ID: 1117722208

View in Genome Browser
Species Human (GRCh38)
Location 14:58638569-58638591
Sequence AGCACGGCTGTTCCTGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117722208 Original CRISPR AGCACGGCTGTTCCTGCCCA GGG Intronic
900319148 1:2073968-2073990 AGCACGGCTGGCCCGGCCCCGGG - Intronic
901417583 1:9128429-9128451 AGCCCCGCTGTGCCTGCCCCAGG - Intronic
902737694 1:18412208-18412230 AGCCTGGCTGTACCTCCCCAGGG - Intergenic
902851368 1:19160174-19160196 AGCACGGCTGCTGCTCCCGACGG + Exonic
904276035 1:29384829-29384851 AGCACGTCTGTCCCAGCCCTAGG - Intergenic
905369970 1:37477643-37477665 AGCTAGGCTGCTCCTGCCCCAGG - Intronic
905538380 1:38741497-38741519 TGCAGGGCTTTTCCAGCCCAGGG - Intergenic
907326417 1:53641363-53641385 AGGAAAGCTGTTCCTTCCCAGGG - Intronic
908598923 1:65718408-65718430 AGCACTTCTGGTCCTGCCCAGGG - Intergenic
911634074 1:100213832-100213854 AGCGCTGCTGCTCCTGCCCCAGG + Intronic
912518618 1:110230791-110230813 AGCACCTCTGGGCCTGCCCAGGG + Intronic
915283348 1:154837648-154837670 AGACTGGCTCTTCCTGCCCAGGG - Intronic
919791492 1:201293599-201293621 AGCACGGCCATTCCAGCCCAGGG - Intronic
923096209 1:230777319-230777341 ACCAGGGCTGAGCCTGCCCAAGG + Intronic
923663572 1:235979520-235979542 AGCACGTCTGTTCTTTCCCCAGG - Intronic
924629274 1:245721692-245721714 AGCACCTCTGGACCTGCCCAGGG + Intergenic
1062852856 10:759192-759214 AGCAAGGCTGCTGCTGCCCCAGG + Intergenic
1062868967 10:882037-882059 AGCATGTTTGTGCCTGCCCAAGG + Intronic
1062876362 10:945941-945963 ATCAAGGCTGTTCCTGCTGAGGG - Intergenic
1063592669 10:7408615-7408637 CGCGCGGCGGTTCCTGCCCGAGG - Intronic
1067793760 10:49306321-49306343 AGCCCGGCTGTGCCCGCCCCTGG - Intronic
1068326907 10:55502306-55502328 AGAAGGGCTGTTACTGCCAATGG - Intronic
1069743431 10:70699984-70700006 AGAGGGGCTGTTCCTGCCCCTGG - Intronic
1072954992 10:99880240-99880262 AGCACGGCAGCTCCTCCCCCAGG - Exonic
1075093499 10:119456429-119456451 AGCAGGGCTGTCCATCCCCAGGG + Intronic
1075664097 10:124218588-124218610 AGCAAGGCTGAGCCTGCCCCTGG - Intergenic
1076289871 10:129337112-129337134 GGCAAGGCTGTTCCCTCCCATGG + Intergenic
1076675717 10:132146552-132146574 AGGACACCTGTCCCTGCCCATGG - Intronic
1076930015 10:133525890-133525912 TGGACAGCTGTTTCTGCCCAGGG + Intronic
1077051172 11:567790-567812 ACCACACCTGTGCCTGCCCAGGG + Intergenic
1077130504 11:969877-969899 AGCTGGGCTGCACCTGCCCAGGG + Intronic
1080818781 11:35785349-35785371 AGCAAGGCTATTCTTGCCCCAGG - Intronic
1081842319 11:46211545-46211567 GTCACTGCTGCTCCTGCCCAGGG + Intergenic
1083640243 11:64141515-64141537 AGCTCGGCTGTGCCTTGCCAAGG + Intronic
1085026225 11:73238176-73238198 TGCCCAGCTCTTCCTGCCCAGGG + Intergenic
1090228005 11:125083084-125083106 GGCACTGTTGTTCCTCCCCAGGG - Intronic
1091205940 11:133821156-133821178 AGCAGGGGTGCTCCTGCCCAGGG - Intergenic
1091314032 11:134598250-134598272 TGCACGGTTCTCCCTGCCCAAGG + Intergenic
1096070621 12:48773697-48773719 TGCAGGGCTCTCCCTGCCCAAGG - Intronic
1098207843 12:68132203-68132225 AGCACGTCTGGACATGCCCAGGG - Intergenic
1102558182 12:113742586-113742608 AGCGCCGCTGCTGCTGCCCAGGG - Intergenic
1103000918 12:117384756-117384778 AGCCCCCCTGTCCCTGCCCAAGG - Intronic
1113618375 13:111696731-111696753 AGGAAGGCTGTTTCTGGCCAGGG + Intergenic
1113623907 13:111781992-111782014 AGGAAGGCTGTTTCTGGCCAGGG + Intergenic
1115102242 14:29716414-29716436 AGAACAGCTGTCCCTGCCTAAGG - Intronic
1117508548 14:56426166-56426188 AGCCCTCCTGTTCCTTCCCAAGG + Intergenic
1117722208 14:58638569-58638591 AGCACGGCTGTTCCTGCCCAGGG + Intronic
1118846017 14:69548288-69548310 AGCACAGCTGGACCTGCGCAGGG - Intergenic
1119368562 14:74117590-74117612 AGAATGACTGTTTCTGCCCATGG + Intronic
1120640050 14:86999850-86999872 AGCCTGGCTGTTCATGCCTAAGG + Intergenic
1123072324 14:105647848-105647870 AGCACTGCTGACCCTGCCCTGGG + Intergenic
1123078286 14:105680144-105680166 AGCACGCCTGGCCCTGCCCCTGG + Intergenic
1123092332 14:105747367-105747389 AGCACTGCTGACCCTGCCCTGGG + Intergenic
1131269705 15:90939573-90939595 GGCAAGTCTCTTCCTGCCCAGGG + Intronic
1135976239 16:27110373-27110395 GGCGCGGCTGATCCTGCCTAGGG + Intergenic
1137347211 16:47675251-47675273 AGCCCCGCTGTTACTGACCAGGG - Intronic
1139365791 16:66432762-66432784 ACCAAGGGTGTTCCCGCCCAGGG + Intronic
1140187639 16:72788788-72788810 AGCACAACTGTTCCTTCCCCTGG - Exonic
1141205391 16:81929295-81929317 AGCATGCCCGTGCCTGCCCAGGG - Intronic
1142320849 16:89382024-89382046 AGCACGACTGTCCAGGCCCAGGG + Intronic
1142606211 17:1082549-1082571 AGCACGCGTGTTCCCGGCCAGGG + Intronic
1143118691 17:4594582-4594604 AGCCCGGAACTTCCTGCCCACGG + Intronic
1143300145 17:5902808-5902830 GGCACACCTGTTCCTCCCCAGGG + Intronic
1143742865 17:8966598-8966620 AGCACTGCTGTTCCAGCCTCTGG + Intergenic
1144119934 17:12142456-12142478 AGCAGGGATGTTCCTTACCAAGG + Exonic
1146387837 17:32393380-32393402 AGCATGGTGGTTCATGCCCATGG + Intergenic
1148694454 17:49550494-49550516 AGCCCTCCTGTTCCTGCCCTCGG - Intergenic
1149362598 17:55910995-55911017 AGCACAGCTGTGGCTGCCCCAGG - Intergenic
1151840366 17:76613191-76613213 AGCACGGCTGTTCCCTCCCCGGG - Intergenic
1151944081 17:77309927-77309949 AGCACAGATGTGCCTGCCCGGGG - Intronic
1154253476 18:12763851-12763873 AGCACGGCTGCTTCTGGCCAGGG - Intergenic
1155215736 18:23641608-23641630 ACCCAGGCTGTTCCTGCCAAGGG - Intronic
1156392765 18:36666156-36666178 AGCCCTGCTATTCCTTCCCATGG + Intronic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1158894639 18:61901390-61901412 AGCACCCCTGTACCTGCCCCAGG + Intergenic
1158898355 18:61936992-61937014 AGCACGTCTGTGCATGCTCAAGG - Intergenic
1160266193 18:77342260-77342282 AGGACAGCTGTGCCTGCCCCAGG + Intergenic
1160915143 19:1492868-1492890 GGCCCGGCTGTGCCTGCCCCCGG + Intronic
1162359026 19:10206476-10206498 AGTGCTGCTGTTCCTGCCCAGGG - Intronic
1167981442 19:53279680-53279702 ATCACTGCTGGTCCTGCCCGAGG - Intergenic
1168121350 19:54254119-54254141 AGCCCGGCTGCTCCTCCCCCAGG + Intronic
1168124862 19:54277651-54277673 AGCCCGGCTGCTCCTCCCCCAGG + Intronic
1168132892 19:54332278-54332300 AGCCCGGCTGCTCCTCCCCCAGG + Intergenic
1168177124 19:54633898-54633920 AGCCCGGCTGCTCCTCCCCCAGG - Intronic
1168488830 19:56790044-56790066 AGAGCTGCTGTTCCTTCCCATGG - Intronic
928027006 2:27748728-27748750 TGCATGGATGCTCCTGCCCACGG + Intergenic
934571913 2:95377933-95377955 AGGACAGCGGTGCCTGCCCAGGG + Intronic
935657007 2:105431800-105431822 TGCCTGGCTGCTCCTGCCCAAGG + Intronic
936390104 2:112064708-112064730 AGCAAGGCTTTTCCTGCACCTGG + Intronic
944847582 2:203684148-203684170 AGCAGGGCTGTCCCTCCCCCTGG - Intergenic
947634487 2:231673159-231673181 AGAACGTCGGTCCCTGCCCAGGG - Intergenic
948257219 2:236577216-236577238 GGCATGGCTGTTGCTGCCCAAGG - Intronic
948335947 2:237207185-237207207 AGCACGGCTGAACCCACCCAGGG + Intergenic
1169123221 20:3109812-3109834 AGCAGGGGTCTTCCTGCCTAGGG + Exonic
1173003796 20:39124341-39124363 TGCAGGGCTAATCCTGCCCATGG - Intergenic
1174062047 20:47839721-47839743 AGCACTCCTCATCCTGCCCAAGG - Intergenic
1175925240 20:62468262-62468284 AGGCTGGCTGTTTCTGCCCATGG - Intronic
1175962827 20:62645785-62645807 AGCCAGGCCCTTCCTGCCCACGG + Intronic
1179801318 21:43812733-43812755 GGCATGGCTGGGCCTGCCCAGGG + Intergenic
1180763200 22:18224076-18224098 ATCACTGGTGTCCCTGCCCAAGG - Intergenic
1180772446 22:18400471-18400493 ATCACTGGTGTCCCTGCCCAAGG + Intergenic
1180877179 22:19179994-19180016 AGCAGAGCTCTTCCTGCCCATGG + Intronic
1181217894 22:21345172-21345194 ATCACTGGTGTCCCTGCCCAAGG - Intergenic
1181469790 22:23131012-23131034 GCCATGGCTGTTCCTGCCCAGGG - Intronic
1183414775 22:37675940-37675962 AGCACAGTTATTTCTGCCCAGGG + Intronic
1184191633 22:42898855-42898877 TGCACGGATGTTTCTGCACAGGG - Intronic
1184300922 22:43560522-43560544 AGCATGGCTGCCCCTACCCAAGG - Intronic
1185048005 22:48538582-48538604 AGCATGACTGTGCCTGCTCATGG + Intronic
1185419618 22:50728202-50728224 AGGAAGGCTGTGCCTGCCAAAGG - Intergenic
950854302 3:16091162-16091184 AGCATGCCAGTTCCTCCCCATGG + Intergenic
953326954 3:42020018-42020040 AGCTCAGCTGTTCATGCCAAAGG + Intronic
954541662 3:51397041-51397063 AGCAGGGCTTTACCTGCCCCTGG + Exonic
955173663 3:56590166-56590188 AGAAGGGCTGTTCTGGCCCATGG + Intronic
955320343 3:57969992-57970014 AGCTTGCCTCTTCCTGCCCAGGG + Intergenic
958733141 3:97979764-97979786 AACACTGCTGTGCCTGGCCAGGG + Intergenic
963601725 3:147384719-147384741 TTCACAGCTGTGCCTGCCCATGG - Intergenic
964335282 3:155648336-155648358 AGGACTGCTTTTCCTTCCCAAGG - Intronic
965229269 3:166029526-166029548 ACCCAGGATGTTCCTGCCCAGGG + Intergenic
966430298 3:179825125-179825147 AGCAGGGTTACTCCTGCCCAAGG - Intronic
968448932 4:666119-666141 AGCACGTCTGTGTCTGCCCCAGG + Intronic
968496377 4:919528-919550 AGCAGGCCCATTCCTGCCCAGGG + Intronic
968548899 4:1212557-1212579 TACACGGATGTTCCTGCCTATGG + Intronic
968818534 4:2833930-2833952 AGCAAGGCTGTGCTTGCCTAGGG + Exonic
968970824 4:3792654-3792676 TGAAGGGCTGTCCCTGCCCATGG - Intergenic
969291877 4:6245424-6245446 AGCACCGCACTCCCTGCCCAGGG - Intergenic
971669834 4:29542743-29542765 ACCCAGGCTGTTCCTGCCAAAGG + Intergenic
972607299 4:40625437-40625459 AGGACGCCTGTACCTGACCAAGG - Intronic
975040898 4:69743598-69743620 ACCAAGGCTGTTACTGCCAAGGG + Intronic
976668016 4:87621127-87621149 AGCACAGCAGTCCCTGGCCAGGG - Intergenic
977000465 4:91492429-91492451 AGCACTGCTGTCTCTTCCCAGGG + Intronic
977528947 4:98176987-98177009 AGCAGCACTGTTCATGCCCAGGG - Intergenic
978469712 4:109051010-109051032 TGCAAGGCTACTCCTGCCCAAGG - Intronic
981000819 4:139827043-139827065 AGCAGGGCTGTGAGTGCCCAAGG + Intronic
981550297 4:145936647-145936669 ACCGCGGCGGTGCCTGCCCAGGG - Intronic
985107104 4:186510195-186510217 AGCAGGGATGTTCCTTCTCATGG - Intronic
986128035 5:4901766-4901788 AGCATGGCTGGTCCTGCCATCGG + Intergenic
986507564 5:8468380-8468402 AGTACAGCTGCTCCTTCCCATGG + Intergenic
993678597 5:90847695-90847717 AGCACGGCAGCTGCTGGCCAAGG + Intronic
995297467 5:110538042-110538064 AGCCCGGTTGTTCATTCCCATGG - Intronic
998445012 5:142191775-142191797 AGGACGTGTGTTCCTCCCCATGG + Intergenic
999784766 5:154881127-154881149 AGCAAGGCTGTTGCTGCCAGTGG - Intergenic
1000170754 5:158701066-158701088 AGCATGGCTCTGCCTCCCCAAGG + Intronic
1001584459 5:172823970-172823992 AGCAGGGATGCTCCTGCCCCTGG - Intergenic
1002784845 6:392894-392916 CGGACGGCTGTGCCCGCCCAGGG + Intronic
1005775817 6:29129938-29129960 ACCCAGGCTGTTCCTGCCGAGGG - Intergenic
1005956205 6:30665211-30665233 AGCGCCGCTGCTCCTCCCCAGGG + Exonic
1006193710 6:32224254-32224276 AGCAGGGCTGGGACTGCCCAGGG - Intergenic
1007255214 6:40523628-40523650 TGCATGCCAGTTCCTGCCCAGGG - Intronic
1007721680 6:43888900-43888922 CCCACGTCTCTTCCTGCCCATGG + Intergenic
1009392182 6:63157364-63157386 AGCACTGTTGTTTGTGCCCAAGG - Intergenic
1012749551 6:103140430-103140452 ACCATGGCTGTTCGTGCCAAGGG + Intergenic
1015004608 6:128263952-128263974 AGCACAGCTGTTTCTTTCCAAGG + Intronic
1015892003 6:137978688-137978710 AGCATGACTGTTCCTGTTCAGGG + Intergenic
1017729733 6:157304897-157304919 CACAGGGCTGTTCCTGCCTAGGG - Intronic
1019022882 6:168933162-168933184 AGGATGGATGTTCCAGCCCACGG + Intergenic
1019102508 6:169642642-169642664 AGCCCGGCTCTGCCTGCCCTTGG + Intronic
1019277458 7:183261-183283 AGCCCAGCTGTGCCTGCCCTTGG - Intergenic
1019478604 7:1255809-1255831 AGCCCGGCTGAGCCGGCCCAGGG + Intergenic
1020082867 7:5296109-5296131 GGGACGGGTGTTCCTGGCCAGGG - Intronic
1024060829 7:45697319-45697341 GGCACAGCTGGTCCTGCCCCTGG - Intronic
1024367664 7:48539789-48539811 AGCATGTCTGTTTCTGCACAAGG - Intronic
1025232405 7:57211442-57211464 AGCACTCCTCGTCCTGCCCAAGG + Intergenic
1026509313 7:71015447-71015469 AGCAGGACTGTTCCATCCCAAGG - Intergenic
1027050509 7:75018672-75018694 AGCACCACAGTCCCTGCCCAGGG - Intronic
1027337074 7:77162581-77162603 AGCATTGTTGTTCCTGCCTAAGG + Intronic
1029382537 7:100222998-100223020 AGCACCACAGTCCCTGCCCAGGG + Intronic
1029778723 7:102708528-102708550 AGCATTGTTGTTCCTGCTCAAGG - Intergenic
1031782393 7:125985196-125985218 AGTTTGGCTGTTCCTGGCCAGGG + Intergenic
1033221087 7:139526431-139526453 AGCAGGGCTGCTCCTCTCCAGGG + Intronic
1034936605 7:155204209-155204231 AGCACGGGTGTCCAAGCCCATGG - Intergenic
1035595811 8:856758-856780 AGCACGGATTTTCCTGTCCAGGG - Intergenic
1037085216 8:14840459-14840481 ATCACAGCTTTTCCTGGCCACGG - Intronic
1042604041 8:70528364-70528386 AGCAGGGAAGCTCCTGCCCATGG + Intergenic
1043188833 8:77190791-77190813 AGCAGGGCTGTGGCTGCCGAGGG + Intergenic
1043912128 8:85875394-85875416 AGCACAGCTGTCCCCTCCCAAGG + Intergenic
1044053790 8:87542801-87542823 ACCCAGGCTGTTCCTGCCAAAGG + Intronic
1044999846 8:97869522-97869544 AGCGCGGCTTGTCCTGCGCAGGG - Intronic
1048057641 8:130883658-130883680 TTCCCTGCTGTTCCTGCCCAAGG + Intronic
1049116563 8:140693648-140693670 AGCCCGGATGCTCTTGCCCAAGG - Intronic
1049395434 8:142398067-142398089 AGCACTGCTGTGCCTTCCCTTGG + Intronic
1060377304 9:123128213-123128235 AGCACAGCTGCCCCTGCCTATGG - Exonic
1061370085 9:130193132-130193154 AGCTGTGCTGTTGCTGCCCAGGG + Intronic
1061928874 9:133822009-133822031 AGCACGGCTGTAGCTCTCCAGGG + Intronic
1189998827 X:46665036-46665058 AGCAAGTCTGTGCCTGACCACGG + Intronic
1190503304 X:51100244-51100266 AGCAGTGCTATTCCTGTCCAGGG - Intergenic
1193650379 X:84123729-84123751 AGCATGCCTGGTCCTGCCCGGGG + Intronic
1195367041 X:104136434-104136456 AGCACTGCCGTTCCTGCCCAAGG - Intronic
1196564560 X:117189535-117189557 AGCACCTCTGGACCTGCCCAGGG + Intergenic