ID: 1117741285

View in Genome Browser
Species Human (GRCh38)
Location 14:58821732-58821754
Sequence CATCAGAACCAGATGGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117741285_1117741290 0 Left 1117741285 14:58821732-58821754 CCCAGTTCCATCTGGTTCTGATG No data
Right 1117741290 14:58821755-58821777 CCTGGCTATATTTCTGTCCTTGG No data
1117741285_1117741291 1 Left 1117741285 14:58821732-58821754 CCCAGTTCCATCTGGTTCTGATG No data
Right 1117741291 14:58821756-58821778 CTGGCTATATTTCTGTCCTTGGG No data
1117741285_1117741292 11 Left 1117741285 14:58821732-58821754 CCCAGTTCCATCTGGTTCTGATG No data
Right 1117741292 14:58821766-58821788 TTCTGTCCTTGGGTTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117741285 Original CRISPR CATCAGAACCAGATGGAACT GGG (reversed) Intergenic
No off target data available for this crispr