ID: 1117716819

View in Genome Browser
Species Human (GRCh38)
Location 14:58589598-58589620
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 13, 1: 53, 2: 62, 3: 56, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117716813_1117716819 15 Left 1117716813 14:58589560-58589582 CCCAGTAGTCATTCAGGAGCAGG 0: 6882
1: 3380
2: 1919
3: 1766
4: 2040
Right 1117716819 14:58589598-58589620 GTAGTTGAGCGGTTTTGAGTGGG 0: 13
1: 53
2: 62
3: 56
4: 96
1117716815_1117716819 14 Left 1117716815 14:58589561-58589583 CCAGTAGTCATTCAGGAGCAGGT 0: 7186
1: 3446
2: 1974
3: 1828
4: 2105
Right 1117716819 14:58589598-58589620 GTAGTTGAGCGGTTTTGAGTGGG 0: 13
1: 53
2: 62
3: 56
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117716819 Original CRISPR GTAGTTGAGCGGTTTTGAGT GGG Intergenic
900701707 1:4052720-4052742 GAACTTGAGAGGTCTTGAGTTGG - Intergenic
900817914 1:4864060-4864082 GTAGTTGAATGGTTTTGAGTGGG + Intergenic
906558132 1:46731181-46731203 GTAGTTGTGCGGGTTTGAGTGGG - Intergenic
907876345 1:58492109-58492131 GTGGTTGAGTGGTTTTGAGTGGG - Intronic
911966051 1:104373374-104373396 GTAGTTGAGTGGTTTTGAGTGGG - Intergenic
912276594 1:108264736-108264758 GTAGTCGTGTGGTTTTGAGTGGG - Intergenic
912284288 1:108352034-108352056 GTAGTTTTGCTGTTTTGAGTGGG + Intergenic
912291634 1:108429621-108429643 GTAGTCGTGTGGTTTTGAGTGGG + Intronic
913149769 1:116029342-116029364 TTCATGGAGCGGTTTTGAGTTGG + Intronic
913344280 1:117792638-117792660 GTTGTTGAGGGGTTGGGAGTAGG + Intergenic
914375178 1:147066751-147066773 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
916343416 1:163761151-163761173 GTAGCTGTGTGGTTTTGAGTGGG - Intergenic
916553217 1:165870110-165870132 GTATTTGATCTGTTTTGAGGTGG + Intronic
917774380 1:178318089-178318111 GTAGTTGAGCGGCTTTGAGTGGG + Intronic
918786628 1:188771688-188771710 GTAGTTGTGGGGTTTTGAGTGGG - Intergenic
918967966 1:191376083-191376105 GTAGTTGTGTGGTTTTGAATGGG + Intergenic
919254899 1:195108490-195108512 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
920359470 1:205403998-205404020 GTAGTTGAGTGGTTTTGAGTGGG + Intronic
921401110 1:214724975-214724997 GTAGTTGTGTGGTTTTGAGTGGG + Intergenic
922260249 1:223935138-223935160 GTAGTTGAGGGGATTTCAATTGG + Intergenic
924296300 1:242589773-242589795 GTAGTTGAGCGGTTTTGAGCAGG - Intergenic
924341418 1:243037689-243037711 GTAGTTGAGGGGATTTCAATTGG + Intergenic
924871933 1:248056649-248056671 GTAGTTGTGTGGTTTTGAGGGGG + Intronic
1063056774 10:2513464-2513486 GTAGTGCAGGTGTTTTGAGTTGG + Intergenic
1064020723 10:11806395-11806417 GCCATTGAGCGTTTTTGAGTAGG + Intergenic
1065621880 10:27590151-27590173 GTAGTTGTGCATTTTTGAGTGGG - Intergenic
1066735052 10:38467736-38467758 GTAGTTGAGGGGATTTCAATTGG - Intergenic
1066784913 10:38992907-38992929 GTAGTTGAGCGGTTTTGAGTGGG + Intergenic
1066992510 10:42529505-42529527 GTAGTTGAGCGGTTTTGAGTGGG + Intergenic
1067207357 10:44230784-44230806 GAAATTGTGTGGTTTTGAGTGGG + Intergenic
1071975587 10:90952597-90952619 GTAGTTGTGCAGTTTTGACTGGG + Intergenic
1072854519 10:98933260-98933282 GTAGTGGTGTGGTTTTGAGTGGG + Intronic
1074506029 10:114071627-114071649 ATATTTGAGTGGTTTTCAGTGGG + Intergenic
1075636006 10:124030770-124030792 GAAGTTGAGCTGTTTGGAGAGGG + Intronic
1079690513 11:23411141-23411163 GTAGTTGTGTGGTTTTAAGTGGG + Intergenic
1079903014 11:26211202-26211224 GTAGTCGTGCAGTTTTGAGTGGG - Intergenic
1080591417 11:33726375-33726397 GTAGTTGTGCGGTTTTGAGTGGG - Intronic
1081760220 11:45571753-45571775 GAAGGTGAGTGGTTCTGAGTTGG + Intergenic
1083062555 11:59889592-59889614 GTAATTGTGTGGTTTTGAGTGGG + Intergenic
1085334900 11:75685430-75685452 GTAGTTGTGTGGTTTTGAGTGGG + Intergenic
1086897993 11:92335703-92335725 GTAGGTTAGTGGTTTTGAGGTGG + Intergenic
1087513754 11:99130806-99130828 GTAGTTGTGTGGTTTTGAGTTGG - Intronic
1087598973 11:100288453-100288475 GTAGTTGAGCGGTTTGGGTGAGG - Intronic
1090518205 11:127451006-127451028 CTAGTTGAGTGATTTTGAGCAGG - Intergenic
1090547303 11:127779993-127780015 GTAGTTGAGCAGCTTTGAGTGGG + Intergenic
1091158935 11:133401743-133401765 TTAGTTGTGAGATTTTGAGTGGG - Intronic
1092152024 12:6255871-6255893 GTGGATGAGAGGTTTTGGGTAGG - Intergenic
1092581391 12:9846806-9846828 GTAGTTGTGCAGTTTTGAGTGGG + Intergenic
1093332347 12:17858250-17858272 GTAGTTCAGCGGCTTTGAGTGGG - Intergenic
1093604457 12:21073501-21073523 TTAGTTCACCGGTTTTGTGTGGG + Intronic
1094378078 12:29812433-29812455 GTAGTTGAGCAGTTTTGAATGGG - Intergenic
1094451905 12:30591193-30591215 GTAGTGGAGCGGTTTTGAGTGGG - Intergenic
1095128641 12:38511171-38511193 GTAGGTGTGCGGTTTTGAGTGGG - Intergenic
1095337127 12:41042212-41042234 GTAGTTGAGCAGTTTTGAGTGGG + Intronic
1095595579 12:43953999-43954021 GTAGTTGTGTGGTTTTGAGTAGG - Intronic
1095768548 12:45924552-45924574 GGAGTTGGGGGGTTTTGAGAAGG + Intronic
1096015807 12:48273391-48273413 GTAGTTTTGTGGTTTTGAGTGGG + Intergenic
1096398587 12:51286704-51286726 ATAGATGCGGGGTTTTGAGTAGG - Intronic
1097498732 12:60376138-60376160 GTAGTTGTGTGGTTTGGAGTGGG - Intergenic
1098395849 12:70015761-70015783 GTAGTTGAGCAGCTTTGAGTGGG - Intergenic
1098764273 12:74466811-74466833 GTAGTTGTGTGGTTTTTAGTGGG + Intergenic
1099253461 12:80287193-80287215 GTAGTTGTGCAGTTTTGAGTGGG + Intronic
1100136551 12:91559627-91559649 ATAGTTGCATGGTTTTGAGTGGG - Intergenic
1100327969 12:93558719-93558741 ATAGTTGTGTGGTTTTGAATGGG - Intergenic
1102933362 12:116878910-116878932 GGAGTTTCGCTGTTTTGAGTCGG - Intronic
1103013484 12:117476030-117476052 TTAGCTGAGTGGTTCTGAGTGGG - Intronic
1105458275 13:20560867-20560889 GAAGTAGAACAGTTTTGAGTTGG - Intergenic
1106348710 13:28906551-28906573 ATAGTTGAGCAGTTTTGAGTGGG + Intronic
1107289547 13:38837237-38837259 GTAGTGGTGTAGTTTTGAGTGGG + Intronic
1107314536 13:39117261-39117283 GTAGTTGTGTGGTTTTTAGTGGG + Intergenic
1108859639 13:54840311-54840333 GAAGTTGGGCAGTTTTTAGTTGG + Intergenic
1109615691 13:64830860-64830882 ATAGTTGTGCGGTTTTGAGTGGG - Intergenic
1110020232 13:70460245-70460267 GCAGTTTTGCGGTTTTGAGTGGG - Intergenic
1110557990 13:76882519-76882541 GGAGTTGAGCAGATTTGAGAAGG + Exonic
1110824988 13:79961277-79961299 ATAGTTGTGCAGTTTTTAGTGGG - Intergenic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1112484333 13:99806809-99806831 GTAGTTGAGCTGCTGGGAGTTGG + Intronic
1116412808 14:44645060-44645082 GTAGTTGAGCGGCTTTGAGTGGG + Intergenic
1117716819 14:58589598-58589620 GTAGTTGAGCGGTTTTGAGTGGG + Intergenic
1121707058 14:96004787-96004809 GTAGTTGTGTGGTTTTGAGTGGG - Intergenic
1123884854 15:24716155-24716177 GTAGCTGTGTGGTTTTGAGGAGG + Intergenic
1129566654 15:76630595-76630617 GTAGTTGTGTGGTTTTGCGTGGG + Intronic
1131584459 15:93678109-93678131 GTAGTTGAGCGGCTTTGAGTGGG - Intergenic
1132282307 15:100630654-100630676 GTATTTGAACGTTTTTGTGTGGG + Intronic
1135924109 16:26677127-26677149 GTGGTTGAGTGGTAGTGAGTTGG - Intergenic
1141570473 16:84930756-84930778 GTAGTTCAGTGGGTGTGAGTGGG + Intergenic
1143046283 17:4082642-4082664 GTACTTGAGCGGGTTTTAGTGGG - Intronic
1144210817 17:13013837-13013859 GTCGTTGAGTTGCTTTGAGTTGG - Intronic
1145738591 17:27252044-27252066 GTAGTTGTGCAGTTTTGAGTGGG - Intergenic
1146420559 17:32681548-32681570 GTAGTTGAGCGGCTTTGAGTGGG + Intronic
1150507534 17:65714898-65714920 GCAGTTGAAAGCTTTTGAGTAGG + Intronic
1155127046 18:22888203-22888225 GTAGTTGATCAGTTTTGAGTGGG - Intronic
1156084845 18:33385557-33385579 GTAGTTGTGTGGTTTTGAGTGGG - Intronic
1156276907 18:35592586-35592608 GCTGTTGAAAGGTTTTGAGTAGG + Intronic
1156529668 18:37803204-37803226 GTAGCTGTGTGGTTTTGAGTGGG + Intergenic
1156947680 18:42854868-42854890 GTAGTTGTGTGATTTTAAGTTGG - Intronic
1157062021 18:44302692-44302714 GTAGCTGAGCGGTTTTGAGTGGG - Intergenic
1158728838 18:60000991-60001013 GTAGTTGCATGGTTTTGAGTGGG + Intergenic
1159076924 18:63690908-63690930 GTAGTTGTGTGGTTTTGAGTGGG - Intronic
1162172128 19:8799142-8799164 GTAGTTGAGCAGTTTTGAGTGGG + Intergenic
1167706939 19:51086696-51086718 GGAGGTGAGTGGTTTCGAGTAGG + Intergenic
926475119 2:13312269-13312291 GCAGTTGTGTGGTTTTGAGTGGG + Intergenic
929272451 2:39987371-39987393 GTAGTTGAGGGGTTTTGAGTGGG - Intergenic
929275933 2:40024670-40024692 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
930951589 2:57149403-57149425 ATAGTTGTGTTGTTTTGAGTGGG - Intergenic
931498541 2:62838185-62838207 GTAGTTGAGCGGCTTTGAGTGGG - Intronic
932050388 2:68392450-68392472 GTTGTTGATGGCTTTTGAGTAGG - Intronic
933016812 2:77138317-77138339 GTAGTTGAGTGGTTTTGAATGGG - Intronic
933018769 2:77164658-77164680 GCAGTTGAGCGGTTTTGAGTGGG - Intronic
933618390 2:84508864-84508886 GTAGTTGAGCAGTTTTGAGTGGG + Intergenic
933792951 2:85897708-85897730 GTATCTTAGGGGTTTTGAGTTGG - Intergenic
934316344 2:91923883-91923905 GTAGTTGAGCAGCTTTGAGTGGG - Intergenic
935489113 2:103695593-103695615 GTAGTTGTGTGGCTTTGAGTAGG + Intergenic
935604462 2:104956903-104956925 GTAGTTGTGCAGTTTTGAGTGGG + Intergenic
936576417 2:113659888-113659910 GTAGTTGAGCAGTTTTGAGTGGG - Intergenic
936782606 2:116052238-116052260 GTAGTTGAGCGGCTTTGTGTGGG + Intergenic
937452775 2:122015974-122015996 GTAGTTGAGCGGCTTTGAGTGGG + Intergenic
938403292 2:131012107-131012129 GTGGCTGAGCAGTTTTGGGTGGG + Intronic
941238578 2:163008285-163008307 TAAGTTGAGAGGTTTTGATTTGG - Intergenic
941524058 2:166584084-166584106 GTAGTTGAGTGGTTTTGAGTGGG - Intergenic
942285028 2:174407756-174407778 GTAGTTGAGCGGCTTTGAGTGGG + Intronic
942493145 2:176510114-176510136 GTAGGTGATCGGTTGGGAGTGGG + Intergenic
944197045 2:197065148-197065170 GTAGTTGAGTGGTTTTGAGTGGG - Intronic
945164579 2:206929230-206929252 GTAGTTGTGTGGTTTGGGGTAGG - Intergenic
946649059 2:221871573-221871595 GTAGTTGTGTGGTTTTCAGTGGG - Intergenic
949083973 2:242132438-242132460 GTAGTTGAGGGGATTTCAATTGG - Intergenic
1169567918 20:6876070-6876092 GTAGTTGGAAGCTTTTGAGTTGG - Intergenic
1171054248 20:21890363-21890385 GTAGTTGAGCGGCTTTGAGTGGG - Intergenic
1171514350 20:25716951-25716973 GTAGTTGAGTGGTTTTGAGTGGG + Intergenic
1171560176 20:26117201-26117223 GTAGTTGAGCAGTTTTGAGTGGG - Intergenic
1171575202 20:26303616-26303638 GTAGTTGAGCGGCTTTGAGTGGG - Intergenic
1175201220 20:57279250-57279272 GGCATTGAGCCGTTTTGAGTTGG - Intergenic
1176280559 20:64304928-64304950 GTAGTTGAGGGGATTTCAATTGG - Intergenic
1177287849 21:19075039-19075061 GTAGTTGAGCGGCTTTGAGTGGG + Intergenic
1178033734 21:28557489-28557511 GTAGTTGTGTGATTTTGAGTGGG - Intergenic
1185423990 22:50753433-50753455 GTAGTTGAGCGATTTTGAGTGGG + Intergenic
949209456 3:1480307-1480329 GTAGTTGAGCAGTTTTGAGTGGG - Intergenic
950707998 3:14795111-14795133 GCAGTTGAGCAGTTTTGACGCGG + Intergenic
951178920 3:19636196-19636218 GTGGTTGTGTGGTTTTGAGTGGG + Intergenic
951182896 3:19679972-19679994 GTGGTTGTGTGGTTTTGAGTGGG + Intergenic
951442658 3:22741033-22741055 GTAGCTGAGTGGTTTTGAGTGGG + Intergenic
951480394 3:23155319-23155341 GTGGTTGATCCATTTTGAGTCGG - Intergenic
957010984 3:75006174-75006196 GTAGTTGTGTGGTTTTGAGTGGG + Intergenic
958076997 3:88693149-88693171 GTAGTTGTGTGGTTTTTAGTGGG - Intergenic
958172992 3:89960533-89960555 GTAGTTGAGCGGCTTTGAGTGGG - Intergenic
958205459 3:90385745-90385767 GTAATTGAGCAATTTTGAGTGGG + Intergenic
958515586 3:95111108-95111130 GTATTTGTGTCGTTTTGAGTGGG + Intergenic
959848352 3:111059510-111059532 GTAGTTGTGTGGTTTTGAGTGGG - Intergenic
960567832 3:119154130-119154152 GTAGTTGTGTGGTTTTGAGTGGG + Intronic
964959829 3:162409164-162409186 GTAGTTGTGCAGCTTTGAGTGGG + Intergenic
965522522 3:169682196-169682218 GTAGTTGAGCGGCTTTGAGTGGG - Intergenic
965763462 3:172106082-172106104 GTATTTGATGGGTTTTGAATTGG + Intronic
966652086 3:182312923-182312945 GTAGCTGTGTGGTTTTGAGTGGG + Intergenic
967831210 3:193921717-193921739 GTTGTTGTGCGATTCTGAGTGGG - Intergenic
970002845 4:11382041-11382063 GTAGTGGAGCGGCTTTGAGTGGG + Intergenic
970107234 4:12598311-12598333 GTAGTAGAGTTGTTTTGAGTGGG - Intergenic
970241355 4:14012755-14012777 GTAGTGGAGCGGCTTTGAGTGGG + Intergenic
972173844 4:36379322-36379344 GTAGTTGAGTGGTTTTGAGTGGG - Intergenic
974453038 4:62091626-62091648 GTAATTGTGCAATTTTGAGTGGG + Intergenic
974539555 4:63216829-63216851 GTAGTTGTGTGTGTTTGAGTGGG + Intergenic
974814371 4:66986471-66986493 GTAGTTGTGTGGTTTTGAGTGGG + Intergenic
975247888 4:72141556-72141578 ATAGTTGTGCTGTTTTGAGTGGG + Intronic
975500311 4:75077524-75077546 GTAGTTGTGTGGTTTTGAGTGGG + Intergenic
976524678 4:86073690-86073712 GTAGTTGAGTGGTTTTGAGTGGG + Intronic
976861763 4:89674147-89674169 GTATTTGTGTGGTTTTGAATGGG - Intergenic
977023697 4:91789325-91789347 GTAGTTGAGCGTCTTTCAGTGGG + Intergenic
977410646 4:96658062-96658084 GTATTTGAACAGTTTTGTGTTGG - Intergenic
978328154 4:107582036-107582058 GTAGTTGTGTGGTTTAGAGTGGG - Intergenic
979017206 4:115449983-115450005 GTAGTTGTGCAGTTTTGAGTGGG + Intergenic
979261411 4:118650685-118650707 GTAGTTGAGGGGATTTCAATTGG - Intergenic
979337867 4:119484386-119484408 GTAGTTGTGTGGTTTTGAGTGGG - Intergenic
979581646 4:122367622-122367644 GTAGTTGTGTGGTTTTGAGTGGG - Intergenic
979760329 4:124394769-124394791 GTACTTGAGTGGTTTTGAGTGGG + Intergenic
979827642 4:125258955-125258977 GTAGTTGAATGGTTTGGAGTGGG + Intergenic
980184911 4:129448907-129448929 GTAGCTGTGTGGTTTTGAGTGGG - Intergenic
980583457 4:134784477-134784499 GTAGTTGTGTGGTTTTGAGTGGG + Intergenic
981685546 4:147450553-147450575 GTAGTTGAGTGGCTTTGAGTGGG + Intergenic
982372563 4:154649696-154649718 GTAGTTGTGTGGTTCTGAGTGGG - Intronic
983150429 4:164272654-164272676 GTAGTTGAGGGGATTTCAATTGG + Intronic
983169331 4:164518330-164518352 GTAGTTGTGTGGTTTTGAGTGGG + Intergenic
983582233 4:169320532-169320554 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
984618928 4:181929872-181929894 GTAGTTGTGCAGTTTTGAATGGG - Intergenic
985193725 4:187405715-187405737 GTACTTGTGTGGTTTTGAGTGGG + Intergenic
985367104 4:189243291-189243313 GTAGTTGTGCAGTTTTGAGTGGG + Intergenic
987635050 5:20528597-20528619 GTAGTTGTGTGGTTTTGAGTGGG - Intronic
987837157 5:23176625-23176647 GTAGTTGTGTGGTCTTGACTAGG + Intergenic
987949560 5:24657999-24658021 GTACTTGTGTGGTTTTGAGTTGG + Intergenic
988770872 5:34432057-34432079 GTAGTTGTGCGGTTTTGAGTGGG + Intergenic
989545014 5:42662450-42662472 GTAGTTGAGTGGTTTTGAGTGGG - Intronic
992078150 5:73209906-73209928 GTAGTTGTGCAGTTTTGAGTGGG - Intergenic
992514505 5:77477519-77477541 GTAGTTGAGCGGTTTTGAGTGGG - Intronic
993031447 5:82711239-82711261 GTAGTTGAACGGTTTTGTTAAGG - Intergenic
994574980 5:101566801-101566823 GTAGCTGTGCAGTTTTAAGTGGG + Intergenic
995314552 5:110753269-110753291 GAAGATGAGGGGTTTAGAGTAGG + Intronic
996194076 5:120581812-120581834 GAAATTGTGTGGTTTTGAGTGGG + Intronic
996965516 5:129303391-129303413 GTAATTGTGTGGTTTTGAGTGGG + Intergenic
997080718 5:130734803-130734825 GTAGTTGAGCGGCTTTGAGTGGG - Intergenic
997094982 5:130900376-130900398 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
998268437 5:140684377-140684399 TTAGTTGAGCCAGTTTGAGTTGG - Intronic
998362835 5:141604750-141604772 TTAGTTAAGCGGTTGTCAGTAGG - Intronic
999049243 5:148504338-148504360 GCAGTTGAGCAGTTTTGAGTGGG - Intronic
1000069230 5:157723798-157723820 GTAGCTGTGTGGTTTTGAGTGGG - Intergenic
1001361091 5:171087260-171087282 GTAGTTGTGCAGCTTTGAGTGGG + Intronic
1003971273 6:11301710-11301732 GTAGTTGTGTGGTTTTGAGTGGG - Intronic
1003987820 6:11454659-11454681 GTAGTTGTGTGGTTTTGAGTGGG - Intergenic
1004702916 6:18095708-18095730 CTATTTAAGCTGTTTTGAGTTGG + Intergenic
1005002422 6:21255735-21255757 GTATTTGAGCAATTTTGAATGGG - Intergenic
1005670479 6:28100548-28100570 TGAGTTGTGTGGTTTTGAGTGGG + Intergenic
1006482332 6:34306654-34306676 GTATTTGAGCTGGTTTGTGTTGG - Intronic
1007845346 6:44750270-44750292 GTAGTTGAGCGGTTTTGAGTGGG - Intergenic
1007846065 6:44757780-44757802 GTAGTTGAGCGGCTTTGAGTGGG + Intergenic
1007928836 6:45672673-45672695 GTAGTTGAGCGGCTTTGAGTGGG + Intergenic
1010820433 6:80409175-80409197 GTAGTTGTGTGGTTTTGAGTGGG + Intergenic
1011308521 6:85956201-85956223 GTAGTTGAGTGGTTTTGAGTGGG + Intergenic
1011318441 6:86063089-86063111 GTGGTTTTGCTGTTTTGAGTGGG + Intergenic
1016355357 6:143212289-143212311 GTAGTTGTGGGTTTTTGAGAAGG - Intronic
1018816246 6:167334239-167334261 GTAGTTGAGCGGCTTTGAGTGGG + Intronic
1020694425 7:11395987-11396009 GTAGTTGAGCGGTTTTGAGTGGG - Intronic
1021072076 7:16253401-16253423 GTAGTTGTACAGTTTTGAATGGG + Intronic
1021390879 7:20091289-20091311 GTAGTTGTGTAGTTTTGAGTGGG - Intergenic
1022695425 7:32700830-32700852 GTAGTTGAGCGGCTTTGAGTGGG + Intergenic
1022871454 7:34484377-34484399 GTAGTTGAGTGGGTTTGTATAGG - Intergenic
1023143203 7:37122980-37123002 GTAGTTGAGCAGTTTTGAGTGGG - Intronic
1025042009 7:55654141-55654163 GTAGTTATGTGATTTTGAGTGGG - Intergenic
1028578745 7:92382584-92382606 GTAGTTGTGCGGTTTTGAGTGGG - Intronic
1028644423 7:93079230-93079252 GTAGTTTTGTGGTTTTGTGTGGG - Intergenic
1029886046 7:103873050-103873072 GTAGTTGGGCGGCTTTGAGTGGG - Intronic
1030276777 7:107729718-107729740 TTATTTGAGGGGTTTTTAGTTGG - Intergenic
1030548947 7:110934135-110934157 GTAGTTGGGTGGTTTTGAGGGGG + Intronic
1032942923 7:136815974-136815996 GTAGTTGTGTGGTTTTGAGGGGG + Intergenic
1036554814 8:9849322-9849344 TTAGTTGAGCCATTTTAAGTTGG + Intergenic
1037545193 8:19913290-19913312 GTAGTTGAGCGGTTTTGAGTGGG + Intronic
1037999245 8:23377236-23377258 GTAGTTGAGCAGTTTTGAGTGGG + Intronic
1039154820 8:34543066-34543088 GTCATTGAGCGGTTTTGAGTGGG - Intergenic
1039170632 8:34740883-34740905 GTCGTTGAGCAGTTTTGAGTGGG - Intergenic
1041482242 8:58334453-58334475 GTAGCTGTGTGGTTTTGAGTGGG - Intergenic
1041612936 8:59873099-59873121 GTAGTTGAGCGGCTTTGAGTGGG + Intergenic
1041614044 8:59884688-59884710 GTAGTTGAACAGTTTTGAGTGGG - Intergenic
1041841892 8:62281671-62281693 GTAGTTGAGTGGTTTTGAGTGGG + Intronic
1043700419 8:83280513-83280535 GTAGTTGTGCAGTTTTGAGTGGG - Intergenic
1043716733 8:83496455-83496477 GTAGTTGAGTGGATTTGAGTGGG - Intergenic
1043787633 8:84422845-84422867 GTAGTTGAGCGGCTTTGAGTGGG + Intronic
1043790970 8:84467439-84467461 GTAGTTGAGCAGCTTTGAGTGGG + Intronic
1044315574 8:90746801-90746823 GTAGTTGTGTGGTTTTGAGTGGG + Intronic
1047147894 8:122226193-122226215 TCAGTTGAGCGTTTTTGTGTTGG - Intergenic
1047473614 8:125203800-125203822 GTTGTTGAAAGGTTTTTAGTAGG + Intronic
1050857042 9:10372308-10372330 TTATTTGACAGGTTTTGAGTAGG + Intronic
1051204161 9:14666694-14666716 GTAGTTGAGCGGCTTTGAGTGGG - Intronic
1051230742 9:14952546-14952568 GTAGTTGTAGAGTTTTGAGTGGG - Intergenic
1051843631 9:21426923-21426945 GTAGTTGTGTTGTTTTGAGTGGG + Intronic
1052256585 9:26464519-26464541 GCAGTTGAGTGGTTTTAATTAGG - Intergenic
1054884657 9:70183144-70183166 GTAGTTGTGCAGTTTTGAGTGGG + Intronic
1054886238 9:70202350-70202372 GTAGTTGAGCGGCTTTGAGTGGG + Intronic
1055239543 9:74166791-74166813 GTAATTGTGCGGTTTTGAGTGGG - Intergenic
1055714342 9:79101148-79101170 GTAGTTGAGTGGCTTTGAGTGGG + Intergenic
1186016969 X:5207839-5207861 GTAGTTGAGAGCTTTAGAATAGG - Intergenic
1186278648 X:7968315-7968337 GTAGTTGAGTGGTTTTGAGTGGG - Intergenic
1187605456 X:20877419-20877441 GTAGTTGTGTGGCTTTGAGTGGG - Intergenic
1190604044 X:52121993-52122015 GTAGTTGAGTGGTTTTGAGTGGG - Intergenic
1190991210 X:55552389-55552411 GTATTTGAGCGGTTTTGAGTGGG + Intergenic
1190997820 X:55628497-55628519 GTGGTTGTGTGGTTTAGAGTGGG - Intergenic
1191081134 X:56510809-56510831 GTATTTGTGTGGTTTTGGGTGGG - Intergenic
1191161730 X:57336584-57336606 GTAGTTGTGTGGTTTGGTGTGGG - Intronic
1191651229 X:63539857-63539879 GCAGTTGTGTGGTTTTGAGTGGG - Intergenic
1191929050 X:66348793-66348815 GTACTTGAGTGGTTTTGAGTGGG - Intergenic
1192936156 X:75860509-75860531 GTAGTTGTGCAGTTTTGAATGGG + Intergenic
1194140189 X:90199101-90199123 GTAGTTGTGCAGTTTTGAGACGG - Intergenic
1195212847 X:102667147-102667169 GTAGTTGTGTGGTTTTGAGTGGG + Intergenic
1195622309 X:106969170-106969192 GTAGTTGTGTGATTTTGAGTGGG - Intronic
1195774545 X:108389011-108389033 GTAATTGTGTGGTTTTGAGTGGG + Intronic
1195840409 X:109170236-109170258 GTAGTTGAGGTATTTTGATTTGG + Intergenic
1196168222 X:112558241-112558263 GTAGTTGTGTGGTTTTGAGTGGG - Intergenic
1196172488 X:112605174-112605196 GTAGTTGAGCAGTTTTGAGTGGG - Intergenic
1197049294 X:122039990-122040012 GTAGTTGTGTTGCTTTGAGTGGG + Intergenic
1198489565 X:137125254-137125276 GTAGTTGAGCAGTTTTGAGTGGG - Intergenic
1200485936 Y:3768068-3768090 GTAGTTGTGCAGTTTTGAGACGG - Intergenic
1200889569 Y:8308990-8309012 GTAGTTGAGCGGTTTTGAGTGGG + Intergenic
1201246636 Y:12010672-12010694 GTATTTGAGTGTTTTTCAGTGGG + Intergenic
1202382877 Y:24293058-24293080 GTAGTTGAGGGGATTTCAATTGG - Intergenic
1202487907 Y:25377067-25377089 GTAGTTGAGGGGATTTCAATTGG + Intergenic