ID: 1117734774

View in Genome Browser
Species Human (GRCh38)
Location 14:58757330-58757352
Sequence GGTTAAGAATGGTGGCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117734770_1117734774 -10 Left 1117734770 14:58757317-58757339 CCACATGGCTTGGGGTTAAGAAT No data
Right 1117734774 14:58757330-58757352 GGTTAAGAATGGTGGCCTCAGGG No data
1117734764_1117734774 4 Left 1117734764 14:58757303-58757325 CCTCTAGGGCCTGCCCACATGGC No data
Right 1117734774 14:58757330-58757352 GGTTAAGAATGGTGGCCTCAGGG No data
1117734769_1117734774 -9 Left 1117734769 14:58757316-58757338 CCCACATGGCTTGGGGTTAAGAA No data
Right 1117734774 14:58757330-58757352 GGTTAAGAATGGTGGCCTCAGGG No data
1117734768_1117734774 -5 Left 1117734768 14:58757312-58757334 CCTGCCCACATGGCTTGGGGTTA No data
Right 1117734774 14:58757330-58757352 GGTTAAGAATGGTGGCCTCAGGG No data
1117734760_1117734774 20 Left 1117734760 14:58757287-58757309 CCACATGGCATCTCATCCTCTAG No data
Right 1117734774 14:58757330-58757352 GGTTAAGAATGGTGGCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117734774 Original CRISPR GGTTAAGAATGGTGGCCTCA GGG Intergenic
No off target data available for this crispr