12688740 AAGGAGAGAGAGGAAGGAGATGG - Intronic
1144178281 17:12729360-12729382 TGAGAGAGAAAGGAAGTGCCTGG + Intronic
1144185323 17:12790467-12790489 TGGGAGAGGAAGGAAGGTGCTGG + Intronic
1146511081 17:33449265-33449287 GAGGGGAGGAAGGAAGCAGCTGG - Intronic
1147374298 17:40014965-40014987 TAAGAGAGAAAAAAAGAAGCTGG - Intergenic
1147605870 17:41773416-41773438 GAGGAGAGGAAGGAGGCAGCTGG - Intronic
1148506646 17:48132621-48132643 TAGGAAAAAAACCAAGTAGCTGG + Intergenic
1151134317 17:71931074-71931096 TAGGTCAGAAAGGAGGTAACGGG + Intergenic
1151290701 17:73147904-73147926 AGAGAGAGAAAGAAAGTAGCAGG - Intergenic
1151396829 17:73828247-73828269 CAGGAGAGAAAGGATGAAGGAGG - Intergenic
1151470368 17:74314154-74314176 GAGGAGGGAGAGGAAGCAGCGGG + Exonic
1153355817 18:4134237-4134259 CAGGAGAAGAAGGAATTAGCTGG - Intronic
1153818179 18:8809012-8809034 AAGGAGAGAAAGGAAGTTTCAGG + Intronic
1155087849 18:22475012-22475034 TAGGGGAGAACGGGAGTAGAAGG - Intergenic
1155760355 18:29557860-29557882 CAGGAGAGAAAGGGAGCAACAGG + Intergenic
1156114847 18:33775417-33775439 TAGGTGAGACAGGAATTAGGTGG + Intergenic
1157803996 18:50644531-50644553 TTGGAGAGAAAGGAAGAGGGAGG - Intronic
1157958632 18:52127075-52127097 TAGGAGACAGAAGAAGTAGAAGG + Intergenic
1158416382 18:57252840-57252862 GAGGAGAGAGAGGAACTAGCAGG - Intergenic
1159615811 18:70578464-70578486 TAAGAGAGAAAGGGAGTTGCTGG - Intergenic
1160074435 18:75658769-75658791 TGAGAGAGAGAGGAAGGAGCAGG + Intergenic
1160888237 19:1362452-1362474 TGGGAGAGAAATGAACTCGCAGG - Intronic
1162019197 19:7860995-7861017 AAGGAGAGAAAGGAAGGCCCAGG + Intronic
1163024715 19:14503916-14503938 TATGAGAGAAAGGTAGGAGTCGG - Intergenic
1163351272 19:16777726-16777748 TGGGAGGGAAAGGAAGGAGAGGG + Intronic
1163438756 19:17310877-17310899 TAGGAGACCAGGGAAGAAGCTGG - Intronic
1163514516 19:17755016-17755038 AAGGAGAGAAAGGATGAAGGAGG - Intronic
1163622176 19:18367627-18367649 AAGGAAAGAAAGGAAGAAGCAGG + Exonic
1163716113 19:18873289-18873311 TAGGAGAGAAATGTAGGAGTCGG + Intronic
1163779542 19:19239355-19239377 TAGGAGGGAAAGGAAGGAGGAGG - Intronic
1164104966 19:22102031-22102053 TAAGATAGAAATGAAGGAGCTGG - Intergenic
1164386648 19:27776905-27776927 TAGGAAAAAAAGGAAGGAGGAGG - Intergenic
1165107121 19:33477080-33477102 TTGGAGAGACAGGCAGTGGCTGG - Intronic
1166048710 19:40245235-40245257 TAAGAGAAAAAGGAAGGTGCAGG + Intronic
1166139111 19:40796480-40796502 TAGGAGGGGAAGGAAATACCTGG + Intronic
1166286847 19:41836251-41836273 TAGGGGAGAGAGGAAAGAGCAGG - Intergenic
1168147774 19:54429463-54429485 TAGTAGAGAAAGGAATTGGGGGG + Intronic
925494724 2:4434650-4434672 TAGGAGTGAAAGGAAGTGAATGG - Intergenic
925592940 2:5528025-5528047 TGGGAGAGTGAGGAAGTGGCTGG - Intergenic
925776887 2:7344429-7344451 TGGAAAAGAAAGGAAGTAGCAGG + Intergenic
926287927 2:11505386-11505408 CTGGAGAGACAGGAAGGAGCTGG - Intergenic
926315647 2:11707720-11707742 GAGGGGAGAAAGGGAGTGGCTGG + Intronic
926422264 2:12711681-12711703 CTAGAGAGAAAGAAAGTAGCTGG + Intergenic
926986130 2:18626076-18626098 AAAGAGAGAAAGGAAGGAGGAGG + Intergenic
927310217 2:21622213-21622235 TAGGAGATACAGGGAGAAGCTGG + Intergenic
928387548 2:30883262-30883284 TGGGAGATAAGGGAAGTAGTTGG + Intergenic
928401125 2:30979465-30979487 GAGGAGAGACAGGGAGGAGCAGG + Intronic
928566484 2:32556384-32556406 TAGGAGAGAAAGGACTACGCTGG - Intronic
929806883 2:45153993-45154015 GAGCAGAGAAAGGAAGTCACGGG - Intergenic
930299646 2:49598881-49598903 TAAGAGAGAAAGAAAGAAGTGGG - Intergenic
932404459 2:71504094-71504116 TGGGTGAGTCAGGAAGTAGCCGG + Intronic
932515629 2:72345267-72345289 TAGGAGAAATAGGAAGTACCAGG - Intronic
932681473 2:73829334-73829356 AGGAGGAGAAAGGAAGTAGCAGG - Exonic
933418478 2:82018777-82018799 GAGGAGAGAAAATAAGAAGCAGG - Intergenic
933604967 2:84372968-84372990 TAGGCAAGAAAGGAAGTAAAAGG + Intergenic
933720872 2:85396778-85396800 TAGAAGTGAAAGGGAGGAGCTGG - Intronic
933888927 2:86747150-86747172 TAGGTGAGAAATGAGGAAGCAGG - Intronic
934545919 2:95216073-95216095 AAGGAGCCAAAGGAAGTAGAGGG + Intronic
935891470 2:107683391-107683413 TGGGAGAGAAAGGAAGTCGTGGG + Intergenic
936279018 2:111122139-111122161 CAGGAGAGAGAGGAAGTTGTTGG + Intronic
936477003 2:112848130-112848152 TAGGAAGGAAAGGAAGGAGGAGG - Intergenic
936655921 2:114487288-114487310 TGGAAGAAAAAGGAAGTATCAGG + Intronic
937082885 2:119153103-119153125 TAGGAGAGAAAGGTAGCAGAAGG + Intergenic
937118301 2:119425093-119425115 TGGGAGAGTAAGGATGGAGCCGG - Intergenic
939677043 2:145085358-145085380 TAGGACTGAGAGGAAGTGGCTGG + Intergenic
940994921 2:160138053-160138075 TGGGAGACACAGTAAGTAGCTGG - Exonic
941297954 2:163764007-163764029 CAGGAGAGAAAGGAAGAAAAAGG - Intergenic
941446255 2:165603507-165603529 GAGGAGAGGAAGGAAGTGGAAGG - Intronic
941821655 2:169849875-169849897 CAGGAGAGGAAGGAAGCAGGTGG + Intronic
941871924 2:170394708-170394730 TAGAAATGAAAGGAAGAAGCAGG + Intronic
942112685 2:172698268-172698290 GTGGAGAGAAAGGAAGGGGCAGG - Intergenic
942173835 2:173312206-173312228 TAGCAGAGAAAAGAAGTAGATGG + Intergenic
942792885 2:179780637-179780659 TTAGAGAGAAAGGAATTAGTAGG - Intronic
943120639 2:183730673-183730695 TAGGAGAGGAAGGAATTACAGGG - Intergenic
943944411 2:194041688-194041710 TGGGAGAGAAAGGCTGTAGAGGG - Intergenic
944293797 2:198039128-198039150 TAGCAGACTAAGGAAGGAGCTGG + Intronic
944377946 2:199070029-199070051 TAGGTAAGCCAGGAAGTAGCAGG - Intergenic
945042743 2:205755645-205755667 TTGGGGAGAAGGGAAGCAGCTGG + Intronic
945591466 2:211737394-211737416 TAGGAGAGACAAGAAGAAGTGGG - Intronic
946010174 2:216558136-216558158 CAGGAGAGAAGGGCAGTAGTGGG + Intronic
946135936 2:217646913-217646935 TAGGAGCAGCAGGAAGTAGCAGG - Intronic
946461103 2:219869643-219869665 TAGGAGAGAAAACAAGGAACAGG - Intergenic
946472012 2:219969286-219969308 TAGGAGAGAAAGGAAATAAGGGG + Intergenic
946510784 2:220353796-220353818 TAGCAGAGCAAAGAAGCAGCAGG + Intergenic
947151497 2:227121056-227121078 CAGGAGAGAAAGGAATGAGAGGG - Exonic
947531591 2:230912063-230912085 TGGGTGAGAAAGGAGGGAGCAGG - Intronic
947899569 2:233709871-233709893 TAGGACAGAAGGGAAGTTACTGG - Intronic
948995808 2:241577645-241577667 TGGGAGAGAAGGAAAGCAGCCGG + Intergenic
1169108514 20:3017899-3017921 AAGGAGAGAAAGGAGGTAAGTGG + Exonic
1169312730 20:4560452-4560474 AAGGAGAGAATGGGAGTAGGAGG - Intergenic
1169460498 20:5790229-5790251 TAGGGGAGGAAGGAAGTTTCAGG - Intronic
1170205211 20:13790706-13790728 TGGGAGTGAAAGGAAGAAGATGG - Intronic
1170976950 20:21173636-21173658 TATAAGAGAAAGGGAGTAGAAGG + Intronic
1171263781 20:23753898-23753920 ATGGAGTGATAGGAAGTAGCAGG + Intergenic
1172274049 20:33670222-33670244 AAGGGGAGAAGGGAAGTAGAGGG + Intronic
1172460737 20:35116453-35116475 CAGGACAGAAAGGCAGCAGCTGG - Intronic
1172602765 20:36195292-36195314 TAGGAGGGAAAGAAAGCAGCAGG - Intronic
1172837350 20:37881645-37881667 AAGGAGAAATGGGAAGTAGCGGG - Intergenic
1174197932 20:48786407-48786429 CAGGAGAGAAAGAAAGTGGCGGG + Intronic
1175109624 20:56638033-56638055 TAGGAGAGTAGGGAAGGAACAGG + Exonic
1175182565 20:57158949-57158971 AAGGAGAGAAAGCAAGTGACAGG + Intergenic
1175307863 20:57989869-57989891 GAGGAGAGAAAGAAGGTGGCTGG + Intergenic
1175962340 20:62643289-62643311 GAGGATGGAAAGGAAGGAGCAGG + Exonic
1176121177 20:63455276-63455298 AAGGAGATAAGGCAAGTAGCTGG + Intronic
1176724291 21:10417253-10417275 AAGGAGATCAAGGAAGAAGCAGG + Intergenic
1177893686 21:26836787-26836809 TAGGAAAGAAAGGAAGTTGGAGG + Exonic
1178159195 21:29892305-29892327 TAGGAGGTAAAGGAAGGAGGTGG + Intronic
1178170580 21:30035289-30035311 GGGGAGAGAAAGGAAGTGGAGGG - Intergenic
1178825620 21:36014078-36014100 TAAGAGAGAAATGAAGGAGAAGG + Intergenic
1179272555 21:39862655-39862677 CAGGAGAGAAAGGAAGAATATGG - Intergenic
1179426617 21:41284512-41284534 TAGGAAAGAAGGGAAGAGGCAGG - Intergenic
1179460922 21:41534551-41534573 TGGGAGAGAATGGAACCAGCTGG + Intergenic
1181676388 22:24456409-24456431 TGGAAGAGAAAGGATGTAGAGGG + Intergenic
1181710592 22:24684777-24684799 TCGGAGAGAAAGGTAGGAGGGGG - Intergenic
1181798739 22:25329727-25329749 TAGGTGATAAATGTAGTAGCAGG + Intergenic
1182164668 22:28161485-28161507 TAAGAAAGAAAGAAATTAGCTGG + Intronic
1182890200 22:33811814-33811836 TAGGAGACACAGGAAGGAGGAGG + Intronic
1183016145 22:34989266-34989288 GAGAGGAGAAAGGAAGCAGCAGG - Intergenic
1183771427 22:39929493-39929515 GAGGAGAGGCAGGAAGTAGGTGG - Intronic
1183815295 22:40295010-40295032 GAGGATAGAGAGGAAGCAGCTGG + Intronic
1184033297 22:41907078-41907100 CAGGAGAGAAAGAAAGCAGGTGG - Exonic
1184844292 22:47071609-47071631 AAGGAAAGAATGGAAGTAGCAGG - Intronic
949941122 3:9155540-9155562 TAAGAGACACAGGAAGTAGATGG - Intronic
950016765 3:9759926-9759948 TAAGAGAGAAAGGAAAGAGCTGG - Intronic
950902264 3:16508506-16508528 TTGGAGAGCAAGGAATTAGCCGG + Intronic
951242081 3:20298518-20298540 GAGGAGAGGAAGAAAGCAGCAGG - Intergenic
952226925 3:31386984-31387006 TAGGACATAAAGGAGGTAGCTGG - Intergenic
954495129 3:50951240-50951262 TAGGAGAGAAAGAAGGAAGGAGG - Intronic
955592392 3:60551596-60551618 GAGGAGAGGAAGAAATTAGCTGG + Intronic
955803124 3:62706441-62706463 TAGGAGAGAAAAGAACTATATGG + Intronic
956187750 3:66578792-66578814 TGGGAGAGAAGTGAAGGAGCAGG + Intergenic
956316603 3:67944535-67944557 GATGAGATAAAGGAACTAGCTGG - Intergenic
956381224 3:68666533-68666555 TAGAAGAGAAAGAAGGTAGGGGG - Intergenic
957285415 3:78211509-78211531 TGGGAGATAAAGAAAGGAGCAGG + Intergenic
957551704 3:81714003-81714025 TAGAAGAGAAAGCAAGGAGTAGG + Intronic
957758100 3:84517806-84517828 TAGTTGAGGAAGGAAGAAGCTGG - Intergenic
958529527 3:95309071-95309093 CAGCAGAGAGAAGAAGTAGCTGG + Intergenic
958889759 3:99770274-99770296 CAGGAGAGAAAGGCAGGAGAAGG + Intronic
959571690 3:107891431-107891453 ATGGAGAGAAAGGAACTTGCAGG + Intergenic
960632374 3:119744993-119745015 AAGCAGAGAAAGGAAAAAGCTGG + Intronic
961031269 3:123606038-123606060 TAGGAGATAAAGGCAGAGGCAGG - Intergenic
961530006 3:127534828-127534850 CAGGAGAAAAAGCAAGTGGCAGG - Intergenic
961924863 3:130467907-130467929 TTGGAAAGACAGGAAGTAGATGG - Intronic
962262281 3:133919531-133919553 TAGGAGATGAAGGAAATAGGTGG - Intergenic
962558531 3:136580995-136581017 TATAAGAGAAAGAAAGTATCAGG + Intronic
963841829 3:150115661-150115683 TGGGAGAGAAAGAAAGCTGCTGG + Intergenic
963912752 3:150828762-150828784 AAGGAGAGAGAGGCAGTGGCAGG - Intergenic
964212668 3:154245722-154245744 AAGGAAAGGAAGGATGTAGCAGG - Intronic
964630517 3:158804932-158804954 TGAAAGAGAAAGGAAGTAGGAGG + Intronic
966842895 3:184103853-184103875 GAGGAAAGGAAGGAAGGAGCTGG + Intronic
967113560 3:186317280-186317302 TAGGAAAGAAAAGAAGAGGCTGG - Intronic
967409058 3:189149023-189149045 TAGGAGGGATAGGACGAAGCTGG - Intronic
969134594 4:5019874-5019896 CAGGAGGGAAAGGGACTAGCAGG + Intergenic
969454875 4:7295098-7295120 GAGGAGGGAGAGGAAGGAGCTGG - Intronic
969960011 4:10935007-10935029 TAGGGGAGAGAGGAAGCAGGCGG - Intergenic
970770069 4:19601707-19601729 TAGGAGAGAAAGCAAGAAAAGGG + Intergenic
971251256 4:24975292-24975314 TAGGAGAGAAAGGGAAAAGAAGG + Intronic
971563919 4:28115511-28115533 GAGGAGAGAAAGCAAGTGTCTGG - Intergenic
971672675 4:29583291-29583313 TAGGAGAGAGAGAGAGTGGCAGG + Intergenic
971923385 4:32972867-32972889 GAGGAGAGAAAGCAAGTGTCTGG + Intergenic
972775642 4:42237428-42237450 CAGCAGAGAAAGGAAGAAGTGGG + Intergenic
973554060 4:52064423-52064445 TTGGAGGGAAAGGAAGGAGGAGG - Intronic
975772490 4:77742168-77742190 CAGGAGAGAAAGCATGTAGATGG - Exonic
976499708 4:85773570-85773592 CAGGAGAGCATGGAAGCAGCAGG - Intronic
977278201 4:95005612-95005634 TAGGAAAGAAAGGAAGGAGCCGG - Intronic
981776030 4:148368657-148368679 GTGGGGAGAAAGGAAGCAGCAGG + Intronic
983007869 4:162507564-162507586 TAGGAGATAAAGGATGTGGTAGG - Intergenic
983057114 4:163111236-163111258 GAGGAGAGGGAGGAAGTAGTGGG + Intronic
983750892 4:171268560-171268582 AAAGAAAGAAAGAAAGTAGCAGG - Intergenic
984030723 4:174600547-174600569 GAGGAGAGAATGGGAGGAGCTGG - Intergenic
984353525 4:178627206-178627228 CAGCCGAGAAAGGCAGTAGCAGG - Intergenic
984615789 4:181896009-181896031 CAGTAGAGAAAGCAATTAGCAGG - Intergenic
984685007 4:182657597-182657619 TAGAAGAGAGAGGCAGTAGGAGG - Intronic
985509280 5:303058-303080 GAGGAAGGAAAGGAAGGAGCTGG + Intronic
985738993 5:1603834-1603856 GAGGAAGGAAAGGAAGGAGCTGG - Intergenic
987694455 5:21310127-21310149 CGGGAGAGAAGTGAAGTAGCTGG - Intergenic
988857165 5:35239082-35239104 TAGAAGGGAAGGGAAGGAGCGGG + Intergenic
989313218 5:40045589-40045611 AAGAAGAGAAAGGAAGAAGAAGG + Intergenic
989447593 5:41548889-41548911 TAGGAGAGAAGGGTGGAAGCAGG + Intergenic
990019282 5:51105409-51105431 TAGGAAAAAAAGAAAGTAGAGGG - Intergenic
990382544 5:55231579-55231601 CAGGAGGGAAGGGGAGTAGCTGG + Exonic
991745788 5:69739344-69739366 CGGGAGAGAAGTGAAGTAGCTGG + Intergenic
991751918 5:69815889-69815911 CGGGAGAGAAGTGAAGTAGCTGG - Intergenic
991797388 5:70319302-70319324 CGGGAGAGAAGTGAAGTAGCTGG + Intergenic
991825166 5:70614658-70614680 CGGGAGAGAAGTGAAGTAGCTGG + Intergenic
991831205 5:70690790-70690812 CGGGAGAGAAGTGAAGTAGCTGG - Intergenic
991889731 5:71318629-71318651 CGGGAGAGAAGTGAAGTAGCTGG + Intergenic
991970551 5:72136687-72136709 TTGGAGGGAAAGGGAGTGGCTGG - Intronic
991970953 5:72141187-72141209 GAGGAAAGAAAGAAAGAAGCTGG - Intronic
993900304 5:93580158-93580180 TAGGAGAGAGAGGGAATAGCGGG + Intergenic
995121109 5:108536071-108536093 GAGGAGAGAAGAGAAGCAGCTGG + Intergenic
995847181 5:116506662-116506684 TAGGAGAGAAAGCATCTGGCGGG + Intronic
995963622 5:117876176-117876198 TATTAGATGAAGGAAGTAGCTGG + Intergenic
996403365 5:123086051-123086073 TGGGAGGGGAAGGATGTAGCTGG - Intergenic
997439547 5:133899547-133899569 GAGGGGAGAAAGAAAGTACCAGG - Intergenic
997822849 5:137081534-137081556 TAGGGGAGAAAGGAAGAAATTGG - Intronic
997881449 5:137594994-137595016 TATAAGAGAAAGGCAGTGGCAGG + Intronic
997901225 5:137766750-137766772 GAGGAAAGAAAGGAAGAAGAAGG + Intergenic
997984170 5:138490426-138490448 TCGAAGAGAAAGGAAATCGCTGG + Intergenic
998773547 5:145573040-145573062 TAGGATATAGAGGGAGTAGCAGG + Intronic
998810811 5:145964126-145964148 AAGGAAAGAAAGGAAGAGGCCGG - Intronic
999374400 5:151076704-151076726 GAGGTGAGAAAGGAAGAACCCGG + Intronic
999483792 5:151972719-151972741 AATGAGAGAAAGGAAGGTGCAGG + Intergenic
999613701 5:153399354-153399376 TAGGAGACAAATGTAGTAGCAGG - Intergenic
1000168816 5:158681567-158681589 AAGAAAAGAAAGGAAGTTGCCGG + Intergenic
1000261768 5:159595265-159595287 AAAGAGAGAATGGAAGTAGTTGG + Intergenic
1000543432 5:162569464-162569486 TAGGAGCGAAAAGAAGAGGCAGG - Intergenic
1000713906 5:164616041-164616063 AAGAAGAGAAAGAAACTAGCAGG + Intergenic
1001451207 5:171825935-171825957 TAGGAGAAGAAAGAAGTAACAGG - Intergenic
1001806511 5:174591355-174591377 AAGGAGAGGAAGGCAGGAGCAGG - Intergenic
1002155336 5:177273814-177273836 TAGAAGAGAAATGGAATAGCTGG + Intronic
1003575688 6:7292405-7292427 TAGGAGTAAAAGGGAGTAGAAGG - Intronic
1004131215 6:12921663-12921685 GAGGAGGGAAAGGAAGAAGGAGG + Intronic
1004330870 6:14719514-14719536 TGGGAGAGGAAGGAAGGGGCGGG - Intergenic
1005194454 6:23266707-23266729 TCTGAGGGAAAGGAAGCAGCTGG + Intergenic
1005291487 6:24383963-24383985 GAGAAGAGAAAGGAAGAAACAGG + Intergenic
1005403861 6:25464532-25464554 TAGAAGAGAAAGGCAGAAGGTGG - Intronic
1005556452 6:26989808-26989830 CGGGAGAGAAGTGAAGTAGCTGG + Intergenic
1005939420 6:30549782-30549804 TAGGAGAGAAAGGAAATAGTTGG - Intronic
1006023215 6:31130182-31130204 AAGGATAGAAAGGAAGAAGGAGG - Intronic
1006276190 6:33007217-33007239 TAGGAGAGAAAGGAAGGAGTTGG + Intronic
1006592993 6:35171785-35171807 AAGAAGAGACAGGAAGTAGAGGG + Intergenic
1007056746 6:38893373-38893395 TAGAAGAGAAGGAAAGAAGCAGG + Intronic
1007673915 6:43579463-43579485 TAGGAGCAAAAGGAAGTTCCTGG + Intronic
1007733798 6:43967935-43967957 AAGGAGAGAAAGCAAGCAACAGG + Intergenic
1008593631 6:53018807-53018829 TAAGAGAGAAAGGAAGAGGGAGG + Intronic
1008623113 6:53291364-53291386 TAGGGGAGGAAGGAAGTGGGTGG - Intronic
1008728199 6:54447119-54447141 TAGGAGAGGAAGGGGGTGGCTGG + Intergenic
1009749452 6:67864743-67864765 AGAGAGAGAAAGGAAGAAGCTGG - Intergenic
1009836638 6:69009539-69009561 TTGGAGAGACAGGAAGTGGCTGG + Intronic
1009937774 6:70253838-70253860 TAGGAGAAAAAGGAAATGGTAGG + Intronic
1011219774 6:85042038-85042060 GAGAAGAGAAAGGAAGAGGCAGG - Intergenic
1011799730 6:90998752-90998774 TGGGAGAGCAAGGAAGCAGGAGG - Intergenic
1012951708 6:105524943-105524965 TAGAGGTGACAGGAAGTAGCTGG + Intergenic
1013343845 6:109240519-109240541 CAGGAGAGCAAGGAAGAAACTGG - Intergenic
1013665101 6:112339639-112339661 TAGGAGAAAATGGAATCAGCTGG - Intergenic
1013847504 6:114471762-114471784 GAGGAGAGAAAGTAAGCATCTGG - Intergenic
1013868947 6:114733515-114733537 TAGGAGAAAATAGAAGCAGCAGG + Intergenic
1015465142 6:133540918-133540940 GAGGAGAGAAAGTAACTAGAAGG - Intergenic
1015606797 6:134965410-134965432 TAGGAAAGGAAGAAAGTTGCAGG - Intronic
1016737279 6:147492872-147492894 TAGAGGAGAAAGGAAGAAGCTGG - Intergenic
1016878746 6:148889488-148889510 TGGGAGAAAAAGGAAGTCACTGG - Intronic
1017041086 6:150309152-150309174 CAGGAAAGAAAGGAAGGAGGAGG + Intergenic
1017125620 6:151061545-151061567 TAGGAAAGAAATAATGTAGCAGG - Intronic
1017265397 6:152439769-152439791 TAGTAGAGAAATGAACTAACCGG - Intronic
1017357672 6:153528770-153528792 GAGGAGACAAAGGAAGGAGCAGG + Intergenic
1017624527 6:156334784-156334806 TATGAGAGAAGGGATGTTGCAGG - Intergenic
1018593468 6:165453377-165453399 AAGTAGAGACAGAAAGTAGCAGG + Intronic
1018682680 6:166277005-166277027 AAAGAGAGAAATGAAGAAGCAGG + Intergenic
1018714537 6:166521491-166521513 TAGGAAAGAAAAGGAGTAACAGG - Intronic
1018845953 6:167555912-167555934 AAAGAGAGAATGGAATTAGCAGG - Intergenic
1020564622 7:9779345-9779367 TAGATCAAAAAGGAAGTAGCTGG - Intergenic
1020826864 7:13039652-13039674 TTGGAGAGGAAGGAACTACCTGG - Intergenic
1023444672 7:40218960-40218982 AAGGAGCGAAAGAATGTAGCTGG - Intronic
1024800119 7:53067330-53067352 TAGGAGAGAGAGGAAGAACAGGG + Intergenic
1025108421 7:56192443-56192465 GAGGAGAGAAAGGAAGGGGAAGG - Intergenic
1026040458 7:66864065-66864087 AAAGAGAGAAAGAAAGAAGCAGG - Intergenic
1026309845 7:69173957-69173979 GAGGAGAGAAAGGAAGGGGAGGG + Intergenic
1026930466 7:74220548-74220570 CAGGGGAGAAAGCAATTAGCTGG + Intronic
1027047695 7:75002033-75002055 GATGAGGGAAAGGAAGTGGCTGG + Intronic
1027999145 7:85468653-85468675 TAGGAGGGAAAGGGTGGAGCTGG + Intergenic
1028126286 7:87116602-87116624 TAGGAGAGTTAGGGTGTAGCAGG - Intergenic
1029311144 7:99666116-99666138 TTGGAGGAAAAGGAAGTAGTGGG + Intronic
1029385302 7:100239607-100239629 GATGAGGGAAAGGAAGTGGCTGG - Intronic
1029926427 7:104324002-104324024 TAGGAGAGAATCCAAGTAGTGGG + Intergenic
1030613881 7:111717487-111717509 TGTGAGAGAAGGGAAGTAGCAGG + Intergenic
1031423573 7:121579040-121579062 TAAAAGAGAAAGGAGGTAGTTGG - Intergenic
1032115757 7:129115829-129115851 CTGGAGAGAAAGGAAAGAGCTGG - Intergenic
1032662572 7:134001614-134001636 TAGCAGAGAATGGAAGCAACTGG - Intronic
1034119874 7:148617487-148617509 AAGGAGAGAAAGGAAAAAGAAGG + Intergenic
1034613519 7:152394164-152394186 AAGGAGATCAAGGAAGAAGCAGG - Intronic
1035201942 7:157273310-157273332 TGGGGGAGAAAGGAAGTAATAGG - Intergenic
1035276390 7:157750482-157750504 TATGAGAGGCAGGAAGTGGCAGG + Intronic
1035419682 7:158717224-158717246 TAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035692603 8:1569999-1570021 GAGGAGAGAAAGGAAGAAAACGG + Intronic
1036194716 8:6704119-6704141 TAGGTGACAAAGCAAGTTGCTGG - Intergenic
1036497629 8:9283843-9283865 TGGGAGGGAGAGGAAGAAGCTGG - Intergenic
1036572834 8:9997087-9997109 GAGAAGGGAAAGGAAGCAGCAGG - Intergenic
1036648442 8:10626264-10626286 CAGGAGAGAATGCAAGTGGCAGG + Intronic
1037675711 8:21049254-21049276 TAGGAGAGGAAGGAGTTAACAGG - Intergenic
1038535334 8:28349381-28349403 CAGGAGAGTGAGGAAGGAGCAGG + Intronic
1039173093 8:34771278-34771300 TAGGAGAGAAAAGAATAATCTGG - Intergenic
1039216286 8:35275240-35275262 TAGGAAAGATAGGAAATAGGTGG - Intronic
1039361472 8:36881904-36881926 TAGGAGAGAAGGTAAGAATCTGG - Intronic
1040859434 8:51984009-51984031 CTGGAGAGAAAGGAAGTTGTGGG - Intergenic
1041073008 8:54143539-54143561 TAGGACAGACTGGCAGTAGCTGG - Intronic
1041617320 8:59922559-59922581 GAGGAGAGAAAGGAGGTAAAAGG + Intergenic
1041720998 8:60975110-60975132 AAGGAGGAAAAGGAAATAGCAGG + Intergenic
1041973292 8:63768046-63768068 GAGAAGGCAAAGGAAGTAGCTGG - Intergenic
1042170443 8:65985814-65985836 GAGGAGAGAGAGGAAGAGGCAGG - Intergenic
1042852363 8:73228424-73228446 AAGCAAAGAAATGAAGTAGCAGG + Intergenic
1043037607 8:75217729-75217751 TTTGAGAGAAAGGTATTAGCAGG + Intergenic
1043095337 8:75962362-75962384 TGGAAGAGAATGGTAGTAGCTGG + Intergenic
1043285825 8:78529227-78529249 TTGCAAAAAAAGGAAGTAGCAGG - Intronic
1044330254 8:90911252-90911274 TAGGAGAGAAAGGAAGAAAGAGG + Intronic
1045215392 8:100144389-100144411 TAGCAGAGAAAGGACGTTGGAGG - Intronic
1046673892 8:117087931-117087953 GAGGAAAGAAAGAAAGTAGGCGG + Intronic
1046904541 8:119558409-119558431 GAGGAGAGGAGGGAAGAAGCGGG + Intronic
1047536974 8:125728910-125728932 CAGGAGGGAAAGGAAGCCGCTGG - Intergenic
1048179207 8:132179995-132180017 GAGGAGAAACAGGAAGTGGCGGG - Intronic
1048511825 8:135069934-135069956 TAGCAGAGAGGGGAAGCAGCTGG + Intergenic
1048518903 8:135136069-135136091 TAGGAGAACAAGAAAGTAGAGGG + Intergenic
1048529414 8:135234076-135234098 GAGGAGAGGAAGGAAGGAGTGGG - Intergenic
1048829636 8:138463661-138463683 AATGAGAAAGAGGAAGTAGCTGG + Intronic
1048862054 8:138730831-138730853 TAGGAGAGGAAGGAAGCCACAGG + Intronic
1049118296 8:140709817-140709839 AAGGAGAGAAAGGAAGACACTGG + Intronic
1049517607 8:143069725-143069747 GACTAGTGAAAGGAAGTAGCTGG - Intergenic
1050943622 9:11490320-11490342 TAGACATGAAAGGAAGTAGCTGG + Intergenic
1051986245 9:23091097-23091119 TAGAAGAGAAAGAAAGAAGAAGG + Intergenic
1052438993 9:28468454-28468476 CAGGAGAGAGGGGAAGTTGCAGG + Intronic
1053164393 9:35834430-35834452 CAGGAGAGAGAGAAAGGAGCAGG - Intronic
1053201603 9:36155740-36155762 TAGGAGAGAGAGGAAGAGACTGG - Intronic
1056245285 9:84688602-84688624 GAAGAGAGAAAGGAGGAAGCTGG - Intronic
1056278257 9:85014231-85014253 TAGAAGAGAAGGGAAGAAGATGG + Intronic
1056525019 9:87435088-87435110 TAAGAGAGAAAGGAAGGAAAGGG + Intergenic
1056618183 9:88186697-88186719 TGGGAGAGAAAAGAAGGAGAAGG + Intergenic
1057708597 9:97416770-97416792 TAGGAGAGAAAAGGAGTGGTAGG + Intronic
1058287576 9:103198643-103198665 TAGGAGAGAAAGAGAGAAGGAGG + Intergenic
1058570661 9:106339457-106339479 TAAAACAGAAAGGAATTAGCAGG - Intergenic
1060140780 9:121208243-121208265 TAGGAGAGAAGAGAAGGACCAGG - Intronic
1060983798 9:127808534-127808556 TAGGGGAGACAGGCAGGAGCGGG - Intronic
1061149471 9:128820712-128820734 TAGGAGAGATAGGGCTTAGCAGG - Exonic
1061705203 9:132447800-132447822 GAGTACAGAGAGGAAGTAGCAGG - Intronic
1185485982 X:481985-482007 AAGGAGAGGAAGGAAGGAGATGG + Intergenic
1186711493 X:12202564-12202586 CATGGGAGAAAGGAAGTAGGAGG + Intronic
1186899998 X:14043836-14043858 CAGGGGAGAAAGGAAGGAGAGGG + Intergenic
1187413252 X:19069628-19069650 GAGGAGAGAAGAGAAGTAGCCGG + Intronic
1187500019 X:19832130-19832152 TAGGGCAGAAAGGATGTAGCAGG - Intronic
1187612120 X:20954358-20954380 AAGGAGGTAAAGGAAGTATCTGG - Intergenic
1187705543 X:22006106-22006128 TAGGAGAACCAGGAAGGAGCTGG - Intergenic
1188005850 X:25015428-25015450 TTGGAGAGGAAGGAAGGAGAGGG - Intronic
1188761174 X:34032069-34032091 TAGGGGGGAAAGGAAGGAGGGGG - Intergenic
1189022505 X:37355606-37355628 CAGGAGAGAATGGAATTAGTAGG + Intronic
1190406983 X:50098064-50098086 TGGGAGAGAAAGGAAGAAGAGGG - Exonic
1190427192 X:50345005-50345027 GAGGAGAGGAAGGCAGGAGCTGG - Intronic
1190439536 X:50463456-50463478 GAGGAGAGGAAGGTAGGAGCAGG - Intronic
1192082523 X:68062149-68062171 TAGGATAGCAAGGAAATGGCAGG - Intronic
1192564027 X:72147752-72147774 TAGGAGGAGAAGGAAGTAGGAGG - Intergenic
1194488658 X:94518854-94518876 GAGGAGAGGAAGCAAGTATCAGG + Intergenic
1194975595 X:100393437-100393459 AAGGAGAGAGAGAAAGAAGCAGG - Intronic
1195557200 X:106240806-106240828 TAAGAGAGAGAGGAAGAAGTGGG + Intergenic
1195701195 X:107706993-107707015 AAGGAAGGAAAGGAAGGAGCCGG + Intergenic
1196396763 X:115272098-115272120 TAGGAGAGAAAGGTGGTAATTGG - Intergenic
1196753974 X:119141854-119141876 TAGGAGATGAAGGAAGTAGGTGG + Intronic
1196811058 X:119629306-119629328 GAGAAGAAAAAGTAAGTAGCAGG - Exonic
1197736479 X:129853145-129853167 GAAGAGAGAAAGGAAGTAAGAGG - Intergenic
1199284597 X:146042085-146042107 TAAGAGAGAATAGAAGGAGCAGG + Intergenic
1199729867 X:150621341-150621363 TAGAAAAGAGAGGAAATAGCTGG - Intronic
1201387734 Y:13461176-13461198 AAGGAGAGAAAGGAAAGAGAAGG + Intronic