ID: 1117754811

View in Genome Browser
Species Human (GRCh38)
Location 14:58963780-58963802
Sequence AGCCAGTTCTTAAGGTAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117754811_1117754814 -9 Left 1117754811 14:58963780-58963802 CCAACTTACCTTAAGAACTGGCT No data
Right 1117754814 14:58963794-58963816 GAACTGGCTCATCAGACTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117754811 Original CRISPR AGCCAGTTCTTAAGGTAAGT TGG (reversed) Intergenic
No off target data available for this crispr