ID: 1117733982

View in Genome Browser
Species Human (GRCh38)
Location 14:58751152-58751174
Sequence GCCGCCCTTAGCCCCCACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117733982_1117733985 -5 Left 1117733982 14:58751152-58751174 CCTGAGTGGGGGCTAAGGGCGGC No data
Right 1117733985 14:58751170-58751192 GCGGCTCTGCATGGGCCTTTAGG No data
1117733982_1117733987 19 Left 1117733982 14:58751152-58751174 CCTGAGTGGGGGCTAAGGGCGGC No data
Right 1117733987 14:58751194-58751216 GTCCCTCAGCATGAATAGCCTGG No data
1117733982_1117733988 20 Left 1117733982 14:58751152-58751174 CCTGAGTGGGGGCTAAGGGCGGC No data
Right 1117733988 14:58751195-58751217 TCCCTCAGCATGAATAGCCTGGG No data
1117733982_1117733991 30 Left 1117733982 14:58751152-58751174 CCTGAGTGGGGGCTAAGGGCGGC No data
Right 1117733991 14:58751205-58751227 TGAATAGCCTGGGTGACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117733982 Original CRISPR GCCGCCCTTAGCCCCCACTC AGG (reversed) Intergenic
No off target data available for this crispr