ID: 1117712081

View in Genome Browser
Species Human (GRCh38)
Location 14:58541293-58541315
Sequence CTAGTGGAGCACATCTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117712081 Original CRISPR CTAGTGGAGCACATCTTTAA TGG Intronic
906952632 1:50347229-50347251 CTAGTGGAGAAGATGATTAAAGG - Intergenic
909374871 1:74928361-74928383 CAAGTGAAGGACATCTTCAAGGG + Intergenic
910933076 1:92461874-92461896 CTTGTTTAGCACATCTTAAATGG - Intergenic
918527243 1:185478592-185478614 TTAGGGGAGAACATCTTTGAGGG - Intergenic
919783664 1:201240973-201240995 TTTATGGAGCACATTTTTAACGG + Intergenic
921650483 1:217672548-217672570 CTAGTGGAGCATTTCTGAAATGG + Intronic
922700099 1:227754281-227754303 CAAGAGGAGCACATCAGTAAAGG - Intronic
1064394821 10:14973429-14973451 CTAGTGGAGGACTTCTTCCATGG - Intronic
1067839780 10:49666381-49666403 CTATTAGAGCACATTTTTATGGG + Intergenic
1071461835 10:85904100-85904122 ATTGTGGAGCACATTTTCAATGG - Intronic
1079773485 11:24494557-24494579 GTAGGGGAGTACATCTTGAAAGG - Intergenic
1080127021 11:28747016-28747038 CTAGTGGAATACTTCTTTTAAGG + Intergenic
1083386738 11:62316632-62316654 TTAATGGACCACATCTTTGAAGG - Intergenic
1083736152 11:64682456-64682478 CTCGGGGACCACATCTTTGAGGG + Intronic
1087338442 11:96871796-96871818 CTACTGGAGAATACCTTTAAAGG + Intergenic
1088077502 11:105869021-105869043 CTAGTCCAGCAGATCTGTAAAGG - Intronic
1091203409 11:133800352-133800374 CTAGATGAGGATATCTTTAAAGG + Intergenic
1099455169 12:82854428-82854450 TGAGTGGAGCACATATGTAATGG - Intronic
1099721731 12:86370877-86370899 CTAAAGGAGCAAATTTTTAAGGG - Intronic
1105671406 13:22620549-22620571 CTATTGTAGAACATCTATAAAGG - Intergenic
1106628301 13:31443200-31443222 TGAGTGGAGAGCATCTTTAAGGG + Intergenic
1106751428 13:32773463-32773485 ATAATGGAGAACATCTTTTATGG + Intronic
1108483761 13:50904227-50904249 AAAGTGGAGCACTTCTGTAATGG + Intergenic
1109404608 13:61880308-61880330 CTAGCGGAGAACATCGATAATGG + Intergenic
1109584700 13:64384113-64384135 CTACTGGACCACAACTGTAATGG - Intergenic
1112316302 13:98364983-98365005 CTAGAACAGCACATCTTTGAGGG - Intronic
1114366922 14:22037873-22037895 CGAGATGAGCACATATTTAATGG + Intergenic
1115999004 14:39223259-39223281 TTAGTGGAGTACATTTTTATTGG + Intergenic
1117593654 14:57304072-57304094 TTGGTGCAGCACATCTTTGAAGG - Intergenic
1117712081 14:58541293-58541315 CTAGTGGAGCACATCTTTAATGG + Intronic
1119599118 14:75962926-75962948 CTAACTGAGCACTTCTTTAATGG + Intronic
1120020355 14:79523327-79523349 CTAAAGGAGCAAAGCTTTAATGG + Intronic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1130368778 15:83264870-83264892 CTAGTGGACTACATTTTTAGAGG - Intronic
1131591258 15:93751106-93751128 GAAGTGAAGGACATCTTTAAGGG + Intergenic
1140751275 16:78026250-78026272 CTTATGAAGCACATGTTTAAGGG + Intronic
1149968539 17:61192706-61192728 TTGGTGAAGCACATTTTTAAAGG - Intronic
1150662866 17:67100557-67100579 ATAGTGAAGCACATCTTAAATGG + Intronic
1154008639 18:10556986-10557008 CTCGTGGAGCACATTTTAATGGG - Intergenic
1157343765 18:46804769-46804791 CTATTGGAGCACAACTTTGGTGG + Intergenic
1165014088 19:32868305-32868327 TTTGTGAAGTACATCTTTAAAGG - Intronic
925028721 2:632279-632301 CTAATGGAGCTCATTATTAAAGG + Intergenic
926924003 2:17968470-17968492 CTTGTGGCTCACAGCTTTAATGG + Intronic
928596381 2:32862960-32862982 CTAATGGAACACATCTACAAAGG - Intergenic
928725601 2:34170589-34170611 CTGGTGGAGCTGATTTTTAATGG - Intergenic
929266307 2:39922367-39922389 CTAGGGGAGCACTTCTCTCAGGG - Intergenic
937568007 2:123319687-123319709 ATGGTGGAGCTCATATTTAAGGG + Intergenic
938386886 2:130872971-130872993 CCTGTGGAGCACACCTTTAGAGG + Intronic
938990759 2:136626869-136626891 ATAGTGGACCACACCTATAATGG - Intergenic
943278017 2:185893059-185893081 CTAGGGGTGAACATCTGTAAAGG + Intergenic
947116615 2:226778342-226778364 CTAGTGGATAACAGCTTTTATGG - Intronic
1175174569 20:57103168-57103190 TTAGTGGAGCAGGTATTTAAGGG - Intergenic
1176932634 21:14831295-14831317 CAAGTGAAGCACATCTTTGGGGG - Intergenic
1178274581 21:31225452-31225474 CTAGAAGAGCACATCATTGATGG + Intronic
1178814070 21:35911392-35911414 CAAGTGGAGGACATCTATGATGG - Intronic
951599705 3:24360063-24360085 TTACTGGAGCACATCTTTAGGGG - Intronic
955266830 3:57452151-57452173 CCAGTGGAGCATATCTGTATCGG - Intronic
955545443 3:60023739-60023761 CTAGTTGAGCCTATCTATAAAGG - Intronic
956024506 3:64968697-64968719 CTATAGGAGAACATGTTTAAAGG - Intergenic
959256922 3:104027224-104027246 CTAGTTGTGCACATCGTTACTGG + Intergenic
961608775 3:128119593-128119615 CTTGTGGAGCTCATGTTTTAGGG + Intronic
962529157 3:136262921-136262943 CTAGTTGAATACATCTTTATGGG + Intronic
966570247 3:181433531-181433553 GACTTGGAGCACATCTTTAAAGG - Intergenic
966692191 3:182753485-182753507 CTCCTGGACCACTTCTTTAAGGG + Intergenic
971042659 4:22771500-22771522 CAAATGGAACACATCTTTTATGG + Intergenic
971065755 4:23030875-23030897 CTGTTGGATAACATCTTTAAGGG + Intergenic
972731016 4:41795244-41795266 TTAGTGGAGCACACATTAAAAGG - Intergenic
972865175 4:43223055-43223077 CTACTGTGGCACATCTGTAAGGG + Intergenic
978478393 4:109159223-109159245 GTACTGGAGCATATTTTTAAAGG - Intronic
985151211 4:186948788-186948810 CAAGTGGAGCACATCTTGTGGGG + Intergenic
988329011 5:29810534-29810556 GTAGTTGCGCACATCTTTATAGG + Intergenic
990035458 5:51312864-51312886 TTTGTGGAGCACAACTTTACAGG - Intergenic
991308479 5:65208457-65208479 CTAGTGAAGGAGATCTTTATGGG + Intronic
1012688868 6:102288796-102288818 CTAGTGGAACACATTTGAAAAGG - Intergenic
1015317554 6:131833627-131833649 CAAATGGAGCAAATGTTTAAAGG - Intronic
1015374309 6:132492242-132492264 CTCGTTGAGCACATATTTGAAGG - Intronic
1016902120 6:149113321-149113343 CTCGTGGAGCAGATTTTTATGGG - Intergenic
1017247450 6:152241677-152241699 CTAGAGGAGCATATGTGTAAGGG + Intronic
1021006839 7:15407400-15407422 CTCTTGAAGCCCATCTTTAATGG - Intronic
1021923517 7:25512068-25512090 CTAGTGCAGCCAATCTTTTACGG + Intergenic
1024134803 7:46395575-46395597 ATAGAGGTGCACATTTTTAAAGG - Intergenic
1033001213 7:137507292-137507314 CTTGTGGATGACATTTTTAATGG - Intronic
1037448097 8:18988250-18988272 CTAGTGGAGCAGATTTATCAGGG - Intronic
1038120821 8:24612731-24612753 CCAGGACAGCACATCTTTAAGGG + Intergenic
1044395521 8:91706263-91706285 CCAGTGCAGCACTTCTGTAAAGG - Intergenic
1045161938 8:99557714-99557736 CTCGTAGAGAACATTTTTAAAGG + Intronic
1051133543 9:13891413-13891435 CTAGTGTATTACATTTTTAAAGG + Intergenic
1053154680 9:35768712-35768734 CTAGAGGAGCACTTCCTCAAGGG + Intergenic
1053183350 9:35993132-35993154 CTTCTGGAGCACATATTTACAGG + Intergenic
1056170284 9:83979473-83979495 CCAGTGGAGCACATACTTAGCGG - Intronic
1194812674 X:98405195-98405217 CTAGTGGAGCCCATGTTGTAAGG + Intergenic
1195381456 X:104274817-104274839 CTACTGGGTCACATATTTAAGGG + Intergenic
1196892181 X:120302026-120302048 CTATGAGAGCACATTTTTAAAGG + Intronic
1197207778 X:123804690-123804712 CTAGAGGAGCAAATCAATAAAGG - Intergenic
1199069472 X:143459720-143459742 CCAGAGGAGTACATCTCTAATGG + Intergenic
1200545876 Y:4517955-4517977 CTCATGGAGCACATCTGTTAGGG - Intergenic