ID: 1117744952

View in Genome Browser
Species Human (GRCh38)
Location 14:58860268-58860290
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117744948_1117744952 -1 Left 1117744948 14:58860246-58860268 CCTCAGATAGTGTGCTTGCATAC No data
Right 1117744952 14:58860268-58860290 CTAAGGGTATGGAGTCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117744952 Original CRISPR CTAAGGGTATGGAGTCCAGC TGG Intergenic
No off target data available for this crispr