ID: 1117741285 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:58821732-58821754 |
| Sequence | CATCAGAACCAGATGGAACT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1117741285_1117741290 | 0 | Left | 1117741285 | 14:58821732-58821754 | CCCAGTTCCATCTGGTTCTGATG | No data | ||
| Right | 1117741290 | 14:58821755-58821777 | CCTGGCTATATTTCTGTCCTTGG | No data | ||||
| 1117741285_1117741291 | 1 | Left | 1117741285 | 14:58821732-58821754 | CCCAGTTCCATCTGGTTCTGATG | No data | ||
| Right | 1117741291 | 14:58821756-58821778 | CTGGCTATATTTCTGTCCTTGGG | No data | ||||
| 1117741285_1117741292 | 11 | Left | 1117741285 | 14:58821732-58821754 | CCCAGTTCCATCTGGTTCTGATG | No data | ||
| Right | 1117741292 | 14:58821766-58821788 | TTCTGTCCTTGGGTTCCTTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1117741285 | Original CRISPR | CATCAGAACCAGATGGAACT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||