ID: 1117736381

View in Genome Browser
Species Human (GRCh38)
Location 14:58773082-58773104
Sequence TACCCACGGTTCCCACGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117736381_1117736388 3 Left 1117736381 14:58773082-58773104 CCAGTCCGTGGGAACCGTGGGTA No data
Right 1117736388 14:58773108-58773130 GGGTCTGTTCTCGTTAAGTCAGG No data
1117736381_1117736391 17 Left 1117736381 14:58773082-58773104 CCAGTCCGTGGGAACCGTGGGTA No data
Right 1117736391 14:58773122-58773144 TAAGTCAGGTGTAGGGACCCAGG No data
1117736381_1117736389 9 Left 1117736381 14:58773082-58773104 CCAGTCCGTGGGAACCGTGGGTA No data
Right 1117736389 14:58773114-58773136 GTTCTCGTTAAGTCAGGTGTAGG No data
1117736381_1117736393 24 Left 1117736381 14:58773082-58773104 CCAGTCCGTGGGAACCGTGGGTA No data
Right 1117736393 14:58773129-58773151 GGTGTAGGGACCCAGGAGGTTGG No data
1117736381_1117736392 20 Left 1117736381 14:58773082-58773104 CCAGTCCGTGGGAACCGTGGGTA No data
Right 1117736392 14:58773125-58773147 GTCAGGTGTAGGGACCCAGGAGG No data
1117736381_1117736390 10 Left 1117736381 14:58773082-58773104 CCAGTCCGTGGGAACCGTGGGTA No data
Right 1117736390 14:58773115-58773137 TTCTCGTTAAGTCAGGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117736381 Original CRISPR TACCCACGGTTCCCACGGAC TGG (reversed) Intergenic
No off target data available for this crispr