ID: 1117760363

View in Genome Browser
Species Human (GRCh38)
Location 14:59020940-59020962
Sequence AGCCACCCCCACTGGAAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117760363_1117760370 -6 Left 1117760363 14:59020940-59020962 CCCCACTTCCAGTGGGGGTGGCT No data
Right 1117760370 14:59020957-59020979 GTGGCTTGAAGACCAGGGGCTGG No data
1117760363_1117760369 -10 Left 1117760363 14:59020940-59020962 CCCCACTTCCAGTGGGGGTGGCT No data
Right 1117760369 14:59020953-59020975 GGGGGTGGCTTGAAGACCAGGGG No data
1117760363_1117760372 20 Left 1117760363 14:59020940-59020962 CCCCACTTCCAGTGGGGGTGGCT No data
Right 1117760372 14:59020983-59021005 CACCTGAATGCTCATATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117760363 Original CRISPR AGCCACCCCCACTGGAAGTG GGG (reversed) Intergenic
No off target data available for this crispr