ID: 1117760370

View in Genome Browser
Species Human (GRCh38)
Location 14:59020957-59020979
Sequence GTGGCTTGAAGACCAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117760364_1117760370 -7 Left 1117760364 14:59020941-59020963 CCCACTTCCAGTGGGGGTGGCTT No data
Right 1117760370 14:59020957-59020979 GTGGCTTGAAGACCAGGGGCTGG No data
1117760365_1117760370 -8 Left 1117760365 14:59020942-59020964 CCACTTCCAGTGGGGGTGGCTTG No data
Right 1117760370 14:59020957-59020979 GTGGCTTGAAGACCAGGGGCTGG No data
1117760361_1117760370 -3 Left 1117760361 14:59020937-59020959 CCACCCCACTTCCAGTGGGGGTG No data
Right 1117760370 14:59020957-59020979 GTGGCTTGAAGACCAGGGGCTGG No data
1117760363_1117760370 -6 Left 1117760363 14:59020940-59020962 CCCCACTTCCAGTGGGGGTGGCT No data
Right 1117760370 14:59020957-59020979 GTGGCTTGAAGACCAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117760370 Original CRISPR GTGGCTTGAAGACCAGGGGC TGG Intergenic
No off target data available for this crispr