ID: 1117744948

View in Genome Browser
Species Human (GRCh38)
Location 14:58860246-58860268
Sequence GTATGCAAGCACACTATCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117744948_1117744954 3 Left 1117744948 14:58860246-58860268 CCTCAGATAGTGTGCTTGCATAC No data
Right 1117744954 14:58860272-58860294 GGGTATGGAGTCCAGCTGGGAGG No data
1117744948_1117744953 0 Left 1117744948 14:58860246-58860268 CCTCAGATAGTGTGCTTGCATAC No data
Right 1117744953 14:58860269-58860291 TAAGGGTATGGAGTCCAGCTGGG No data
1117744948_1117744952 -1 Left 1117744948 14:58860246-58860268 CCTCAGATAGTGTGCTTGCATAC No data
Right 1117744952 14:58860268-58860290 CTAAGGGTATGGAGTCCAGCTGG No data
1117744948_1117744957 28 Left 1117744948 14:58860246-58860268 CCTCAGATAGTGTGCTTGCATAC No data
Right 1117744957 14:58860297-58860319 CTGCCTTTAGCCCTCGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117744948 Original CRISPR GTATGCAAGCACACTATCTG AGG (reversed) Intergenic
No off target data available for this crispr