ID: 1117748248

View in Genome Browser
Species Human (GRCh38)
Location 14:58893204-58893226
Sequence CAGAAAAAGGGGCAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117748240_1117748248 21 Left 1117748240 14:58893160-58893182 CCTTGGGGGAGAGAAATTTTGGT No data
Right 1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117748248 Original CRISPR CAGAAAAAGGGGCAGGAGAC AGG Intergenic
No off target data available for this crispr