ID: 1117756521

View in Genome Browser
Species Human (GRCh38)
Location 14:58979926-58979948
Sequence ATGTAGTAGATGTATGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117756518_1117756521 30 Left 1117756518 14:58979873-58979895 CCTTTTCTGTTTGAACAATTCAC No data
Right 1117756521 14:58979926-58979948 ATGTAGTAGATGTATGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117756521 Original CRISPR ATGTAGTAGATGTATGATGT GGG Intergenic
No off target data available for this crispr