ID: 1117760365

View in Genome Browser
Species Human (GRCh38)
Location 14:59020942-59020964
Sequence CAAGCCACCCCCACTGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117760365_1117760372 18 Left 1117760365 14:59020942-59020964 CCACTTCCAGTGGGGGTGGCTTG No data
Right 1117760372 14:59020983-59021005 CACCTGAATGCTCATATGTCTGG No data
1117760365_1117760370 -8 Left 1117760365 14:59020942-59020964 CCACTTCCAGTGGGGGTGGCTTG No data
Right 1117760370 14:59020957-59020979 GTGGCTTGAAGACCAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117760365 Original CRISPR CAAGCCACCCCCACTGGAAG TGG (reversed) Intergenic