ID: 1117685183

View in Genome Browser
Species Human (GRCh38)
Location 14:58245502-58245524
Sequence TTGTATAGGAAAAACGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 305}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117685183_1117685187 25 Left 1117685183 14:58245502-58245524 CCTTTCTCGTTTTTCCTATACAA 0: 1
1: 0
2: 0
3: 16
4: 305
Right 1117685187 14:58245550-58245572 TTATTCCGTAAACGTTTAAATGG 0: 1
1: 0
2: 0
3: 2
4: 104
1117685183_1117685185 -1 Left 1117685183 14:58245502-58245524 CCTTTCTCGTTTTTCCTATACAA 0: 1
1: 0
2: 0
3: 16
4: 305
Right 1117685185 14:58245524-58245546 AATTACCTAACAGCGCTTGTAGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117685183 Original CRISPR TTGTATAGGAAAAACGAGAA AGG (reversed) Intronic
901239912 1:7686840-7686862 TTGAATATGAAGAACGAGAGAGG + Intronic
902169873 1:14601007-14601029 TTGTGTAGGAAAAAAGAACAAGG - Intronic
903264438 1:22149059-22149081 TTGTATGGGTGAAACGAAAAGGG - Intergenic
904724744 1:32538947-32538969 TTGAATAGGAAAACCCAGAGAGG - Intronic
904993009 1:34608879-34608901 TTGAATAGGAATAAGGAAAACGG - Intergenic
905716779 1:40159163-40159185 TAGTATAGGAAATAGGAAAATGG - Intergenic
906111456 1:43325072-43325094 TTATATAGGAAAAACAGTAAAGG + Intergenic
906874096 1:49516996-49517018 TTGTATAGGAATAATGTAAACGG - Intronic
906971059 1:50514064-50514086 TTGTATGGGAAAAACAAATATGG + Intronic
906992026 1:50749335-50749357 TCTTAAAGGAAAAACAAGAAGGG + Intronic
906998930 1:50829698-50829720 TGGAATAGGAAAAAAGAGAAGGG - Intronic
908195070 1:61740255-61740277 TTAAATAGGAAAAAAAAGAAAGG - Intergenic
908917470 1:69146413-69146435 TTATAAAGGAAAAAAGAGATTGG + Intergenic
910089571 1:83446160-83446182 TTGCAGAGGAGAAATGAGAATGG + Intergenic
911298750 1:96148900-96148922 TCTTATAGGACAAACTAGAAAGG - Intergenic
911887254 1:103319549-103319571 TTGCCTAAGAAATACGAGAATGG + Intergenic
912297423 1:108483959-108483981 TTGTATATGAAAAATCAGAGTGG + Intergenic
913356472 1:117928531-117928553 GTGTATTGGATAAATGAGAAGGG - Intronic
915878008 1:159633441-159633463 TTTTAAAGGAAGAATGAGAAGGG - Intergenic
915909982 1:159908917-159908939 CTGTCTAAGAACAACGAGAAAGG + Intergenic
916003763 1:160640777-160640799 TTGTTGAGGAAAAGTGAGAAAGG + Intronic
918053252 1:180993633-180993655 TTGAATAGGAGGAAAGAGAAAGG + Intronic
918422684 1:184379991-184380013 TTGTATTATAAAAAGGAGAAAGG - Intergenic
918690907 1:187478220-187478242 TTGTGTAGGAAAAACAAATAGGG - Intergenic
920646729 1:207809192-207809214 TTGCATATAAAAAAAGAGAAAGG - Intergenic
921254951 1:213330660-213330682 TTGTATGAGTAAAATGAGAAGGG - Intergenic
922023953 1:221733299-221733321 GTGTATAGGAGAAAGGAGAAGGG - Intronic
922029827 1:221787209-221787231 TTGGAAAAGAAAAAAGAGAATGG + Intergenic
924326355 1:242898218-242898240 TTGAATAGGAATGGCGAGAATGG + Intergenic
924723695 1:246647071-246647093 TTGTATAGGAAGGAAAAGAAGGG - Intronic
1063741112 10:8821281-8821303 TTGTAGAGGAAAAACAAACAGGG - Intergenic
1064359092 10:14647135-14647157 TTCTGTGGGAAAAACGTGAATGG - Intronic
1065216280 10:23451832-23451854 TTCTAAAAGAAAAACAAGAAGGG - Intergenic
1065799529 10:29339065-29339087 TCGAGTAGGAAAAACAAGAAAGG + Intergenic
1066232694 10:33452793-33452815 TTTTTTTGGAAAAACAAGAATGG - Intergenic
1068357375 10:55927261-55927283 TTGTATAGGAAAAACAAAACAGG - Intergenic
1069011631 10:63380438-63380460 TTGAATGGGATAAACGAGAGTGG - Exonic
1069203291 10:65650820-65650842 TTGTTTAGGAATAAGGAAAAAGG - Intergenic
1069439337 10:68413555-68413577 TTAGATAGGACAAACGGGAAAGG - Intergenic
1070622755 10:78026369-78026391 TTGTGAAGGAAAAATGAGAGAGG - Intronic
1071719553 10:88129806-88129828 TTTTATAGGAACCACGAGTATGG + Intergenic
1072818109 10:98529773-98529795 TTGTGCAGGAGAAAAGAGAAGGG - Intronic
1073370193 10:102981376-102981398 TAATATAGGAAAAAAGAGGAAGG - Intronic
1074762653 10:116678483-116678505 TTGTGAAGGAAAAACCAGGAGGG + Intronic
1079679952 11:23283210-23283232 TTGTATAGTATAATGGAGAATGG - Intergenic
1082649635 11:55773368-55773390 CTGGATAGGAAAAAAGAGATAGG - Intergenic
1082690961 11:56304111-56304133 TTGAATAGGAGTAACGAGAGTGG + Intergenic
1084762863 11:71284919-71284941 CTTTCTAGGAAAAAGGAGAAGGG + Intergenic
1085211269 11:74781341-74781363 TTGTGTATGAAAAACTATAAAGG - Intronic
1086457076 11:86969537-86969559 TTGAAAAGGAAGAAGGAGAAAGG - Intergenic
1087349764 11:97016982-97017004 ATATATAGGAAAAATTAGAAGGG + Intergenic
1087445871 11:98252725-98252747 TTGGATAGGATAAAAGAGTAAGG + Intergenic
1087530755 11:99378629-99378651 TAGTATAAGAAAATCAAGAAAGG - Intronic
1088042773 11:105407746-105407768 GTGTAGAGGAAAACAGAGAATGG + Intergenic
1088806866 11:113360531-113360553 TTGAATAAGAAAACTGAGAAAGG + Intronic
1089873728 11:121699874-121699896 TTGTAAAGGAAAAAAAAAAAAGG - Intergenic
1090958688 11:131536851-131536873 TTGCGTAGGAAAAGGGAGAAAGG + Intronic
1092516128 12:9215487-9215509 TTGTATAAAAAGAAAGAGAAAGG - Intergenic
1093677011 12:21954322-21954344 TTGAATAGGAATAATGAGAGTGG + Intergenic
1093821807 12:23628629-23628651 TTGGATAAGAAAAAGGAGTACGG + Intronic
1097428113 12:59472005-59472027 TCTTATAGGATAAACTAGAAAGG - Intergenic
1098464959 12:70776109-70776131 GTGGATAGGAAGAAGGAGAAAGG - Intronic
1098514309 12:71356544-71356566 TAGTAATTGAAAAACGAGAAAGG + Intronic
1098829335 12:75341104-75341126 TTTTCTAGGAAAAAAGAAAAAGG - Intronic
1098843970 12:75512516-75512538 TTGTATAAGATACACGAGAGTGG - Intergenic
1099600686 12:84733365-84733387 TTGTATAGAAATAAAGATAATGG - Intergenic
1099752904 12:86801154-86801176 TTGTTTAGGAAAGAAGAGAATGG + Intronic
1099896000 12:88647679-88647701 CTGTATAGAAAAAAAGAAAACGG - Intergenic
1101055874 12:100912802-100912824 TTGTATGGAAAAAGCGACAAGGG + Intronic
1101220635 12:102635564-102635586 TGCTATAGGAAAACTGAGAAGGG - Intergenic
1102558372 12:113744210-113744232 GTGTATAGGAAAAAACAGTACGG - Intergenic
1102614434 12:114140918-114140940 TTGTAAAGGAAAATAGATAAGGG - Intergenic
1102868577 12:116394100-116394122 GTGAATAGGAAAAAACAGAAAGG + Intergenic
1104558182 12:129821026-129821048 TTATATAGGAGAAAGGAGGAGGG - Intronic
1105799006 13:23887245-23887267 TTGAATAGGTAACAAGAGAATGG - Intronic
1106700715 13:32225403-32225425 TTGTAGAGCAAAAATGGGAAGGG + Intronic
1106741689 13:32650582-32650604 ATGTTTAGGAAAAACCACAAAGG - Intronic
1106808315 13:33334198-33334220 TTGTTGAGGAAATACAAGAATGG - Intronic
1107196033 13:37652620-37652642 TTGTCTAGAAAGAAAGAGAAAGG - Intronic
1107268448 13:38585245-38585267 TTGTATAGTATCACCGAGAATGG + Intergenic
1108040047 13:46331486-46331508 TTGTAGTGTAATAACGAGAAAGG - Intergenic
1108214522 13:48171258-48171280 TTGAATAGGAGAGATGAGAAGGG + Intergenic
1108221408 13:48237040-48237062 GTGAATAGGGAAAACCAGAAAGG - Intronic
1109487425 13:63045306-63045328 CTGTAAATGAAAAAAGAGAAAGG - Intergenic
1110840902 13:80141800-80141822 TTCAAAAGGAAAAACAAGAATGG + Intergenic
1111116138 13:83780015-83780037 CTGCATAGGAAAAAGGAGATGGG - Intergenic
1114136224 14:19854982-19855004 ATGTAGAGAAAAAAGGAGAAAGG - Intergenic
1114970552 14:28022066-28022088 TTGTATATCTAAAATGAGAAAGG + Intergenic
1116135075 14:40912777-40912799 TTGTCTATGAAAGAAGAGAATGG - Intergenic
1116683211 14:48003702-48003724 TTGTATATGAAAAACTATAAAGG + Intergenic
1117685183 14:58245502-58245524 TTGTATAGGAAAAACGAGAAAGG - Intronic
1120360315 14:83493101-83493123 TTGTATACGTAAAACAAGAAAGG + Intergenic
1120571470 14:86122534-86122556 TTATATATGAAAAAAGAAAATGG + Intergenic
1124061955 15:26301603-26301625 TTGTATAGGAAAAGCAGGATAGG + Intergenic
1125415542 15:39448431-39448453 TGGCATAGGAAAAATGACAAGGG - Intergenic
1126557151 15:50001835-50001857 TTTTATAGGGAAAATGAGAGGGG - Intronic
1126915452 15:53461176-53461198 TTGTAGAGGAAAAAGAAGACTGG + Intergenic
1127515201 15:59687055-59687077 ATTTAGAGGAAAAACTAGAATGG + Intronic
1129368931 15:75075519-75075541 TTGTATAAGAAAAAGTAAAATGG + Intronic
1133068692 16:3230661-3230683 TTGCAAAGGAAAAACTATAACGG - Intronic
1133611517 16:7438158-7438180 TTATATAAGAAAAATCAGAATGG + Intronic
1136129954 16:28213391-28213413 TTGAATAGGAATGATGAGAAAGG + Intergenic
1137038280 16:35586277-35586299 ATGTATAGGACAAAGGAAAAAGG + Intergenic
1137542004 16:49370009-49370031 TTGCATAGCAGAAACCAGAAAGG + Intergenic
1138658252 16:58502881-58502903 TTGCAAAGGAACAGCGAGAAGGG + Intronic
1138724579 16:59121691-59121713 TTGTTGAGGAAAAAAGGGAATGG - Intergenic
1139392983 16:66617345-66617367 TGGAGTAGGAAAAACTAGAAAGG + Exonic
1139738999 16:69018583-69018605 ATGCATAGGAAAAAAGAGAAAGG - Intronic
1141258425 16:82426684-82426706 TTTTCTATGAAAAATGAGAAAGG + Intergenic
1141278951 16:82613379-82613401 TTGTAAAAGAAAAATGAGACCGG + Intergenic
1142553845 17:758633-758655 ATGTATAAAAAAAAAGAGAAGGG + Intronic
1144722464 17:17480978-17481000 TGGTATAGGAAAAACATGTAAGG + Intronic
1147221557 17:38935352-38935374 ATGTATAGGAAAAAAGAGAGGGG + Intergenic
1147592117 17:41690335-41690357 TTTTATAGGAAAAAGCAGAAGGG + Intronic
1147855224 17:43474761-43474783 TTGTATCAGGAAAAAGAGAAGGG + Intergenic
1149223341 17:54440196-54440218 TTTTATAGGAGAAACTAGAAGGG - Intergenic
1150749889 17:67850998-67851020 TTGTAATGGAAAGAGGAGAAGGG + Intronic
1150867924 17:68873993-68874015 TTGTGTAGGAAAAAAGGGTAAGG + Intronic
1152440742 17:80307923-80307945 ATGTATAGGAAAAAAGATCAGGG - Intronic
1153106308 18:1531793-1531815 TGGTCTAGGAACAATGAGAAAGG + Intergenic
1153970331 18:10220424-10220446 TTGCCTTGGAAAAACAAGAAGGG - Intergenic
1154510175 18:15090963-15090985 TTTTAGAGGAAAAAGCAGAAGGG + Intergenic
1156907081 18:42366306-42366328 TTGTGAAGATAAAACGAGAAAGG - Intergenic
1158158827 18:54456801-54456823 TTAAATAGGAAGAACGACAAGGG - Intergenic
1159093346 18:63873621-63873643 TTGTATAGGTAAAACAAGAGAGG - Intronic
1159461670 18:68728848-68728870 TAGTAAAAGAAAAAAGAGAAAGG + Intronic
1168541420 19:57214271-57214293 TTGAATAGGAATAGTGAGAAAGG + Exonic
925021357 2:571616-571638 TTGTATATGGCAAAAGAGAAGGG - Intergenic
925284231 2:2705467-2705489 TTGGATGGGAAAAAGGAGAAGGG + Intergenic
926534807 2:14098686-14098708 TTCTGTAGGAAAAGGGAGAATGG - Intergenic
928861398 2:35861564-35861586 TTCTAGAGGAAAAAGTAGAAGGG - Intergenic
930622760 2:53661324-53661346 TGGTAAAGGAAAGAAGAGAACGG - Intronic
931036881 2:58253730-58253752 TTGTTTAAGAAAAAGGAAAAAGG + Intergenic
933214882 2:79618609-79618631 TTGGAGAAGAAAAACAAGAATGG - Intronic
933405001 2:81846749-81846771 ATGAAAAGGAAAAAGGAGAATGG - Intergenic
933502588 2:83133974-83133996 TTGTATAAGATGAACAAGAATGG - Intergenic
933593043 2:84253828-84253850 TTTCATATGAAAAACGAGTATGG + Intergenic
933712236 2:85334970-85334992 TAGTATAGGGAAAGTGAGAATGG + Intergenic
934682462 2:96294642-96294664 TTGTCTGGGAAAAGCAAGAAAGG - Intronic
934769564 2:96899201-96899223 TTGTACTGCAAAAAGGAGAAAGG - Intronic
934866899 2:97822145-97822167 TCTTATAGGAGAAACTAGAAAGG - Intronic
936559871 2:113528027-113528049 TGGTGCAGGAAAAAGGAGAAAGG + Intergenic
938505397 2:131875401-131875423 TTTTAGAGGAAAAAGCAGAAAGG + Intergenic
939148584 2:138446207-138446229 TTGTTGAGGAAACACAAGAAAGG + Intergenic
939198469 2:139003231-139003253 TTGTCTAGGAAAGTCTAGAAGGG + Intergenic
941131479 2:161655397-161655419 TTGAATAGAAATGACGAGAATGG + Intronic
941446867 2:165612031-165612053 TTTTATAGAAAAAAAGATAAAGG - Intronic
941535774 2:166721134-166721156 TGGTGTAGGAAAAAGGAGGAGGG - Intergenic
942353107 2:175075789-175075811 CTGCAGAGAAAAAACGAGAATGG - Intronic
942405932 2:175655030-175655052 TTGAATAGGAATAGTGAGAAAGG - Intergenic
942638924 2:178039910-178039932 TTGTATAGGAAAACAAAGATAGG + Intronic
943377485 2:187097692-187097714 TTGTATAGTAAAGAGGAAAATGG - Intergenic
944294878 2:198050734-198050756 TTTTAGGGGAAAAACTAGAAGGG - Intronic
945552815 2:211241930-211241952 TTGAATAGTATAAACTAGAAAGG + Intergenic
945876979 2:215288036-215288058 TTGAGTGGGAAAAAGGAGAAGGG + Intergenic
946658579 2:221975666-221975688 TTGGAGAGGAAAATTGAGAATGG - Intergenic
948181375 2:235983415-235983437 TCTTACAGGAAAAAGGAGAATGG - Intronic
948246599 2:236491569-236491591 TTGTGTTGGAAAATGGAGAAGGG - Intronic
948923557 2:241079465-241079487 TTGTGTAGGAAAATGGAGAAGGG + Intronic
1169050225 20:2570086-2570108 TTGAATAGGAGAAGTGAGAATGG - Intronic
1169491746 20:6076949-6076971 TTTTATAGAAAAAACAAGAGAGG + Exonic
1169683548 20:8244502-8244524 TTGTATATGAAATTCAAGAAAGG + Intronic
1169727900 20:8755815-8755837 TTGTAAAGGATAAATGAGGAGGG + Intronic
1169949621 20:11029027-11029049 GAGTATAAGAAAAAGGAGAAAGG - Intronic
1170782041 20:19434619-19434641 ATGTAGAGAAAAAAAGAGAATGG - Intronic
1171779582 20:29407356-29407378 TTCTAAAGGAAGAAAGAGAAAGG + Intergenic
1172038690 20:32028773-32028795 TAGTAGAGGAAGAAGGAGAAGGG + Intronic
1173220221 20:41126234-41126256 TTGTTTGGGAAAAAAGGGAAAGG - Intergenic
1174918668 20:54679411-54679433 TTGCATAGGCAAAGCGAGGAAGG + Intergenic
1176813611 21:13572840-13572862 ATGTAGAGAAAAAAGGAGAAAGG + Intergenic
1177132773 21:17278062-17278084 ATGTGTAGGAGAAACCAGAAAGG + Intergenic
1177624146 21:23637074-23637096 TTGTATATGAAAATAGATAAGGG + Intergenic
1177986862 21:27986924-27986946 TTTTGGAGGAAAAAGGAGAAGGG - Intergenic
1180978458 22:19865747-19865769 TTATTTAGGAAAATAGAGAAGGG - Intergenic
1182533078 22:30977015-30977037 AAGTATAGGAAAAACCAGAGAGG - Intergenic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
1184288057 22:43483192-43483214 TTTTAGAGAAAAAACGAGACAGG + Intronic
1184980226 22:48090411-48090433 TTGTAAAAGAAGAATGAGAATGG + Intergenic
950233131 3:11294124-11294146 TTGTAGAGGAAAAGAGGGAAAGG + Intronic
951149586 3:19272793-19272815 TGCTATAGGAAAAAAGAAAAAGG - Intronic
951249083 3:20373174-20373196 TTGGATAGGAGGAAAGAGAAGGG + Intergenic
951673164 3:25207577-25207599 TAGTATAGAAAAAATGAGGAGGG - Intronic
951691515 3:25401377-25401399 TTGTATATGAAAAATTATAAAGG - Intronic
952971583 3:38654184-38654206 GGGTATAGGAAAAACTGGAAAGG - Intergenic
954559413 3:51543728-51543750 TGGCAGAGGAAAAACTAGAAAGG - Intronic
955813803 3:62820740-62820762 TTGTCTAGTAAAGAGGAGAAAGG - Intronic
958824458 3:99013726-99013748 TTGGAGAGGAATAACTAGAAAGG - Intergenic
959511892 3:107222942-107222964 TTTTATAAGAAAAATCAGAAAGG + Intergenic
959650071 3:108742957-108742979 ATGTATTGGCAAAAAGAGAAAGG - Intergenic
959783560 3:110265917-110265939 ATGTAAAGGAAAAAACAGAATGG - Intergenic
960751823 3:120963313-120963335 TTGAATAGGAATAGTGAGAAAGG + Intronic
962933014 3:140054794-140054816 TGGGGTAGGAAAAAGGAGAAGGG + Intronic
963100037 3:141592614-141592636 TTCTAGAGGAGAAAAGAGAATGG + Intronic
963386484 3:144601179-144601201 ATGTATAAGACAAAAGAGAATGG - Intergenic
963590204 3:147247687-147247709 TTTTTTAGGAAGAACTAGAAAGG - Intergenic
964814709 3:160704386-160704408 TGGTATAGGAAATATTAGAATGG + Intergenic
965340008 3:167478579-167478601 GTCTATAGGAACAACCAGAAGGG + Intronic
965552597 3:169984098-169984120 TTGTATAGGTATAACAGGAAAGG - Intronic
967055843 3:185827473-185827495 ATGTAAAGGAGAAACGAGAGTGG + Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
968065375 3:195755936-195755958 TTGTAAAGGAAGAGCCAGAAAGG - Intronic
968127776 3:196172569-196172591 ATGTATAGGAAAACCGAAAGAGG + Intergenic
970678365 4:18478009-18478031 TTGAAAAGGGAAAACGAGATTGG + Intergenic
971446712 4:26758139-26758161 TTTTATAAGAACAAGGAGAAGGG - Intergenic
973870468 4:55161027-55161049 ATGTATAGGAAAAAAGAGCCAGG - Intergenic
973894493 4:55397669-55397691 ATGGAAAGGAAAAAGGAGAAAGG - Intronic
974167798 4:58226264-58226286 TTGCATAGGAAAAACTGAAAAGG - Intergenic
974488020 4:62528803-62528825 TTGTACAGGCTAAACAAGAAAGG - Intergenic
974703304 4:65479496-65479518 TTGTATAGGGAAATGGGGAAAGG + Intronic
975241955 4:72070407-72070429 TTTTAAAGGAAAAATGAGGAGGG + Intronic
975309592 4:72888519-72888541 TTTTCTAGGAAAAATGAGACAGG + Intergenic
976180872 4:82397724-82397746 TTGTATAGAAAAAAGGATAGAGG - Intergenic
976920021 4:90428235-90428257 TTGGAGAGGGAAAAAGAGAAAGG - Intronic
977432449 4:96947703-96947725 ATGTAAAAGAAAAAAGAGAAAGG + Intergenic
978233620 4:106430867-106430889 TTGTGAAGGAAACACTAGAAAGG + Intergenic
978547251 4:109884266-109884288 TTAGATAGAAAAAAAGAGAATGG + Intergenic
979149037 4:117284839-117284861 TTGTACTGGAAAAATGTGAAAGG + Intergenic
979456498 4:120931196-120931218 TTGTAGAGGAAAAATGGGAGGGG - Intergenic
979523918 4:121697439-121697461 TGGGATAGAAAAAACGTGAAAGG + Intergenic
980199636 4:129639369-129639391 TTGAATAGAAACAACAAGAATGG + Intergenic
980338194 4:131502659-131502681 TTGTAAATGAGAAAAGAGAAAGG + Intergenic
980480676 4:133383591-133383613 GTATATAGGTAAAACTAGAAGGG - Intergenic
981016847 4:139982641-139982663 GTGTATAGGAAAAAAGTGTATGG - Intronic
981731827 4:147907630-147907652 GTGTATAGGAAAAGAGAGCAAGG + Intronic
983707260 4:170676721-170676743 ATGTATAGTACAAACCAGAAAGG + Intergenic
986051742 5:4096549-4096571 ATGAATAGGGAATACGAGAAGGG + Intergenic
986981860 5:13457342-13457364 TGGTATAGGAAAAAGCAGATTGG - Intergenic
987154045 5:15070003-15070025 TTGTAAAGGAAAAATGAGGAGGG + Intergenic
987931570 5:24406116-24406138 TTTTTAAGGAAAAACAAGAATGG + Intergenic
988224391 5:28393569-28393591 TTTTAAAGGAAAAACAAAAACGG - Intergenic
988922202 5:35953935-35953957 GTGTCTAGGAAAAGGGAGAAAGG + Exonic
989496023 5:42112380-42112402 TCTTATAGGAGAAACTAGAAAGG - Intergenic
990782055 5:59376140-59376162 TTGAATAGGAAAGGCGAGAGAGG - Intronic
990826283 5:59902645-59902667 TTGTATAAGAAAAACCATAAGGG + Intronic
990949943 5:61288734-61288756 TTCTATAGGAAAATCTAGAGGGG + Intergenic
990999975 5:61772809-61772831 TTGTAAAGGCAAAAAGAGCATGG - Intergenic
991842873 5:70824713-70824735 TTTAATAGGAAAAACCAAAAAGG - Intergenic
993418887 5:87674881-87674903 CTGGATAGGAGAAAGGAGAAAGG - Intergenic
993531721 5:89033541-89033563 TTGTATTGGAAAAAGAACAAGGG + Intergenic
994692962 5:103040386-103040408 TTGGGTAGGAAAAAAGAAAACGG + Intergenic
995501424 5:112811157-112811179 TTGGATAGGAAAAAGGACAGTGG + Intronic
996447436 5:123571970-123571992 TTTTAAAGGAAAAATGAGGAGGG + Intronic
998311292 5:141135688-141135710 TTCTATATGAAAAACTAGACCGG + Exonic
998811527 5:145971370-145971392 TAGTTGAGGAAAAAAGAGAAGGG + Intronic
1000463649 5:161549458-161549480 GTGTATAGGAGTAAAGAGAAAGG - Intronic
1000890995 5:166802169-166802191 TTGTATTGTAAAAATGAGCATGG - Intergenic
1001831059 5:174789795-174789817 GTGTATAGGAGGAATGAGAATGG + Intergenic
1003369147 6:5507989-5508011 TTTTATAGGCAAATAGAGAAAGG + Intronic
1006755985 6:36415961-36415983 TTGTATATGAAACAGGAGACTGG + Intronic
1008099821 6:47378684-47378706 ATGTGAAGGAAAAACAAGAAAGG - Intergenic
1008948843 6:57132100-57132122 TTTTAAAGGGAAAAAGAGAAGGG + Intronic
1010007613 6:71012415-71012437 TGGTATAGAAATAACCAGAAGGG + Intergenic
1011912178 6:92454205-92454227 ATCTATAGGAAAAAAGAAAAAGG + Intergenic
1011992703 6:93543570-93543592 TTCTAGAGGAAAAATGAAAATGG - Intergenic
1013128071 6:107204616-107204638 TTGGATAGCAAAGATGAGAATGG - Intronic
1013679908 6:112513651-112513673 TTGGATAGTGAAAAGGAGAATGG + Intergenic
1013777890 6:113699362-113699384 TTGTAAAGGAAAAATGAAGAGGG + Intergenic
1015026804 6:128543242-128543264 ATGGAAAGAAAAAACGAGAAGGG - Intergenic
1015621087 6:135132431-135132453 CTGTAAAGGAAAGAAGAGAAGGG - Intergenic
1017418445 6:154246670-154246692 CTGTATAAGAAAAAGGAAAAGGG - Exonic
1018736990 6:166694395-166694417 TTGTATTGGAAGACCGTGAATGG - Intronic
1018920673 6:168170353-168170375 TTTTAAAGGAAAAATGAGGATGG - Intergenic
1021377422 7:19925014-19925036 TTTTATATTAAAAAGGAGAATGG + Intergenic
1021425977 7:20499942-20499964 TTGAATAGGAAAGGTGAGAAAGG - Intergenic
1027306430 7:76902598-76902620 TTGCAGAGGAGAAATGAGAATGG + Intergenic
1027331803 7:77104232-77104254 TTTTATATGAAATACTAGAAAGG - Intergenic
1028879328 7:95861922-95861944 TTGAACAGGGAAAAAGAGAAAGG - Intronic
1032518246 7:132522826-132522848 TTGTATAGCAAAAGTGGGAAGGG + Intronic
1033261780 7:139850267-139850289 TTTTATAGGAAAAAAGGAAATGG - Intronic
1034309597 7:150075357-150075379 TTGAATTGGAAAGAGGAGAAGGG - Intergenic
1034797262 7:154025284-154025306 TTGAATTGGAAAGAGGAGAAGGG + Intronic
1035426049 7:158774562-158774584 TTGTGTAAGAGAAAAGAGAAAGG - Intronic
1036221768 8:6927051-6927073 TTGTATATGCCAAAAGAGAAGGG + Intergenic
1036223456 8:6939758-6939780 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036236327 8:7042501-7042523 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036474318 8:9079365-9079387 TTGTTTAGGGAAAATGAAAACGG - Intronic
1037715859 8:21399571-21399593 TAGTATAAGAAAAACTGGAATGG - Intergenic
1038061517 8:23919033-23919055 ATGCATAGGAAAAAGGAGTAAGG - Intergenic
1038146920 8:24905664-24905686 TTGTATAGGGAAGAAGAGGAGGG - Intergenic
1039027500 8:33273513-33273535 TTGTAAAAGCAAAATGAGAAAGG + Intergenic
1039144580 8:34432791-34432813 TTGGGTAGTAAAAATGAGAATGG - Intergenic
1039926380 8:41936296-41936318 TTATATAGAAAATATGAGAATGG + Intronic
1043930744 8:86088509-86088531 CTGTTTAGGAAAGAGGAGAAGGG + Intronic
1045208201 8:100065989-100066011 TTGTATAGTGAAAAGGAGATGGG - Intronic
1046560870 8:115835932-115835954 TTGAAGAGGAAAGATGAGAAAGG + Intergenic
1048526903 8:135211513-135211535 TTGCACAGGAAAAAAGAGAGAGG - Intergenic
1049842758 8:144784275-144784297 AAGTATAGGAAAAAAGATAATGG + Intronic
1049892994 9:88344-88366 TGGTGCAGGAAAAAGGAGAAAGG - Intergenic
1050701208 9:8341272-8341294 TTGAATAGGAAAAAAAAAAAAGG + Intronic
1051155354 9:14138034-14138056 TTATATAGCAATAACGAGCATGG + Intronic
1051860014 9:21613870-21613892 TTGTAATGGAAAAAGGAGATAGG + Intergenic
1053734215 9:41088402-41088424 TGGTGCAGGAAAAAGGAGAAAGG - Intergenic
1053831411 9:42085722-42085744 TTGAACAGGAAAAAAGTGAAAGG + Intronic
1054131504 9:61371168-61371190 TTGAACAGGAAAAAAGTGAAAGG - Intergenic
1054599136 9:67101716-67101738 TTGAACAGGAAAAAAGTGAAAGG - Intergenic
1054694180 9:68343167-68343189 TGGTGCAGGAAAAAGGAGAAGGG + Intronic
1055811308 9:80151394-80151416 TTGAATAAGAATATCGAGAATGG + Intergenic
1056316987 9:85399760-85399782 TTGTTTGGGATAAAGGAGAAGGG - Intergenic
1056361805 9:85865645-85865667 TTGAATAGGAAAAGTGAGAGTGG - Intergenic
1056377352 9:86027651-86027673 TTGTGTAGGAAAAAATGGAATGG - Exonic
1059061766 9:111040336-111040358 GTGTATAGGAAGAAAGAGACGGG - Intergenic
1059064480 9:111068571-111068593 TTATTTAGGATAAACAAGAACGG - Intergenic
1060761899 9:126260089-126260111 TTCAAGAGGAAAAATGAGAAAGG - Intergenic
1187124624 X:16443285-16443307 TGGTAGAGGAAAAGAGAGAATGG + Intergenic
1187303349 X:18073037-18073059 TTGTAGAGGAAAAAGGGAAAGGG + Intergenic
1188794700 X:34447639-34447661 TTGTATAGGGAAAAAGATAGGGG + Intergenic
1189049240 X:37627053-37627075 TTCTATAGAAAAAATGAGGATGG + Intronic
1189439659 X:41023883-41023905 TTGTATAAGAAAAGCAAGAAAGG + Intergenic
1189574208 X:42333423-42333445 TTGTATACCAAAAACAAAAATGG - Intergenic
1193260391 X:79399681-79399703 TTGTTTAGGAAAAACAGGATGGG - Intergenic
1193336969 X:80301516-80301538 TTGTATATGGAAAAAGATAAAGG + Intergenic
1193459185 X:81769984-81770006 TTATATATAAAAAAGGAGAAAGG + Intergenic
1193640606 X:84006300-84006322 TTGTGTACAAAAAAAGAGAAAGG - Intergenic
1197170198 X:123425177-123425199 TTGTATAAGAAAATCCAAAATGG - Intronic
1197374682 X:125667665-125667687 TTGAATAGGAATAATAAGAATGG - Intergenic
1197979084 X:132196974-132196996 TTGTAAAGAAAAAACTAGACTGG + Intergenic
1198521773 X:137460398-137460420 ATGTATAGGATAAATGAGAGAGG + Intergenic
1199728485 X:150607554-150607576 ATGTATAGGGAAAAGGATAAAGG - Intronic
1200824653 Y:7625407-7625429 TTGTATGGGAAAAACAAGGCTGG - Intergenic
1202235402 Y:22705680-22705702 TTGTATGGGAAAAACAAGGCTGG + Intergenic
1202307757 Y:23490488-23490510 TTGTATGGGAAAAACAAGGCTGG - Intergenic
1202563044 Y:26180098-26180120 TTGTATGGGAAAAACAAGGCTGG + Intergenic