ID: 1117732447

View in Genome Browser
Species Human (GRCh38)
Location 14:58736940-58736962
Sequence CAAGGTAATCAGAGAGAGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117732443_1117732447 16 Left 1117732443 14:58736901-58736923 CCATCTACATTTAGGGGTGAATG No data
Right 1117732447 14:58736940-58736962 CAAGGTAATCAGAGAGAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117732447 Original CRISPR CAAGGTAATCAGAGAGAGAC CGG Intergenic
No off target data available for this crispr