ID: 1117721910

View in Genome Browser
Species Human (GRCh38)
Location 14:58637226-58637248
Sequence GTGCGCGCGCGTGCGCGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 2, 1: 1, 2: 6, 3: 36, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117721910 Original CRISPR GTGCGCGCGCGTGCGCGCTT TGG (reversed) Intronic
900206892 1:1435478-1435500 GTGCCTGCGCGTGCGTGCCTCGG + Intronic
900502934 1:3015505-3015527 GTGCACGCTCGTGAGCGCCTTGG + Intergenic
901660147 1:10794197-10794219 GTGCGCGCGCGCGCGCGTCGTGG + Intronic
902586229 1:17439916-17439938 GCGGGCCCGCGAGCGCGCTTTGG + Intergenic
904847475 1:33430948-33430970 GGGCGGGCGCGTGCGCGCTGGGG - Intronic
904940613 1:34163317-34163339 GTGCGCGCGCCTGGGAGCTCTGG - Intronic
905308555 1:37034660-37034682 GAGCGCGCGAGTGTGCGCCTCGG - Intergenic
907526476 1:55056863-55056885 GTGCGTGCGCGCGCGCGCGTTGG + Intronic
910533951 1:88275030-88275052 GCGCGCGCGCGCGCGCGCCTGGG + Intergenic
912684243 1:111749444-111749466 GTGCGCGCGCGCGCGTGCTAGGG + Intronic
914393449 1:147242614-147242636 GGGCGCGCGACTGCGCGCTGGGG - Intronic
917565382 1:176207269-176207291 GTGCGCGCGCGCGCGAGCGGCGG + Exonic
918995791 1:191757534-191757556 GTGCGCGCGCGTGGGTGGGTGGG - Intergenic
919930009 1:202215015-202215037 GTGTGTGCGCGCGCGCGCGTTGG + Intronic
920600601 1:207320872-207320894 GCGCGCGCGCGCGCGCGCCTCGG - Intergenic
1063928891 10:11009355-11009377 GTGTGTGTGCGTGCGCGCGTCGG + Intronic
1069913498 10:71773523-71773545 GTGCGAGCGAGTGAGCGCTGCGG + Intronic
1071997569 10:91163012-91163034 GTGCGCGAGCGCGCGCGCGTGGG - Intronic
1073326219 10:102645196-102645218 GTGTGTGCGCGCGCGCGCGTAGG - Intronic
1074810204 10:117096994-117097016 GTGCGCGCGCGTGCGCGCTTGGG - Intronic
1080779765 11:35419410-35419432 GTGCGGGTGTGTGCGCGCCTGGG + Intronic
1081872890 11:46391384-46391406 GTGCGCCCGGGTGCGCCCGTGGG - Intergenic
1083227520 11:61294431-61294453 GTCCGTGCGTGTGCGCGCGTGGG - Intronic
1083933377 11:65857921-65857943 GTGCGCGCCCGTGGGCGCCGGGG - Intronic
1084995854 11:72977616-72977638 GTGTGAGAGCGTGCTCGCTTCGG - Intronic
1087003831 11:93449027-93449049 GTGCGCGCGTGCGCGCTCCTCGG + Intergenic
1087141439 11:94768887-94768909 GCGCGGGCGCGGGCGCGCCTCGG - Intronic
1088820483 11:113452472-113452494 GCGCGCGCGCGCGCGCACATTGG + Intronic
1089977444 11:122744897-122744919 GTGCGCGCGCGCGCGCACTTGGG + Intronic
1091555212 12:1567874-1567896 GTGTGCGCGCGTGTGCGTGTGGG - Intronic
1092655044 12:10674872-10674894 GTGCGCGCGCGCGCGCGCGCGGG - Intergenic
1093547839 12:20369205-20369227 GTGTGTGCGCGCGCGCGCGTGGG + Intergenic
1093547840 12:20369209-20369231 GTGCGCGCGCGCGCGTGGGTCGG + Intergenic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096481107 12:51941569-51941591 GTGTGTGCGCGCGCGCGCGTGGG - Intergenic
1096994618 12:55830812-55830834 GCGCGCGCGCGTGCGCGCGGTGG - Intronic
1098350782 12:69557618-69557640 GTGCGCGCGCGCGCGCGCGCAGG + Intronic
1099989784 12:89709397-89709419 GTGCGCGCGCGCGCGCGCGGAGG + Intergenic
1100221145 12:92505743-92505765 GTGCGCGTGCGTGTGTGTTTTGG + Intergenic
1102651966 12:114448538-114448560 GTGCGCGCGCGCCAGGGCTTAGG - Intergenic
1102677249 12:114667322-114667344 GTGTGCGCGCTCGCGCGATTAGG - Intergenic
1103188553 12:118981528-118981550 GTGCGTGCGCGTGTGAGCTCCGG - Exonic
1103539956 12:121659120-121659142 GTGTGCGCGCGTGTGTGTTTAGG - Intronic
1103856369 12:123973246-123973268 GAGCGCGCGCGCGCGCGGCTCGG + Exonic
1104313735 12:127677849-127677871 GTGCGCGCGCGTGCATCTTTGGG - Intergenic
1106879229 13:34111257-34111279 GTGCGCACGCATGCGTGTTTGGG + Intergenic
1108408083 13:50124567-50124589 GAGAGCGCGCGCGCGGGCTTCGG - Intronic
1110922491 13:81106116-81106138 GTGTGCGCGCGTGCGCGCACAGG - Intergenic
1112507039 13:99981601-99981623 GTGCGCGCGCGGGTGCGCGCAGG + Intergenic
1112507041 13:99981603-99981625 GCGCGCGCGGGTGCGCGCAGGGG + Intergenic
1112509429 13:99997064-99997086 GTGTGCGCGCGCGCGCCCCTGGG + Intergenic
1117721910 14:58637226-58637248 GTGCGCGCGCGTGCGCGCTTTGG - Intronic
1119325275 14:73756296-73756318 GCGCGCGCGCGTGCGCGCTGAGG + Intronic
1122265916 14:100546761-100546783 GTGCGCGCGCGCGCGCGCGCCGG - Intronic
1123441455 15:20294985-20295007 CTGCGGGGGCGTGCGCGGTTGGG + Intergenic
1126766478 15:52016049-52016071 GCGCGCGCGCGCGCGCGCGATGG - Intronic
1127415135 15:58749925-58749947 GGGCGCGCGCATGCGCGCGGGGG + Exonic
1128791140 15:70434715-70434737 GTGTGCGCGCGCGCGCGCGCGGG - Intergenic
1131263627 15:90902988-90903010 GTGCGCGCGCGGGAGGGCTCCGG + Exonic
1132522305 16:397381-397403 GTGCGCGCACGTGCGGGCTGGGG + Intronic
1132841266 16:1979456-1979478 GGGGGCGCGCGTGCGCGTGTTGG - Exonic
1133020201 16:2963807-2963829 GTGCGAGCGCGTGCGTGCACTGG + Intergenic
1138956860 16:61981682-61981704 GCGCGCGCGCGCGTGCGCTTGGG + Intronic
1141990213 16:87604991-87605013 GTGCGCGCGCGTGCAGGCACAGG + Intronic
1142672050 17:1491831-1491853 GGGCGCGCGCGTGTTCGCTGTGG - Intronic
1143315447 17:6028508-6028530 GTGCGCGCGCGTGTATGTTTTGG + Intronic
1144592648 17:16537516-16537538 GTGCGCGCGCGTGTTAGCTTGGG + Intergenic
1146601968 17:34225231-34225253 GTGCGCGCGTGCGCGCGTGTTGG - Intergenic
1148069373 17:44899162-44899184 GTGTGCGTGTGTGCGCGCTTCGG + Intronic
1154954285 18:21240558-21240580 GTGCGCGCGCGCGCGCGGGCGGG - Intergenic
1156000353 18:32378052-32378074 GTGTGTGCGCGCGGGCGCTTTGG + Intronic
1160962648 19:1730380-1730402 GTGTGTGTGCGTGCGCGCGTTGG - Intergenic
1161051290 19:2165115-2165137 GGGCGCGTGCGTCCGCGCTTGGG + Intronic
1161572001 19:5035887-5035909 GCGCGCGCGCCTGCGCGCACAGG + Intronic
1161707238 19:5827853-5827875 CGGCGCGCGCGTGCGCGGTTGGG + Exonic
1162361248 19:10221781-10221803 GCGCGCGCGCGTGTGCACATAGG - Intronic
1162584514 19:11550920-11550942 GTGTGCACGCGCGCGCGCATTGG - Intergenic
1163126598 19:15247562-15247584 GTGCGCGTGCGTGCGTGTGTCGG + Intronic
1163585603 19:18161876-18161898 GTGCGTGCGCTTGCACGCCTGGG - Intronic
1166555831 19:43699452-43699474 AGGCGCGCGCGTGTGCGCTTGGG + Intergenic
1168408021 19:56120862-56120884 GGGCGCGCGCGTGCGCGTGGCGG - Intronic
925532254 2:4877115-4877137 GTGTGTGCGCGCGCGCGCCTGGG - Intergenic
926020182 2:9487834-9487856 GCGCGCGCGCGCGCGCGCTGTGG + Intronic
926923576 2:17963770-17963792 GTGCGCGCGCGCGCGCGTCCAGG + Intronic
930158849 2:48132581-48132603 GTGCACGCGCGCGCACGCATAGG - Intergenic
931649374 2:64454398-64454420 GGGCGCGCGCGCGCGCGCCCGGG - Exonic
931867127 2:66425559-66425581 GCGCGCGCGCGCGCGCGTTCCGG - Intergenic
933245197 2:79967091-79967113 GTGCGCGTGTGTGCACGCATAGG - Intronic
936038143 2:109128963-109128985 GTGCGCGGGGGTGCGCGCGGAGG - Intergenic
938900482 2:135795030-135795052 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
942034728 2:171999843-171999865 GGGAGCGCGCGTGCGCGCGCGGG - Exonic
944683637 2:202098818-202098840 GTGCACGCGCGCGCGCGCGCAGG + Intronic
945033357 2:205684937-205684959 GTGTGCGCGCTCGCGCGCTGGGG - Intronic
945203696 2:207310047-207310069 GTGCGCGCGCGCGCGCACGCAGG - Intergenic
947625290 2:231614816-231614838 GTGCGTGCGCGCGCGCGCGCGGG - Intergenic
1169132377 20:3173010-3173032 GTGCGCGCGTGTGTGTGCTCGGG - Intronic
1169758873 20:9069291-9069313 GTGCGCGCGCGCGCGCGTCCGGG - Intronic
1171963725 20:31514400-31514422 GTGTGCGCGCGTGCGCGGCGCGG + Intergenic
1172489224 20:35321286-35321308 GCGCGCGCGCGCGCACGCTCAGG + Intronic
1173227282 20:41169249-41169271 GTGCATGCACGTGCGTGCTTGGG - Intronic
1173807494 20:45935192-45935214 GTGCGCGCGCGCGCGCGCGCTGG + Intronic
1175841312 20:62029469-62029491 GTGTGCGCGCGCGCGCACGTGGG - Intronic
1176550496 21:8218949-8218971 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1176577338 21:8446219-8446241 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1177077013 21:16588646-16588668 GTGCGCGCGCGTGCTCGCTCGGG + Intergenic
1179150536 21:38805512-38805534 GTGCGCGCGAGTGTGCGCCCTGG - Exonic
1179225086 21:39445829-39445851 GGGCGCGCGCATGCGCACTCGGG + Intergenic
1179950436 21:44706406-44706428 GTGCGCGCGTGTGTGTGCATGGG - Intronic
1181413296 22:22740185-22740207 GCGCGTGCGCGCGCGCTCTTTGG - Intronic
1181572020 22:23772891-23772913 GGGCGCGCGCGGCCGCGCTGCGG - Exonic
1181574892 22:23787365-23787387 GGGCGCGCGCGCGCGCGCTCGGG + Intronic
1182709619 22:32312346-32312368 GTGCGCGCGCGCGTGTGATTTGG - Intergenic
1185394047 22:50577950-50577972 ATGGGTGCGCGGGCGCGCTTAGG + Intronic
1203255393 22_KI270733v1_random:135290-135312 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
952316865 3:32238982-32239004 GTGTGCGAGCGGGCGCGCTGCGG - Exonic
953631993 3:44625733-44625755 GTGTGCGCGCGCGCGCGCAAAGG - Intronic
956179085 3:66500924-66500946 GCGCGCGCGCGCGCGCTCTCTGG - Exonic
956659449 3:71583630-71583652 GTGCGCGCGCGGGCGGGAGTGGG - Intronic
956681450 3:71785258-71785280 GCGGGCGCGCGTGTGCGCGTGGG - Intergenic
961574538 3:127823487-127823509 GTGTGCGCGCGTGTGCCCGTGGG - Intergenic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
964720740 3:159765160-159765182 GTACGCGTGTGTGCGCGCGTGGG - Intronic
965905959 3:173706820-173706842 GTGTGCGTGCGTGCACGCGTGGG - Intronic
966593007 3:181702020-181702042 GTGTGTGCGCGCGCGCGCATGGG - Intergenic
966982733 3:185153058-185153080 GTGCGCGTGCGTGTGCGCGTGGG - Intergenic
970617442 4:17781352-17781374 GTGCACGTGCGTGCGCGCGCGGG + Exonic
973754884 4:54064683-54064705 GGGCGCGTGCGTGGGCGCGTGGG + Exonic
976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG + Intronic
978489837 4:109301589-109301611 GTGCGCGCGCGTGCATGTGTTGG - Intronic
981604016 4:146522819-146522841 GGGCGCGCGGGTGCCCGCTCTGG + Intergenic
983672166 4:170250617-170250639 GTGTGTGCGCGTGCGAGCTGTGG + Intergenic
984167447 4:176319908-176319930 GGGCGCGCGCGCGCTCGCGTCGG + Intergenic
984260192 4:177435779-177435801 GTGCGTGTGCGTGCACGCTCAGG - Intronic
986330604 5:6713895-6713917 GTGCGCGCGCGGCCGGGCCTCGG + Intergenic
987303420 5:16617006-16617028 GCGCGCGCGCGGGCGCGCCTGGG + Exonic
987901086 5:24013048-24013070 GTGCGCGCGCGCGCAGGCTGTGG + Intronic
989523284 5:42424909-42424931 GCGCGCGCGAGTGTGCGCCTGGG + Intronic
997237158 5:132279342-132279364 GTGCGCGCGCGCGCGCGCGTGGG - Intronic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
1000463315 5:161547823-161547845 GTGCGCGCGGGTGCGCGCAGCGG - Intronic
1001245729 5:170104852-170104874 GTGTGTGCGCGTGCGTGCGTGGG + Intergenic
1002497127 5:179623219-179623241 GTGCGGGCCCGGGCGCGCCTCGG - Exonic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1002559739 5:180072914-180072936 GTGTGCGCGCGCGCGCGTTTCGG - Intergenic
1003290259 6:4774784-4774806 GTGAGCACGCGTGAGTGCTTAGG + Intronic
1007614053 6:43170353-43170375 GTGCGCGAGCGTGCTTGCTTGGG + Intergenic
1007631708 6:43276504-43276526 GTGCGCGGCCGTGTGCGCGTGGG - Intronic
1007702067 6:43771374-43771396 GTGCGTGCGAGCGCGCGCGTGGG + Intronic
1012872899 6:104693055-104693077 GTGCACGCGCGCGCGCGCTGGGG + Intergenic
1013576054 6:111483844-111483866 GGGCGCGCGGGCGCGGGCTTCGG + Intergenic
1017662418 6:156687422-156687444 GCGGGCGCGCGTGCGCGGTGCGG + Intergenic
1018154441 6:160972777-160972799 GTGCGTGCGCGTGCGCGCAATGG - Intergenic
1019474537 7:1237578-1237600 GTGCGCGCGGGGGCGCGCGGCGG - Intergenic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1023319419 7:38976616-38976638 GTGTGTGTGCGCGCGCGCTTCGG + Intergenic
1023447680 7:40248869-40248891 GTGCGAGCGCGCGCGCGCGCTGG - Intronic
1030394492 7:108968546-108968568 GTGCGCGCGCGCGCACTATTTGG + Intergenic
1031213281 7:118858667-118858689 GAGCGCGCGCGCGCGCGCGTGGG - Intergenic
1034349160 7:150405322-150405344 GTGCGCGCGGGGCCGCGCTGGGG + Intronic
1037878411 8:22560871-22560893 GTGCGCGCGCGCACGCGCCGTGG + Intronic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1038767909 8:30446841-30446863 GTGCGCGCGCGCGCGCGCGGTGG + Intronic
1044115311 8:88327743-88327765 GCGCGCGCGCGCGCGCGCCAAGG - Intronic
1044719692 8:95133760-95133782 GGGCGCGCCCGTGCGCGCGCAGG + Intergenic
1047423567 8:124727081-124727103 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
1050445787 9:5721433-5721455 GTGCACGCGCGTGTGTGCTGGGG - Intronic
1051419085 9:16871942-16871964 CTGCAGGCGTGTGCGCGCTTAGG - Intergenic
1054739512 9:68790577-68790599 GTGCGCGCTCATGTGCGTTTGGG - Intronic
1054842662 9:69760012-69760034 GAGCGCGCGCGCGCGCGCGCGGG + Intergenic
1054842663 9:69760020-69760042 GCGCGCGCGCGCGGGTGCTTCGG + Intergenic
1055030368 9:71767873-71767895 GCGCGCGCGCTTGTGCGTTTGGG - Intronic
1055158921 9:73100353-73100375 GCGCGCGCGCGCGCGTGCATAGG + Intergenic
1056341589 9:85639350-85639372 GTGTGCGCGTGCGCGCGCATGGG - Intronic
1059269328 9:113062085-113062107 GTGTGCGCGCCCGCGTGCTTGGG + Intergenic
1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059272734 9:113078426-113078448 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1062259174 9:135650766-135650788 GTGTACGCGCGTGCATGCTTAGG + Intergenic
1185747350 X:2583817-2583839 GTGCGCTCGTGCGGGCGCTTTGG - Intergenic
1187265002 X:17723769-17723791 GTGCGCGCGCGTGCGCGCATGGG + Intronic
1188597812 X:31922522-31922544 GTGTGCGCGCGCGTGCGCTAGGG + Intronic
1188597814 X:31922524-31922546 GTGCGCGCGCGTGCGCTAGGGGG + Intronic
1189310749 X:40015422-40015444 CTGCGAGTGTGTGCGCGCTTAGG - Intergenic
1189322889 X:40097150-40097172 GTGGGCGGGCGGGCGCGCTGAGG - Intronic
1198441506 X:136667841-136667863 GTGCGTGCACGTGCGCGCTTGGG - Exonic
1199760116 X:150898700-150898722 CCGCGCGCGCGCGCGGGCTTTGG - Exonic