ID: 1117724524

View in Genome Browser
Species Human (GRCh38)
Location 14:58659924-58659946
Sequence AGATATGCCCTGAGAATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117724524_1117724534 11 Left 1117724524 14:58659924-58659946 CCACCCATTCTCAGGGCATATCT No data
Right 1117724534 14:58659958-58659980 ATTCTGGAACATTCCCTTGGGGG No data
1117724524_1117724537 24 Left 1117724524 14:58659924-58659946 CCACCCATTCTCAGGGCATATCT No data
Right 1117724537 14:58659971-58659993 CCCTTGGGGGGCCTGATCTCAGG No data
1117724524_1117724533 10 Left 1117724524 14:58659924-58659946 CCACCCATTCTCAGGGCATATCT No data
Right 1117724533 14:58659957-58659979 CATTCTGGAACATTCCCTTGGGG No data
1117724524_1117724535 12 Left 1117724524 14:58659924-58659946 CCACCCATTCTCAGGGCATATCT No data
Right 1117724535 14:58659959-58659981 TTCTGGAACATTCCCTTGGGGGG No data
1117724524_1117724531 8 Left 1117724524 14:58659924-58659946 CCACCCATTCTCAGGGCATATCT No data
Right 1117724531 14:58659955-58659977 CACATTCTGGAACATTCCCTTGG No data
1117724524_1117724540 26 Left 1117724524 14:58659924-58659946 CCACCCATTCTCAGGGCATATCT No data
Right 1117724540 14:58659973-58659995 CTTGGGGGGCCTGATCTCAGGGG No data
1117724524_1117724539 25 Left 1117724524 14:58659924-58659946 CCACCCATTCTCAGGGCATATCT No data
Right 1117724539 14:58659972-58659994 CCTTGGGGGGCCTGATCTCAGGG No data
1117724524_1117724528 -5 Left 1117724524 14:58659924-58659946 CCACCCATTCTCAGGGCATATCT No data
Right 1117724528 14:58659942-58659964 TATCTCCAGGATCCACATTCTGG No data
1117724524_1117724532 9 Left 1117724524 14:58659924-58659946 CCACCCATTCTCAGGGCATATCT No data
Right 1117724532 14:58659956-58659978 ACATTCTGGAACATTCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117724524 Original CRISPR AGATATGCCCTGAGAATGGG TGG (reversed) Intergenic
No off target data available for this crispr