ID: 1117692120

View in Genome Browser
Species Human (GRCh38)
Location 14:58318604-58318626
Sequence CATTTTGCAGAGAGTGAGGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 293}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117692118_1117692120 3 Left 1117692118 14:58318578-58318600 CCTCACTTTGTCTGAAAGGAGAG 0: 1
1: 0
2: 2
3: 11
4: 186
Right 1117692120 14:58318604-58318626 CATTTTGCAGAGAGTGAGGTAGG 0: 1
1: 0
2: 1
3: 36
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117692120 Original CRISPR CATTTTGCAGAGAGTGAGGT AGG Exonic
901236053 1:7668181-7668203 CATTTTGCAGACTGGGAAGTAGG - Intronic
902526846 1:17064391-17064413 CACCTTGCAGAGAGAGAGGGGGG + Intergenic
903434471 1:23336177-23336199 CACTTTGGGGAGGGTGAGGTAGG + Intronic
904428194 1:30445247-30445269 CCTTTTTCTGAGAGTCAGGTTGG - Intergenic
904752917 1:32752279-32752301 CATTTTGCAGGGAGGGAAGAGGG + Intronic
905476134 1:38229480-38229502 CATTCTGCAGAGAGTGGGGCAGG + Intergenic
906852804 1:49270013-49270035 CAGATTGCACAGAGAGAGGTTGG - Intronic
907297747 1:53466242-53466264 CACTTTGGGGAGGGTGAGGTGGG + Intronic
908139977 1:61174174-61174196 CATTATGCAGATGGAGAGGTCGG + Intronic
909759976 1:79273995-79274017 CATTTGGCATAGAATGAGTTAGG - Intergenic
909872520 1:80760770-80760792 CATTTTTCAGACTGTGAGCTTGG + Intergenic
909908750 1:81233846-81233868 CACTTTGGAGAGAGAGAGGGAGG - Intergenic
910238747 1:85063354-85063376 GATTCTCCAGAGAGGGAGGTGGG + Intronic
911394984 1:97294412-97294434 CATTTTGAAGACGGTGAGGTAGG - Intronic
911822048 1:102435403-102435425 CATTTTTCAGAGAGACAGGCAGG + Intergenic
912498680 1:110107551-110107573 CATTTTCCAGGGAGTGAGGTGGG + Intergenic
913141535 1:115946186-115946208 CATTTTGCAGATACTGAAGCTGG - Intergenic
915368803 1:155330836-155330858 CATTTTGCAGATAGATAGGAAGG - Exonic
915590338 1:156866845-156866867 CATTCTGGTCAGAGTGAGGTCGG + Intronic
917854447 1:179089613-179089635 CCTGTTACAGAGAGTCAGGTGGG + Intronic
918295100 1:183149241-183149263 TTTTTTGGAGAGAGTGAGGCAGG + Intergenic
919496822 1:198282971-198282993 TAATTTGGAGAGAGTGAGGTGGG + Intronic
920249008 1:204609981-204610003 CATTTTACAGTGAGTGATGGAGG - Intergenic
920661806 1:207921734-207921756 CACTTTGCAGAAAGTGAGCAGGG - Intergenic
920849139 1:209616841-209616863 CATTGTCCTGGGAGTGAGGTGGG - Intronic
921642648 1:217573964-217573986 TATTTTGCAGAGAATGAGAATGG + Intronic
921667001 1:217884551-217884573 CATTTTCCAGAGATTTGGGTGGG - Intergenic
921844070 1:219860511-219860533 CTTCTTTCAGAGAGTGAGGAAGG + Intronic
921998310 1:221446275-221446297 CACTTTGGGGAGACTGAGGTGGG - Intergenic
922084410 1:222332375-222332397 CCTTTTCCAGAGAGTGAGGGAGG - Intergenic
922769966 1:228176404-228176426 CATTTGGGGGAGAGGGAGGTGGG + Exonic
923441943 1:234028819-234028841 GAGTTTGCTGAGAGAGAGGTGGG + Intronic
924225727 1:241920194-241920216 GATATTGCAGAGGCTGAGGTGGG - Intergenic
1063309836 10:4941705-4941727 GATTTTCCAGAGAAGGAGGTTGG + Intronic
1063317453 10:5020397-5020419 GATTTTCCAGAGAAGGAGGTTGG - Intronic
1065582177 10:27182892-27182914 CATTTTGGGGAGGCTGAGGTGGG - Intronic
1066000476 10:31100228-31100250 AATTTTGCAGAAATTGAGGAGGG + Intergenic
1066539154 10:36425897-36425919 GGTTTTGCAATGAGTGAGGTGGG - Intergenic
1068370852 10:56111561-56111583 CATTGTGCAGTGTGTGAGGTGGG - Intergenic
1068405182 10:56578792-56578814 CATTAGTCAGAGAGTGAGGGTGG + Intergenic
1069711887 10:70494786-70494808 CATTCTGCAGACAGTGAAGTAGG + Intronic
1071083696 10:81842794-81842816 CTTTTTGCAGTGAGAGAGGAAGG - Intergenic
1073642441 10:105266768-105266790 CAGATAGCAGAGAGTGTGGTTGG + Intergenic
1073848964 10:107592251-107592273 CACTTTGCGGAGGCTGAGGTGGG - Intergenic
1074317727 10:112374647-112374669 CATTTGGCAGACAGAGAGGAAGG + Intronic
1075344569 10:121672836-121672858 CATTTTTCAGTGAGTGAGAGAGG + Intergenic
1075813573 10:125246862-125246884 CTTTTTGCAGTGAGTGAGCTGGG + Intergenic
1076394169 10:130126505-130126527 CCCTCTGCGGAGAGTGAGGTGGG - Intergenic
1076649266 10:131976621-131976643 CTGGTTGCAGAGAGTGTGGTTGG - Intronic
1078233123 11:9460668-9460690 CATTTTGTAGCGAGGGAGGGAGG - Intronic
1079302245 11:19288286-19288308 CATTTTGGAGAAAGAGAGGGAGG - Intergenic
1079495491 11:21038705-21038727 AATTTTGGAGAGAGTGGGGAGGG + Intronic
1080196151 11:29611830-29611852 CATTTTGCATAGAAAGAGGATGG - Intergenic
1080421673 11:32116486-32116508 CATTTTGAAGAGGCTGAGCTGGG + Intergenic
1080544590 11:33303618-33303640 CATTTTGAAGTGTGTGAGGTCGG - Intronic
1080621134 11:33988070-33988092 AGTTTTGCAGAGAAGGAGGTAGG - Intergenic
1080787752 11:35491298-35491320 CAGTTTACAGAGAGGGAGGATGG - Intronic
1080923178 11:36729284-36729306 CATTGTGCAGAGCGTTAGGGAGG - Intergenic
1080931175 11:36812916-36812938 AATTTTGCACAGACTGAGCTTGG - Intergenic
1081018204 11:37908474-37908496 CATTTTGCAGACAGACAGGAGGG - Intergenic
1082088603 11:48070253-48070275 CATTTTGGGGAGGCTGAGGTGGG + Intronic
1082435244 11:52728418-52728440 GATTCTACAGAGAGTGAGTTTGG - Intergenic
1083094721 11:60238883-60238905 CATTTTGCAAAGAATCAGTTAGG - Intronic
1084151119 11:67288558-67288580 CCTTTTGCAGAGGCTGCGGTTGG - Intronic
1085474044 11:76778377-76778399 CATTTTACAGATAGTAAGGCAGG + Intergenic
1085776855 11:79374268-79374290 ACTTTTGCAGGGATTGAGGTGGG + Intronic
1085946359 11:81277904-81277926 CAGTTTGCACAGAGAGAGGGAGG - Intergenic
1086721445 11:90126460-90126482 TATTTTGCTGAGTGGGAGGTGGG + Intergenic
1087473934 11:98613718-98613740 CATTTTGGAGAGGGTGGAGTGGG - Intergenic
1087504804 11:99005880-99005902 CATTCTGTAGAAGGTGAGGTGGG - Intergenic
1087930374 11:103970687-103970709 CATTTTTCAGAGAGTGACTTAGG + Intronic
1088318061 11:108527376-108527398 CTTTTTGCAAAGAGAGAGGGAGG + Intronic
1088695360 11:112361709-112361731 CAGTGTGCAGAGAGTGTGGTGGG + Intergenic
1089130396 11:116207826-116207848 CATCCTGCAGAGAGAGAGGACGG - Intergenic
1091991981 12:4962851-4962873 TATTTTGCACAGAGACAGGTGGG - Intergenic
1093775461 12:23068584-23068606 CACTTTGCAGAGAAGGAGATTGG + Intergenic
1094176472 12:27546765-27546787 CATTTTGGGGAGACTGAGGTGGG + Intronic
1095744410 12:45641549-45641571 TATTTGGTAGAGAGTGAGGAGGG - Intergenic
1096394421 12:51254962-51254984 GCTTTTTCAGGGAGTGAGGTGGG + Intronic
1097793304 12:63838229-63838251 CATTTTGAAGAGTGTAAAGTAGG + Intergenic
1098012003 12:66063037-66063059 TATTTTGGAGAGAGAGTGGTTGG - Intergenic
1100209424 12:92386516-92386538 TATTTGGTAAAGAGTGAGGTGGG + Intergenic
1101849960 12:108393976-108393998 CATTTTACAGAAAGGGAAGTGGG - Intergenic
1102549064 12:113677839-113677861 TTTTTGGCAGAGAGTGAGGGCGG + Intergenic
1103518764 12:121524142-121524164 CTTTCTGCAGGGAGGGAGGTAGG - Intronic
1105013192 12:132769519-132769541 CATATTGCAGAGAGTGGGAACGG + Exonic
1105491189 13:20890201-20890223 CACTTTGGAGAGGCTGAGGTGGG + Intronic
1108463689 13:50693532-50693554 CAGTTTACAGAGAGGGAGGGTGG - Intronic
1112004952 13:95245885-95245907 CATTTTGTTGGGAATGAGGTGGG - Intronic
1113404603 13:110026678-110026700 AATGATGCAGAGAGTGAGGTGGG + Intergenic
1115512190 14:34148473-34148495 CAGTTAGCTGGGAGTGAGGTGGG - Intronic
1115900882 14:38146612-38146634 CATTTTGTAGAGAATTACGTTGG + Intergenic
1116349993 14:43848572-43848594 GATTTTGGAGAAAGTGATGTTGG + Intergenic
1117469734 14:56030935-56030957 CTTTTCCCAGAGAGTGAGGAGGG - Intergenic
1117692120 14:58318604-58318626 CATTTTGCAGAGAGTGAGGTAGG + Exonic
1118642832 14:67808218-67808240 CATTTTGGAGGCAGTGAGGTGGG - Intronic
1120361921 14:83514907-83514929 GATTTTGCAGGGAGGGAGGGAGG + Intergenic
1122007432 14:98717004-98717026 CACTTGGCAGAGAGGGAGGCGGG + Intronic
1122013560 14:98773782-98773804 CATTTTGGGGAGAGTGGGGGTGG - Intergenic
1202837165 14_GL000009v2_random:86826-86848 CGTCTGGCAGTGAGTGAGGTTGG + Intergenic
1202906557 14_GL000194v1_random:76956-76978 CGTCTGGCAGTGAGTGAGGTTGG + Intergenic
1125434721 15:39632422-39632444 CACTTTGGAGAGGCTGAGGTGGG - Intronic
1125483554 15:40096916-40096938 CATTTTGAAGAGATTGAGTGTGG - Intronic
1126177590 15:45752054-45752076 AGTTTTGCATAGAATGAGGTAGG + Intergenic
1127594412 15:60464662-60464684 CAATTTGTAGAAAGTGAGGATGG + Intronic
1128134925 15:65255687-65255709 CTTTTTGCAGGGAGGGGGGTTGG + Intronic
1128342553 15:66832606-66832628 TATTATGAAGAGAGAGAGGTAGG - Intergenic
1128625223 15:69194569-69194591 GATTTTTCAGATAGTGATGTAGG + Intronic
1130151774 15:81316884-81316906 GATTTTGCTGAGAGGGTGGTTGG - Intronic
1130205010 15:81867688-81867710 CATGGTGCAGAGAGGGTGGTTGG + Intergenic
1130525723 15:84704666-84704688 AATTTGGCAGAGAGTGAGTGTGG - Intronic
1132883909 16:2174060-2174082 CAGGCTGCAGAGACTGAGGTAGG - Intronic
1132938363 16:2493944-2493966 CATTTTCCAGAGGGAGAGCTGGG - Intronic
1132976667 16:2714428-2714450 CATTGTGCAGAGAGAGGTGTGGG - Intronic
1133465865 16:6026369-6026391 CATTTTGCAGATAGAGAGTGGGG + Intronic
1134839265 16:17388521-17388543 CATTTTGCAGAGGAAGAAGTTGG - Intronic
1135549592 16:23387935-23387957 CATGTGGCAGAGAGTGAAGGAGG - Intergenic
1139522305 16:67491018-67491040 CAGTTTGAAGAGTGTGAGTTTGG + Intergenic
1139794121 16:69468290-69468312 CATTTTTCAGAAATTGAGGTGGG + Intergenic
1140645611 16:77026697-77026719 CACTTTTGAGAGATTGAGGTTGG - Intergenic
1142540597 17:655713-655735 CAATTTGCAGAAAGTGGGGCAGG + Intronic
1143258747 17:5583324-5583346 CATTTTGCAGACAGAGAAATAGG + Intronic
1144745684 17:17612649-17612671 CATTCTGCAGAGAGTGAAACAGG + Intergenic
1145264597 17:21373761-21373783 CATTTTACAGAGAGGGAAGTGGG + Intergenic
1145314327 17:21720305-21720327 CATTTTGCTGAAATTGAGGATGG - Intergenic
1145712779 17:26992281-26992303 CATTTTGCTGGGATTGAGGATGG - Intergenic
1148865033 17:50623972-50623994 CATTGGGCAGAGAGTGCGTTCGG - Exonic
1149251427 17:54774561-54774583 CAATTTGCAGACAGTGATATGGG - Intergenic
1151300863 17:73224178-73224200 CATTTTGGGGAGGCTGAGGTGGG + Intronic
1152072118 17:78139068-78139090 CGTATTGTAGAGATTGAGGTGGG + Intronic
1152197923 17:78928424-78928446 CATTTTGTTCTGAGTGAGGTGGG + Intergenic
1153113075 18:1617601-1617623 TATTGTGAAGAGTGTGAGGTAGG - Intergenic
1153490791 18:5645963-5645985 CATTCTGCAGGGAATGTGGTAGG + Intergenic
1154982174 18:21511888-21511910 CATTTTTGGGAGACTGAGGTAGG - Intronic
1155094788 18:22545027-22545049 AATTTTGGGGAAAGTGAGGTGGG + Intergenic
1156698454 18:39795769-39795791 CAGTTTGCAGAGGGAGAGGGAGG + Intergenic
1156721309 18:40073288-40073310 AATTTTGCAGAAACTGAGGTGGG + Intergenic
1157761743 18:50270373-50270395 GAATTGGGAGAGAGTGAGGTAGG + Intronic
1158915888 18:62128961-62128983 AATTTTGCAGGGAGTGAGTGGGG - Intronic
1159784491 18:72697157-72697179 CAGTTTGCACAGAGAGAGGGAGG - Intergenic
1161069877 19:2254638-2254660 CATTTTGGGGAGACTGAGGTGGG + Intronic
1161210657 19:3063529-3063551 GATTTTGCTCTGAGTGAGGTAGG + Intergenic
1161398329 19:4056478-4056500 CATTTTGGGGAGGCTGAGGTGGG + Intronic
1161948131 19:7451659-7451681 CACTTTGGAGAGACCGAGGTGGG - Intronic
1162400735 19:10445087-10445109 GATTTTGCCCAGAGTAAGGTGGG + Intronic
1162456552 19:10788462-10788484 GCTTTTGCTGTGAGTGAGGTGGG + Intronic
1163000139 19:14362103-14362125 GCTTTTGCACTGAGTGAGGTGGG + Intergenic
1163935903 19:20442927-20442949 CATTTTTGAGAGTCTGAGGTGGG - Intergenic
1164772763 19:30824317-30824339 CATTTGCCAGAGGTTGAGGTAGG + Intergenic
1165180552 19:33963838-33963860 CATTTGGCAGATACTGAGGGAGG - Intergenic
1165535427 19:36440296-36440318 CACTTGGCAGAGACTGAGGTAGG + Intergenic
1165687195 19:37831937-37831959 CATTTTCCAAAGTGTGGGGTAGG + Intergenic
1165767494 19:38360413-38360435 CACTGGGCAGAGGGTGAGGTGGG + Intronic
1166620755 19:44297870-44297892 CATTTTGGGGAGGCTGAGGTGGG + Intronic
1168298728 19:55390877-55390899 CATCTTGGAGAGAGAGATGTTGG + Intronic
925839265 2:7975898-7975920 CATTTTCCAAAGAGTGACATGGG + Intergenic
925891618 2:8439270-8439292 CATTTGGCAGGGAGCAAGGTAGG + Intergenic
928806117 2:35157868-35157890 AATATTGTAGAGAGTGATGTTGG - Intergenic
929652927 2:43700216-43700238 CCTTTTCCAGAGAGTGAGTTAGG - Exonic
930276641 2:49319043-49319065 TATTTAGCAGAGAGTGAAGATGG - Intergenic
931256462 2:60578184-60578206 CTTTTTATAGAGAGAGAGGTGGG - Intergenic
932996324 2:76858316-76858338 CAGTTTGAAAAGAGTCAGGTGGG - Intronic
933100043 2:78243938-78243960 CATTTAGCAGGTAGTTAGGTTGG + Intergenic
934674512 2:96240105-96240127 CATTGTGCAGAGGGTTAAGTGGG + Intergenic
934774755 2:96929966-96929988 CACTTTTCAGAGACTGAGGCAGG + Intronic
935023728 2:99256332-99256354 CACTTTCCTGAGAGTCAGGTAGG - Intronic
935418368 2:102842243-102842265 AATAATGCAGAGAGGGAGGTAGG - Intronic
936496777 2:113029294-113029316 CATTTTGCTGCAAGTGTGGTAGG - Intronic
939001433 2:136740103-136740125 CATTTGGCAGACACTGTGGTAGG + Intergenic
939472681 2:142644538-142644560 CCTTTTCCAAAGAGAGAGGTAGG + Intergenic
939581801 2:143958738-143958760 CATTTTATAGAGAGAGAGTTTGG + Intronic
940513389 2:154648136-154648158 TATTTTGCAGGGACAGAGGTTGG - Intergenic
941159477 2:162019846-162019868 CATTTTGCAAAGAGTAAGGCCGG + Intronic
942575862 2:177362859-177362881 CTATTTGCTGAGAGTGAGGCAGG - Intronic
942941673 2:181626022-181626044 CATTTTACAGATTGTGAGGAAGG + Intronic
943258611 2:185629494-185629516 CCTTTTGCACAGAGAGAGGAAGG + Intergenic
944571444 2:201049213-201049235 CAATTTGCTGAGAGAGATGTGGG - Intronic
945606881 2:211944587-211944609 CATCTTGCAGAGAGAAAGGAAGG - Intronic
945867477 2:215192752-215192774 AATTTTGCAGAAAGAGACGTAGG + Intergenic
946326146 2:218985538-218985560 CTGTTTGCAGAGAGTCAGGGAGG - Exonic
946482099 2:220066914-220066936 TGCTGTGCAGAGAGTGAGGTGGG + Intergenic
946699804 2:222401102-222401124 CTTTTTGCACAAAGTGAGGAAGG + Intergenic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
947276829 2:228401490-228401512 CAGTGTTCAGAGAGTGGGGTGGG + Intergenic
1170972268 20:21126567-21126589 CAATTTGAAGAGAGTGGGGAGGG - Intronic
1171942778 20:31347907-31347929 CATGGTGCAGAGAGTGTGCTTGG + Intergenic
1172997750 20:39083543-39083565 AATTCTGAAGAGAGTCAGGTTGG + Intergenic
1173034427 20:39395202-39395224 CATTTTGTTTGGAGTGAGGTAGG + Intergenic
1173987291 20:47271539-47271561 GATATGGCAGTGAGTGAGGTTGG - Intronic
1174656486 20:52176360-52176382 CATTTTAGAGAGATTGTGGTTGG - Intronic
1176188565 20:63795425-63795447 CATTGTGCAGGCAGTGAGGGGGG + Intronic
1176625904 21:9091755-9091777 CGTCTGGCAGTGAGTGAGGTTGG + Intergenic
1177893133 21:26831399-26831421 CATTTTGCTCAGAGTAAGATGGG - Intergenic
1179244937 21:39624868-39624890 GATTTTCAAGAGAGTGAGGATGG - Intronic
1179270671 21:39848130-39848152 CAGTTTGCAAAGAGAGAGGGTGG + Intergenic
1179898376 21:44376115-44376137 CGTTTGGCAGAGAGTGCAGTGGG + Intronic
1180783929 22:18536548-18536570 CCGGTTCCAGAGAGTGAGGTAGG - Intergenic
1180928059 22:19570078-19570100 CATTTTACTGAAAGTAAGGTTGG + Intergenic
1181127496 22:20710597-20710619 CCGGTTCCAGAGAGTGAGGTAGG - Intronic
1181240828 22:21475900-21475922 CGGGTTCCAGAGAGTGAGGTAGG - Intergenic
1181417903 22:22773333-22773355 GATTTGGAAGAGAGTGAGGGAGG - Intronic
1184573372 22:45341525-45341547 GAGTTTGCAGAGAGTGAGGGAGG + Exonic
1184637372 22:45844250-45844272 AATGTGGCAGGGAGTGAGGTTGG + Exonic
1185030035 22:48437780-48437802 CCTGTTGCAGAGACTGCGGTGGG - Intergenic
1185105321 22:48866002-48866024 CATTTTGCAGACCGGGAAGTGGG + Intergenic
949371570 3:3340373-3340395 CATTTTTCAGAGATTGTGATGGG - Intergenic
949610902 3:5702463-5702485 GATATAGCAGAGAGAGAGGTTGG + Intergenic
950674555 3:14546756-14546778 CATTTTGAGGAGAGTCAAGTGGG - Intergenic
950721174 3:14883707-14883729 CCTTTTGCAGGGAGAGAGGGTGG + Intronic
951253399 3:20420338-20420360 CATTTTGGAGAAAATGAGATGGG - Intergenic
954457846 3:50609635-50609657 TATTTTGCAAGGAGTGAGGGAGG - Intronic
955881229 3:63548347-63548369 CATTATGCAGATAGGGAAGTTGG - Intronic
955923665 3:63984545-63984567 CATGTTACTGAGAGTCAGGTAGG - Intronic
957520938 3:81317392-81317414 CATTTGGCAGAGAGGGAGTTGGG + Intergenic
960221634 3:115118305-115118327 CACTCTGCAGAGGCTGAGGTGGG - Intronic
960769554 3:121178592-121178614 AAGTTTGCAGAGTGTGAGATGGG + Intronic
961402312 3:126656002-126656024 GATTTGGCAGAGAATGAGGCTGG + Intergenic
961724363 3:128916442-128916464 CATTTTGGATAGTGAGAGGTTGG - Intronic
962060396 3:131920867-131920889 CAATTTGCGGAGAGGGAGGAAGG - Intronic
962490062 3:135884489-135884511 CCTTTTCCAGAGAGTGAGCAGGG + Intergenic
962922629 3:139964654-139964676 CCTTCTGGAGGGAGTGAGGTGGG + Intronic
963227206 3:142874400-142874422 CATCGTGCAGAGAGTGAGGGGGG - Intronic
963262087 3:143203036-143203058 CATTTTCCAGAGAATAAGGATGG - Intergenic
963308975 3:143687425-143687447 AATTTAGCAGAGAGTGGGTTCGG + Intronic
965504827 3:169503115-169503137 CATTTTAGAGAGAGTGAACTGGG + Intronic
966105490 3:176327978-176328000 CATATTGCAAAAAGTTAGGTTGG + Intergenic
967287766 3:187889972-187889994 CATTCTGCAGAGACTCAGGCAGG - Intergenic
967727231 3:192873106-192873128 CATTTTGGAGACAGTGGGGAGGG - Intronic
968490313 4:886642-886664 CATCTTGGTGAGAGTGATGTTGG - Intronic
968932991 4:3593101-3593123 CATTGCGCAGAGAGTGGGGATGG + Intergenic
969418082 4:7074051-7074073 CAGTTTACTGACAGTGAGGTGGG - Intergenic
969861345 4:10038067-10038089 CATTTTCCAGACAGTGTGATGGG - Intronic
970190438 4:13511096-13511118 CACTTTTGAGAGACTGAGGTGGG + Intergenic
970535533 4:17026573-17026595 CCTTTTGCAGTGAGGGAGGGAGG + Intergenic
970870264 4:20808945-20808967 GATTTTGCTGAGAGTGAGAGAGG - Intronic
971864090 4:32146204-32146226 AATTCTGCAGAGGGTTAGGTGGG - Intergenic
972834892 4:42858315-42858337 CATTTTGCTGACACTGAGGTAGG + Intergenic
974017017 4:56656655-56656677 CATTTTACAGAGATGGAGATAGG + Intronic
976345361 4:83993735-83993757 CAGTTTGCATAGGGTGAGGGAGG - Intergenic
976543277 4:86302944-86302966 CATTTTGCTATGAGTGAGGATGG - Intronic
980394471 4:132192515-132192537 CATTTTGGTGAGAGTAAGGTGGG + Intergenic
981111123 4:140934647-140934669 CATTTTGCTTAGAGTGAGAGGGG + Intronic
983776834 4:171618262-171618284 CTTTTTGCAGACACTTAGGTTGG + Intergenic
1202762782 4_GL000008v2_random:126404-126426 CGTCTGGCAGTGAGTGAGGTTGG - Intergenic
985690349 5:1306412-1306434 CACTTTGGGGAGGGTGAGGTGGG - Intergenic
985825847 5:2191013-2191035 TCTTTTGCATAGAGTGAGTTGGG - Intergenic
987120179 5:14760029-14760051 CGATCTTCAGAGAGTGAGGTGGG + Intronic
987555107 5:19436237-19436259 AAGTTTCCAGAGAGTGAGATGGG - Intergenic
988450275 5:31335265-31335287 TATTTTAGAGAGAGAGAGGTGGG - Intergenic
988899602 5:35718124-35718146 CAGTTTGCACAGGGAGAGGTAGG + Intronic
989026549 5:37074839-37074861 CATTTTGCAGGGTGTGTTGTAGG + Intergenic
989213435 5:38880067-38880089 CAGTCTGCAGAGAGTGAGAAAGG + Intronic
989286071 5:39701595-39701617 GATTTTGCAGATAGTGCGATCGG + Intergenic
990854590 5:60249686-60249708 CATTTTGCAAAGATACAGGTAGG + Intronic
991056504 5:62326377-62326399 CATTTTGCTGAGAGTGTGGGTGG - Intronic
991949383 5:71933032-71933054 ACTTTTCCAGAGAGTGAGGCTGG + Intergenic
992852093 5:80821008-80821030 CATCTTGCAGAGAGAGAAGCAGG - Intronic
993323194 5:86501256-86501278 CCTTTTGTAGGGATTGAGGTTGG - Intergenic
993493118 5:88576328-88576350 CATTTTGAAGAAAGAGAGGAGGG - Intergenic
995582208 5:113613980-113614002 CATTTGGAAGAGAGACAGGTAGG + Intergenic
995582213 5:113614048-113614070 CATTTGGAAGAGAGACAGGTAGG + Intergenic
995673307 5:114632771-114632793 CTTTTTGCTGAGGGTGAGATAGG - Intergenic
995775278 5:115718438-115718460 AAATTTACAGAAAGTGAGGTTGG - Intergenic
997284981 5:132671523-132671545 CACTTTGCAGGGGCTGAGGTGGG + Intergenic
997390668 5:133512233-133512255 CATGTGGCAGAGAGAGAGGTGGG - Intronic
998852514 5:146364437-146364459 CTTTTTGCAGGGAAGGAGGTGGG + Intergenic
998865220 5:146492404-146492426 CATTTTGTAGGGTGTGAAGTAGG + Intronic
1000350075 5:160346119-160346141 CACTTTGCGGAGGCTGAGGTGGG + Intergenic
1000581316 5:163038344-163038366 CAGTTCGTAGAGAGTGATGTAGG + Intergenic
1000954038 5:167521079-167521101 CATTCTGGAGAGACTGAGGTTGG + Intronic
1004542509 6:16564244-16564266 CATTTTTGGGAGAGTGAGATAGG + Intronic
1005099688 6:22157399-22157421 CATTTTGCAGATAAGGAGATTGG + Intergenic
1005681920 6:28216719-28216741 CCTTTTGCAGTGTGTGTGGTGGG - Intergenic
1006388949 6:33747513-33747535 GACTTTGCAGAGAGTGAGGAGGG + Intergenic
1007534486 6:42573493-42573515 CATTTTGCAGGGAAGGAGGGAGG + Intronic
1007641381 6:43342622-43342644 AAGTTTGAAGAGAGTGAGGGTGG + Intronic
1010427386 6:75742512-75742534 CAGTTTCCAAAGTGTGAGGTGGG + Intergenic
1011570469 6:88729064-88729086 CATATAGCAGAGAGCGAGCTTGG - Intronic
1013111922 6:107070966-107070988 CATTTCCCAGAGTGTTAGGTGGG + Intronic
1013635712 6:112027422-112027444 CATGGTGCAGAGAGTGCAGTGGG + Intergenic
1013838701 6:114363589-114363611 CATTTGGCAGAGAGGCAAGTTGG + Intergenic
1014554389 6:122828432-122828454 CATTTTGGAGAGGCTGAGGCAGG + Intergenic
1016511481 6:144848127-144848149 ACTTTAGCAGGGAGTGAGGTTGG + Intronic
1016872201 6:148829377-148829399 CATTTTCCAGATAGGGAAGTTGG - Intronic
1018437405 6:163775179-163775201 CAATTTGCATACAGTGAGGTTGG + Intergenic
1018967717 6:168501542-168501564 CATTCTGCAGAATGTGAGGTGGG + Intronic
1021986213 7:26100836-26100858 CATTTTGAAGAGATTGCGGGTGG - Intergenic
1024202952 7:47125130-47125152 AATCTTGCAGAGAGGAAGGTGGG - Intergenic
1024374024 7:48617994-48618016 CCTGGGGCAGAGAGTGAGGTAGG - Intronic
1027231864 7:76277278-76277300 CATTATGCTGAGAGTGGGATGGG - Intronic
1029980595 7:104875092-104875114 CATTTTTGGGAGACTGAGGTAGG - Intronic
1030567280 7:111174476-111174498 TTTTTTGCATTGAGTGAGGTAGG - Intronic
1031313960 7:120233717-120233739 CATGTTGCAGACATTGAAGTTGG + Intergenic
1032062134 7:128733779-128733801 CATGCTGCTGACAGTGAGGTGGG - Intergenic
1033097444 7:138443230-138443252 GATATAGCAGAGAGAGAGGTTGG + Intergenic
1038806868 8:30801983-30802005 CATTTTGCAGAAATTAAGGGAGG - Intronic
1041574599 8:59379898-59379920 CATTTTGGAAAGAGGGAAGTTGG + Intergenic
1042922144 8:73930574-73930596 GAGGTTGCAGTGAGTGAGGTGGG - Intergenic
1044874403 8:96650187-96650209 CATTTTGCAGAGAAAGTGTTTGG + Intronic
1045847247 8:106652237-106652259 CAATTTGCTGAGAGTGAGCTTGG + Intronic
1045961688 8:107976165-107976187 CCTTTGGCAGAGGGTGAGGCAGG - Intronic
1046149795 8:110209003-110209025 CATTATCCAGAGAGAGAGGGAGG + Intergenic
1050267566 9:3906875-3906897 AAGTTTGCAGACAGTGAGATAGG - Intronic
1051158474 9:14178130-14178152 CATCTTACAAAGAATGAGGTGGG - Intronic
1054457138 9:65438876-65438898 CATTGGGCAGAGAGTGGGGATGG - Intergenic
1055182395 9:73403203-73403225 AATTTTCCAGAGTGTGAGGTGGG - Intergenic
1056518459 9:87377178-87377200 AATTTTGCAGGGAGAGAGGATGG + Intergenic
1058118668 9:101114503-101114525 CACTCTGCAGGGAGAGAGGTAGG + Intronic
1058880574 9:109282637-109282659 AATCTTGCGGAGAGAGAGGTTGG - Intronic
1058981011 9:110170690-110170712 CATTTTATAGTGAGGGAGGTTGG + Exonic
1059511871 9:114855672-114855694 CATTTTGCAGAGAAGGAAGAAGG + Intergenic
1060040617 9:120297051-120297073 CATTTTCCCGACAGTGAGGTTGG - Intergenic
1060176719 9:121502587-121502609 CAGTTTGCAGAGAGAGAGAGAGG - Intergenic
1062038206 9:134392114-134392136 CATTTTGCAGAGGGGGAGGGTGG + Intronic
1062649687 9:137569265-137569287 AATTTTGGATAGGGTGAGGTCGG - Intronic
1203749076 Un_GL000218v1:62176-62198 CGTCTGGCAGTGAGTGAGGTTGG + Intergenic
1203543545 Un_KI270743v1:111285-111307 CGTCTGGCAGTGAGTGAGGTTGG - Intergenic
1186215062 X:7290775-7290797 CATTTTACAGAGAAAGAAGTGGG - Intronic
1186679717 X:11859504-11859526 CATTTTGCATAAAGTAAGGAAGG + Intergenic
1187587050 X:20674971-20674993 AATTTTACAGAGAGTCAGGTTGG + Intergenic
1188841630 X:35024539-35024561 CATTTTTTATAGAGTGGGGTGGG - Intergenic
1190633669 X:52413413-52413435 CTTTTTACAGAGAGGGAGGGAGG - Intergenic
1192051916 X:67732328-67732350 CTCTTTGGAGAGAGTGATGTGGG - Intergenic
1192276508 X:69636859-69636881 CATGATGGAGAAAGTGAGGTGGG - Intronic
1193790839 X:85813643-85813665 CATTTTTCAGGGAGTCAGGCAGG + Intergenic
1194912860 X:99668395-99668417 CATTTTACAGAGAGAGAGAGAGG - Intergenic
1196897354 X:120350420-120350442 CATTTTGGTGAGAGTGGGATTGG - Intergenic
1197238361 X:124094296-124094318 GATTTAGAAGAGAGTAAGGTTGG + Intronic
1199201885 X:145100404-145100426 CATTTGACAGAGAGAGAGGGAGG - Intergenic
1199654595 X:149981755-149981777 CATTTTACAGAGGAAGAGGTGGG - Intergenic
1201162432 Y:11177189-11177211 CGTCTGGCAGTGAGTGAGGTTGG + Intergenic