ID: 1117755704

View in Genome Browser
Species Human (GRCh38)
Location 14:58972099-58972121
Sequence GACAATGACGTCGCTTCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117755704_1117755708 -6 Left 1117755704 14:58972099-58972121 CCTGTTGAAGCGACGTCATTGTC No data
Right 1117755708 14:58972116-58972138 ATTGTCTGGGGTAATATCTGAGG No data
1117755704_1117755709 9 Left 1117755704 14:58972099-58972121 CCTGTTGAAGCGACGTCATTGTC No data
Right 1117755709 14:58972131-58972153 ATCTGAGGTTCGTCGTCTCATGG No data
1117755704_1117755710 15 Left 1117755704 14:58972099-58972121 CCTGTTGAAGCGACGTCATTGTC No data
Right 1117755710 14:58972137-58972159 GGTTCGTCGTCTCATGGCCATGG No data
1117755704_1117755711 24 Left 1117755704 14:58972099-58972121 CCTGTTGAAGCGACGTCATTGTC No data
Right 1117755711 14:58972146-58972168 TCTCATGGCCATGGAAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117755704 Original CRISPR GACAATGACGTCGCTTCAAC AGG (reversed) Intergenic
No off target data available for this crispr